The blood in the right ventricle of the
heart must reach the left ventricle by way
of the lungs and not through a passage
connecting the ventricles.
[Ibn al-Nafis (d.1288/678). commentary on
the Canon of Medicine by Ibn Sina
(Avicenna)]
My Father
for his uncompromising principles that guided my life
My Mother
for leading her children into intellectual pursuits
My WIFE
for her magnificent and infinite give and support
My Children
For making everything worthwhile
Most patients with hypertrophic cardiomyopathy and congenital heart diseases express the atrial essential myosin light chains (ALC-1) in their ventricles, partially replacing the ventricular essential light chains (VLC-1). This VLC-1/ALC-1 isoform shift is correlated with an increase in cross-bridge cycling kinetics as measured using chemically skinned fibers from the hypertrophied ventricles of human hearts. To study the functional importance of hALC-1 in the whole intact perfused-heart, a transgenic rat model overexpressing hALC-1 (TGR/hALC-1) in the heart was generated. WKY rats were used as the respective genetically correct control strain.
Using hALC-1HIST protein as a standard, the amount of transgenic protein expression was quantified by Immunoblot analysis of the left ventricular tissue extracts of the transgenic rats. Twelve-week-old TGR/hALC-1 expressed around 17μg hALC-1 per mg of whole SDS-soluble protein.
The transgene was localized in-between the Z-lines of the sarcomere by immunofluoresecnce microscopy. Furthermore, the proper integration of the transgene into the rat ventricular myosin was confirmed by purifying myosin from rat ventricular tissues.
Whole ventricular proteome analysis by 2D-PAGE, resolved approximately 3000 proteins spots in each TGR/hALC-1 and WKY animal. The whole protein expression patterns in both animal groups showed no differences with the exception of the transgenic hALC-1 protein spot.
The perfused heart contractility parameters were evaluated using the Langendorff preparation. Expression of hALC-1 was accompanied by statistically significant improvements (p<0.001) in all measured contractile parameters of the hearts of the TGR/hALC-1 compared to the age matched control (WKY) animals, represented by increases in the developed left ventricular pressure, maximal rate of pressure increase and the relaxation rate. Age dependent decrease in the transgene expression caused a decline of the improved contractility parameters to normal values.
Die meisten Patienten mit hypertropher Kardiomyopathie und kongenitalen Herzerkrankungen exprimieren die atriale essentielle leichte Myosinkette (ALC-1) im Ventrikel, wo sie teilweise die ventrikuläre essentielle leichte Myosinkette (VLC-1) ersetzt. Diese VLC-1/ALC-1 Isoformveränderung korrelierte mit einem Anstieg der Zykluskinetik der Myosin-Querbrücken in chemisch gehäuteten Herzfasern aus hypertrophierten Humanventrikeln. Um die funktionelle Bedeutung der ALC-1 im gesamten intakten Herzen zu untersuchen, habe ich in der vorliegenden Arbeit ein transgenes Rattenmodell charakterisiert, das die humane ALC-1 (hALC-1) im Herzen exprimiert (TGR/hALC-1). WKY-Ratten dienten als genetisch korrekter Kontrollstamm.
Mittels rekombinanter hALC-1 als Standard wurde die exprimierte hALC-1-Menge in SDS-Extrakten linker Ventrikel der TGR/hALC-1 im Western-Blot untersucht. 12 Wochen alte TGR/hALC-1 exprimierten etwa 17 µg hALC-1/mg SDS-Extrakt. Das exprimierte Transgen konnte in der Immunfluoreszenz zwischen den Z-Linien der Sarkomere lokalisiert werden. Die gerichtete Integrations des Transgens in das kardiale Myosinmolekül wurde zusätzlich noch in hochgereinigten Myosinpräparationen nachgewiesen.
Analyse des linksventrikulären Proteoms durch 2D-PAGE, das zur Identifikation von etwa 3000 Proteinen führte, zeigte vergleichbare Proteinmuster in WKY und TGR/hALC-1.
Die Untersuchungen der Kontraktilität des intakten isoliert perfundierten Herzen wurden mit Langendorff-Präparationen durchgeführt. Die Expression des hALC-1-Transgen führte zu statistisch signifikanten (p<0.001) Steigerungen aller gemessenen Kontraktilitätsparameter (linksventrikuläre Druckentwicklung, maximale Geschwindigkeit der Kraftentwicklung, maximale Erschlaffungsgeschwindigkeit). Die altersbedingte Abnahme der Transgenexpression führte zu einer Abnahme der verbesserten Kontraktilitätsparameter auf das Kontrollniveau der WKY-Tiere.
Cardiac contraction is driven by the cyclic interaction of the motor protein type II myosin with the actin filament, consuming ATP as the energy source to produce tension or shortening. Characterization of the functions of myosin and its subunits on the molecular level provides important steps in the understanding of the physiological and pathophysiological states of the heart.
The release of Ca2+from the sarcoplasmic reticulum (SR) following membrane depolarization and subsequent Ca2+-induced myofilament activation is referred to as excitation–contraction coupling (ECC) (Fig. 1). Myocardial contraction is activated by a transient rise in cytosolic free calcium concentration [Ca2+] to about 1 μM from a resting diastolic [Ca2+]of about 0.1 μM. Despite a rather modest rise in the average free [Ca2+], activation of the contractile proteins typically requires the binding of between 40 and 60 μM total Ca2+. The bulk of this Ca2+required for activation of contraction originates from the sarcoplasmic reticulum (SR), with Ca2+influx through L-type Ca2+channels and Na+–Ca2+exchangers (NCX) making more minor contributions, although the relative contribution varies between species (Bers 2002).
A central feature of ECC is the gating of SR Ca2+release channels (called ryanodine or RyRs receptors), where gating refers to the opening (or activation) and the closing of individual RyRs channels located within the terminal cisternae of the SR. Gating of RyRs channels is controlled primarily by elevations of [Ca2+]in the subsarcolemmal space between the T-tubular membrane of the sarcolemma and the terminal cisternae of the SR, which occurs following the opening of sarcolemmal L-type Ca2+ channels in response to membrane depolarization (Lopez-Lopez et al. 1994; Lopez-Lopez et al. 1995). The amplification process whereby elevated subsarcolemmal Ca2+ ‘triggers’ further Ca2+release from the SR is called Ca2+-induced Ca2+release (CICR).
Relaxation of myocyte contraction involves the extrusion of Ca2+from the cytosol. At steady state, the majority of relaxation involves Ca2+reuptake into the SR by the Ca2+-
Cardiomyocytes contains large number of myofilaments that are organized in a regular array of cross-striations. The cross striations of the myocardium reflect the organization of the contractile proteins into thick and thin filaments. The thick filaments, which are composed largely of myosin, extend the length of the A-band to which they contribute both its darkly staining characteristics and its high birefringence. The thin filaments are composed of actin and the regulatory proteins tropomyosin and troponin complex, they extend the length of the I-bands to which they contribute both its lightly staining striations and less birefringent. A broad dense M-band is found in the center of each A-band, while the I-bands are bisected by Z-lines. The latter delimit the fundamental morphologic unit of striated muscle, the sarcomere, which is defined as the region between two Z-lines. Each sarcomere thus consists of a central A-band plus two adjacent half I-bands. (Fig. 2) (Katz 2001).
During systole the thin filaments are drawn toward the center of the sarcomere by movements of the myosin cross-bridges, which project from the thick filaments to establish bonds with the thin filaments. The thin filaments extend from the Z-lines at either end of the sarcomere into the A-bands, where the extent of overlap between the thick and thin filaments depends on sarcomere length (Katz 2001).
Although these proteins do not participate directly in the contractile process, they maintain sarcomere structure and provide mechanical linkages that convey the tension developed by the contractile proteins to adjacent sarcomeres and ultimately to the ends of the muscle (Schiaffino et al. 1996)
At least five proteins are present in the thick filaments contain amino acid sequences that resemble both fibronectin and immunoglobulins (Helmes et al. 1996; Linke et al. 1997; Small et al. 1992). Titin which is also called connectin, is one of the largest known proteins with a molecular weight of about 3,000,000, extends into the thick filaments from the Z-lines (Fig. 3). Titin includes both an elastic region, which is located in the I-band, and a rigid region that supports the thick filaments within the A-bands.
Myosin binding protein C, also called C protein (MW-140,000), which links the thick filaments and titin in the central third of the A-band, plays a role in sarcomere formation (Fig. 3) and contains a number of phosphorylation sites that regulate contractility (Winegrad 1999). Myosin binding protein H (MW-74,000) is present in the purkinje fibers but not in working cardiac myocytes (Alyonycheva et al. 1997). M-protein and myomesin (MW-185,000) contribute to a set of transverse striations, called M-band, which link the thick filaments in the center of the A-band (Fig. 3). These proteins participate in myofibrillogenesis and stabilize interaction between titin and the thick filaments. Nebulette (MW-107,000) is oriented along the axis of the thin filament and projects from the Z-lines into the I-bands (Moncman et al. 1995). Tropomodulin (MW-43,000) is a capping protein, and is found at the ends of the of the thin filaments where, by covering the end of the F-actin polymer (Fig. 3), it helps to determine thin filament length (Sussman et al. 1994). α –Actinin (MW-140,000) and Cap Z (β-actinin) (MW-38,000), they weave the ends of thin filaments into the Z-lines at the ends of each sarcomere (Fig. 3).
The main site for Ca+2regulation is the thin filament. Figure 4A is a diagram of the thin filament in striated muscle showing the three components: actin, tropomyosin (Tm), and troponin (Tn) with the three Tn subunits (Gordon et al. 2000).
Monomeric globular actin (G-actin) polymerizes spontaneously to form the backbone of the thin filament, F-actin. The double helical structure of F-acin as two-stranded long-pitch helical structure is evident form electron microscopy of isolated filaments and X-ray diffraction patterns form actin bundles and intact muscle. There are grooves between the two so-called long pitch strands; tropomyosin molecules lie along these grooves such that each tropomyosin molecule interacts with seven actin monomers, There is one troponin complex associated with each tropomyosin molecule (Fig. 4A) (Gordon et al. 2000).
G-actin comprises a single polypeptide chain (mol. Wt 42 000), which binds Ca+2 and ATP reversibly. The structure of the actin monomer (Fig. 4B) was determined at atomic resolution (Holmes et al. 1990; Kabsch et al. 1990) into the actin filament helix by modeling against fiber X-ray diffraction patterns from aligned gels of actin filaments (Popp et al. 1987; Popp et al. 1991). The resulting structure is shown in Figure 4B. Each actin monomer comprises four subdomains. Structure positions of subdomains 3 and 4 close to the helix axis, where they interact with subdomains 3 and 4 of other actin monomers. Subdomains 1 and 2 are on the outside of the helix. Subdomain 1 contains the amino and carboxyl termini of the molecule (Holmes et al. 1990).
Tropomyosin (Tm) forms an α helical coiled-coil dimmer. Each tropomyosin molecule extends across seven actin monomers in the thin filament and overlaps with neighbouring tropomyosin by about eight residues to form a continuous, rather flexible structure. Image reconstruction studies indicate that tropomyosin lies in the groove of the actin bound to the inner (large) domain of actin (Fig. 4A). One troponin is bound to each tropomyosin dimer, the bulk of the troponin lying about 20nm from the tropomyosin C-terminus (Fig. 4A) (Milligan et al. 1990).
TnC is the myofibrillar protein that by binding Ca2+, transmits the signal to the thin filament. The structure of TnC has been solved to atomic resolution by X-ray crystallography; it consists of two globular domains corresponding to the amino and carboxyl termini, and these are linked by a central, nine-turn α-helix. Each globular domain contains two divalent metal binding sites formed from the helix-loop-helix EF hand motif. The two metal binding sites in the amino-terminal domain are Ca2+specific and are believed to be the regulatory sites (i.e., Ca2+ binding to these sites is believed to trigger activation). TnC interacts both with TnI and TnT. TnC interacts more strongly with TnI when Ca2+is not bound to the TnC regulatory sites; modulation of this interaction is believed to be the regulatory mechanism within the troponin complex (Herzberg et al. 1985).
Troponin and tropomyosin exert their regulatory effect in the thin filament by causing inhibition when TnC has no Ca2+bound to the regulatory sites. The actin filament without its regulatory proteins is intrinsically active; that is, it activates myosin ATPase and supports force production and movement. TnI has a major role in inhibiting this activity. In fact, on its own, TnI has an effect on actin filament activity similar to the whole troponin complex at low [Ca2+]. Besides its interaction with TnC, TnI appears
to interact with TnT and actin. The interaction with actin is particularly important: it is thought that through this link TnI exerts its regulatory effect and this interaction is modulated by Ca2+ binding to TnC (Squire et al. 1998).
TnT is involved in the attachment of the troponin complex to tropomyosin and thus to actin. It is a rodlike molecule with amino and carboxyl termini at opposite ends. The amino-terminal region binds to the head–tail junction of tropomyosin; the carboxyl-terminal region is closely associated with TnC and TnI (Squire et al. 1998).
Contraction occurs when myosin S1 heads of the thick filament attach to and exert force on actin molecules in the thin filament (Geeves et al. 1999; Xu et al. 1999). This force causes the thin filament to slide over the thick filament and the sarcomere to shorten and develop force against a load. Ca2+binding to troponin (Tn) on the thin filament initiates the force-generating interaction of myosin and actin, and ATP hydrolysis provides the energy for the molecular changes that drive force generation and muscle shortening. Regulation by Ca2+is mediated through changes in the thin filament, although modulation can occur through myosin (Gordon et al. 2001).
Figure 5A shows the salient structural features of thin filament regulation. Helically arranged actins form the backbone of the thin filament, with the regulatory proteins tropomyosin (Tm) and troponin Tn attached to actin in a 7:1:1 (A:Tm:Tn) ratio. Tm, a long, flexible molecule, binds to seven actin monomers in the thin filament helix and overlaps the adjacent Tm. Tn attaches to two actins in the absence of Ca2+ through its TnI subunit and to Tm through the TnT subunit.
Ca2+binding to the TnC subunit strengthens the TnC-TnI interaction and detaches TnI from its contacts with actin. Recent structural studies (Vibert et al. 1997) show that this Ca2+-mediated detachment of TnI from actin allows Tm to move over the surface of the thin filament. On the actin surface, there are sites for weak (mainly electrostatic) and strong myosin binding (Fig. 5A). Tm either rolls around its axis or slides from a position near the outer edge of the thin filament [where it covers many of the myosin binding sites on actin (Fig. 5B)] to a position allowing increased weak and some strong myosin head binding (Fig. 5C). Tm is a flexible molecule, and its positioning should be considered dynamic; Tm does not occupy a single fixed position in the presence of elevated [Ca2+] but “rocks and rolls” or “slips and slides” back and forth over the actin surface. The Tm positions (Fig. 5, B–D) should therefore be considered average positions. When myosin cross-bridge is strongly bound to actin, Tm is locally stabilized in a position that makes both weak and strong myosin binding sites available on nearby actin monomers (Fig. 5D).
The motor protein, myosin II, is composed of two heavy chains with molecular masses of 200 kDa each and four light chains, two each of so called essential and regulatory light chains (MLC 1 and MLC 2,respectively), of molecular mass 20 kDa. The heavy chains form a parallel two-chain coiled-coil structure over most of their length except for the large, globular NH2-terminal regions, termed heads or S1 (subfragment 1). One pair of light chains bind to each S1. The coiled-coil region of the myosin, termed the myosin rod (tail). The S1 head structure projecting from the backbone of the thick filament interacts with actin to generate force and filament sliding (Fig. 6) (Sellers et al. 1995).
The 50-KDa domain is split by a long narrow cleft with actin-binding sites located on both sides of the cleft. Also the ATP-binding (active) site forms an open cleft and is located opposite to the actin-binding site at the 25/50 KDa junction. The apex of the long cleft through the 50 KDa domain is very close to the nucleotide binding cleft, thus mediating signal transduction between the actin and nucleotide binding clefts.
Amino acids 771-843 at the C-terminus form an 8.5 nM α- helical structure, the neck region that binds two types of light chains. The essential myosin light chain binds between amino acid 783 and 806 and the regulatory light chains further downstream between amino acids 808 and 842. A so-called converter domain joins the catalytic and light chain binding domains (around amino acids 711-771).
The swinging-cross-bridge hypothesis of muscle contraction (featured in most text books) was recently modified into swinging-lever arm hypothesis in which the bulk of the cross-bridge is envisaged to bind to actin without rolling on the surface during the power stroke (as had been initially suggested); large movements are envisaged as coming from the distal (C-terminal) part of the myosin cross-bridge moving as a lever arm (Geeves et al. 1999).
The structural changes in the cross-bridges are associated with the strain of an elastic component present in the cross-bridges, which operates over a range of 8–10 nm (Huxley et al. 1971). The α-helical neck domain is believed to function as a lever arm which swings relative to the catalytic domain: picometer changes in the active site of S1 are magnified into nanometers of motion by rotation of the converter domain (Eisenberg et al. 1985; Holmes 1997). In fact, truncation and elongation of the light chain binding domains show that the sliding velocity of actin filaments is proportional to the length of the lever arm (Uyeda et al. 1996). Furthermore, the light chain binding domain, rather than the catalytic domain, reveals tilting motions during length perturbations of an isometrically contracting muscle (Hopkins et al. 1998; Irving et al. 1995; Lombardi et al. 1995). The elastic element of the cross-bridge may therefore reside in the lever arm (Howard et al. 1996).
In the intact contractile structure the ATP- or ADP-Pi- loaded MHC binds (as the cross-bridge) to the N-terminus of actin. Myosin undergoes changes in actin affinity and structure, being strongly attached to actin (having high affinity) or weakly attached (having low affinity) (Brenner 1988; Eisenberg et al. 1985). Force is generated upon the transition from the weakly to the strongly attached state. This transition is considered to be coupled to the Pi release step (Dantzig et al. 1992). Figure 8 shows the structural and biochemical events in a cross bridge cycle (Gordon et al. 2001):
Step 2: The subsequent detachment of actin from the actin-myosin·ATP (A~M·ATP) complex is similarly rapid and is caused by an opening between myosin’s upper and lower 50-kDa regions like the opening of jaws.
Step 3: A “flexing” or bending of the myosin neck region accompanies the hydrolytic cleavage of ATP, whose equilibrium constant (K3, defined as k+3/k–3) is only ~10.
Step 4: Following ATP cleavage, myosin again binds weakly to actin at a high rate, but in the absence of Ca2+Tm sterically blocks access of the myosin head to strong binding sites on actin (Fig. 8B). However, when Ca2+is bound to TnC, TnI detaches from actin, allowing the Tm/Tn complex to roll or slide over the thin filament surface. This exposes weak binding sites on actin and transiently exposes strong binding sites on actin (Fig. 8B) for binding to the complementary regions in myosin’s 50-kDa domain.
Step 5:The greater the [Ca2+], the greater the fraction of time the Tm/Tn complex allows myosin access to strong binding sites on actin. Consequently, the rate of strong cross-bridge attachment, the flux through is dependent on [Ca2+] and Tm position (i.e., in the simplest case, the value of k+5 is proportional to the fraction of Tn having bound calcium). Strong binding of myosin to actin (Fig. 8B) is associated with movement of the upper and lower 50-kDa subdomains toward each other (or closing the jaws). This movement may allow the neck region of myosin to extend, opening a pathway for inorganic phosphate release from the ATP binding pocket in myosin. Alternatively, closing the jaws might promote inorganic phosphate release from the binding pocket, which then allows the extension of myosin’s neck region.
Step 6: In any event, myosin neck extension is the power stroke that, in isometric muscle, stretches an elastic element by some 10 nm and produces force. In nonisometric conditions, shortening of the neck extension causes the thick and thin filaments to slide past each other.
Step 8: Is reversible to form the rigor state, A·Mf. During isometric contractions, the slowness of k+7 causes the population of cross-bridges in the initial force-bearing (A·Mf*·ADP) state to rise and with it force.
Cross-bridges attach and exert force constantly during steps 7, 8, and 1 during isometric contraction, and force drops to zero when the cross-bridges detach in step 2. During shortening contractions the filaments slide past each other, the strain on the cross-bridge is reduced, and step7 occurs more rapidly. This accounts for the Fenn effect (an increased rate of energy liberation above the isometric rate as shortening velocity increases). The chemomechanical mechanism shown in figure 8 implies that during an isometric contraction, a cross-bridge remains strongly attached to actin for a relatively long time (>100 ms/cycle). Strongly bound cross-bridges prevent Tm/Tn from returning to its blocked or closed position, maintaining the thin filament in a “switched on” position (Fig. 8B). In the absence of Ca2+, cross-bridge detachments at the end of the cycle allows Tm/Tn to cover the strong myosin binding sites on actin and deactivate the thin filament (Fig. 8A)
In the human heart two sarcomeric myosin II genes are expressed generating two isoenzymes of the myosin heavy chain (designated α and β-MHC). These are located in tandem on the long arm of human chromosome 14q11.2-q13 (Saez et al. 1987). In the normal heart both MHC isoenzymes are expressed in a tissue-specific manner: the α -MHC is preferentially expressed in the atrium, and the β -MHC is almost exclusively expressed in the ventricle (Bouvagnet et al. 1984).
The human α –MHC contains 1939 amino acids residues (Matsuoka et al. 1991) while the β –MHC contains 1935 amino acids (Jaenicke et al. 1990). A total of 131 residues differ between both heavy chains and most of these differences are confined to regions of biological significance in the S1 subfragment such as the N-terminus, the ATP binding pocket, the actin binding cleft, the light chain binding domain and in the two hinge regions further down in the rod (tail) domain (Schaub et al. 1998).
In the hypertrophied atrium considerable amounts of β-MHC are expressed (Gorza et al. 1984; Mercadier et al. 1983), which is associated with a decrease in maximal shortening velocity (Arndt et al. 1989). α-MHC, however, is either found to be a minor component of human ventricular myosin (Gorza et al. 1984; Hirzel et al. 1985; Mercadier et al. 1983) or could not be detected at all (Ritter et al. 1999). Furthermore, there are no changes in α-MHC expression during hypertrophy of the human ventricle (Gorza et al. 1984; Hirzel et al. 1985; Mercadier et al. 1983; Ritter et al. 1999).
Two types of myosin light chains (MLC), essential and regulatory, are associated with the neck region of the MHC. The essential MLC is designated as the MLC-1 or alkali MLC. The regulatory MLC is designated as MLC-2 or phosphorylatable MLC or 5,5-dithio-bis-(2-nitrobenzoate)-MLC (Ritter et al. 1999). Together with calmodulin and troponin C, both types belong to the superfamily of EF hand Ca2+binding proteins (Moncrief et al. 1990).
In the normal human heart mainly the VLC-2b isoform is expressed (LC-2b to LC-2a ratio of 2.3) (Morano et al. 1997; Morano et al. 1996). In most patients with limited cardiac functions, this ratio remains at its normal level. However, recently it was found that in patients with HOCM VLC-2a expression declines in favor of the VLC-2b form (Ritter et al. 1999).
Expression of ALC-1 is tissue specific and developmentally regulated. Human embryos express large amounts of ALC-1 both in the whole heart and in skeletal muscle (Barton et al. 1985). ALC-1 protein levels decrease in the ventricle to undetectable levels during early postnatal development but persisted in the atrium throughout the whole life (Fallot 1963).
The situation differs in patients with congenital heart disease such as Tetralogy of Fallot. Tetralogy of Fallot is a complex congenital heart disease characterized by four components: right ventricular infundibular stenosis, ventricular septal defect, dextroposed aorta overriding the interventricular septal defect, and right ventricular hypertrophy (Auckland et al. 1986). The hypertrophied right ventricle of children with tetralogy of Fallot express large amounts of VLC-1 in the atrium (Shi et al. 1991) and ALC-1 in the ventricle, up to adulthood (Auckland et al. 1986). Similarly, the hypertrophied left ventricle of patients with ischemic, dilative, and hypertrophic
MLC-1 binds not only to the neck domain of the MHC (Rayment et al. 1993) but also with its N-terminus to the C-terminus domain of actin (Hayashibara et al. 1994; Morano et al. 1997; Sutsch et al. 1992; Trayer et al. 1987). Thus MLC-1 tethers the MHC to the actin filament. It has been demonstrated that MHC and MLC-1 bind to different actin monomers (Timson et al. 1998). Binding of MLC-1 to actin cannot be predicted from the crystal structure of myosin S1 (Rayment et al. 1993). This is due to the limited resolution of the three-dimensional structure of the N-terminus of MLC-1 (Rayment et al. 1993). In fact, around 40 N-terminal amino acid residues of MLC-1 are not seen in the crystal structure (Rayment et al. 1993). This missing part of MLC-1 contains ten Pro and ten Ala residues, which could form an antenna-like structure long enough to bridge the gap to the actin filament (Morano 1999).
Experimental evidence for the functional importance of the MHC/actin tether has been obtained by weakening the tether on the MLC-1/actin interface and/or MLC-1/MHC interface and simultaneous registration of cross-bridge function. Inhibition of the MLC-1/actin interaction by peptide competition using synthetic N-terminal MLC-1 peptides increases force production and shortening velocity of both demembrated (skinned) and of intact electrically driven human ventricular fibers (Morano et al. 1995) as well as myofibrillar ATPase activity (Rarick et al. 1996).
Assuming that tethering MHC to the actin filament via MLC-1 imposes a load on the myosin cross-bridge, thus relieving or weakening the MHC/actin tether decreases this load and accelerates cross-bridge cycling kinetics and at the same time enhances tension output per cross-bridge, thus increasing contractility (Morano et al. 1995).
The ALC-1 and VLC-1 differ in the primary structure of the N-terminus (Fodor et al. 1989). Indeed, the affinity for actin of the N-terminal peptide 5–14 derived from ALC-1 is significantly lower than the actin affinity of the corresponding N-terminal peptide of VLC-1 (Morano et al. 1997). These results support the idea that binding of ALC-1 to actin is weaker than the binding of VLC-1 to actin, representing a weaker MHC/actin tether
Regulation of ALC-1 expression in the human heart is still not well understood. In the mouse two E boxes, which interact with muscle-specific basic helix-loop-helix (bHLH) regulatory proteins of the MyoD family, and a diverged CArG box, which binds to the serum response factor, exist within the first 630 bp of the ALC-1 promoter region (Catala et al. 1995).
E boxes have been shown to be sufficient for ALC-1 transcription regulation during skeletal muscle differentiation (Catala et al. 1995). bHLH regulatory factors of the MyoD family regulate skeletal muscle differentiation by forming heterodimers with E12 bHLH factors that bind to E-box elements, thus increasing the transcription rate of target genes (Olson 1992). Recently two cardiac-specific bHLH proteins homologous to the MyoD family have been detected in the heart, designated as the E and D forms of heart–autonomic nervous system–neural crest derivative (HAND) (Cserjesi et al. 1995; Srivastava et al. 1995). They are important for early development and looping of the embryonic heart (Srivastava et al. 1997). Since both HAND transcription factors bind weakly to E-box as E12 heterodimers, the ALC-1 may be a target gene. Recently it has been reported that in the human hypertrophied ventricle there is upregulation of HAND gene expression and a positive correlation between HAND and ALC-1 mRNA (Ritter et al. 1999). Furthermore, ALC-1 expression may be regulated by endogenous antisense ALC-1 mRNA present in the human ventricle (Ritter et al. 1999). Moreover Ca2+-calmodulin-dependent processes, which are involved in the development of human heart hypertrophy, increased the activity of the human ALC-1 promoter. Both activation of calcineurin (CaN) and Calmodulin dependant kinase IV (CaMKIV) revealed a potent role in human ALC-1 gene regulation (Woischwill et al. 2004).
Skinned fiber studies showed that the shortening velocity, rate of tension development, isometric force generation, and Ca2+sensitivity of isometric force generation increase upon partial replacement of VLC-1 by ALC-1 in the human ventricles (Morano et al. 1997; Morano et al. 1996). Furthermore, there was a significant positive correlation between ALC-1 expression and dP/dtmax of patients with hypertrophic obstructive cardiomyopathy (HOCM) in vivo (Ritter et al. 1999). Thus crossbridge cycling kinetics and tension generation per cross-bridge are modulated by differential expression of MLC-1 genes. These results demonstrated for the first time that there is a molecular mechanism which allows the ventricular cardiomyocyte to adjust to enhanced work load through modification of the structure of the molecular motor – the partial substitution of VLC-1 by ALC-1 which increases power output of the sarcomeric motor macromolecules and improves cardiac contractility (Morano 1999). These results have been supported in a transgenic mouse model overexpressing the mouse ALC-1. By the examination of the chemically skinned fibre function, the ventricular fibres from the transgenic mice had a higher Vmax of shortening when compared to non-transgenic mice. Furthermore this light chain Isoform switch in the transgenic mouse model lead to increased contractile functions at the whole heart level (Fewell et al. 1998).
The functional properties of the human atrial essential myosin light chain (hALC-1) has never been evaluated in an intact heart preparation on the whole organ level. Functional examination of the chemically skinned ventricular fibers from a transgenic mouse model overexpressing the mouse ALC-1 showed a higher maximal shortening velocity (Vmax) when compared to non-transgenic mice: In the mouse heart, 95% replacement of mouse VLC-1 by the mouse ALC-1 was accompanied by a 1.78-fold increase in Vmax of shortening. However chemically skinned ventricular fibers of patients expressing the hALC-1 with 20% replacement of human VLC-1 by human ALC-1 showed 1.88-fold increase in maximal shortening velocity (Vmax). Although the data are consistent, it appears that the effect of mouse ALC-1 is attenuated as compared with hALC-1. These data suggest that there is a significant difference between the human and mouse ALC-1 isoforms at the functional level. To verify the functional efficiency of hALC-1 compared with mouse ALC-1 and to analyze hALC-1 functions in intact whole heart preparations, a transgenic rat-model overexpressing the hALC-1 was produced and characterized at the protein and functional levels.
Amersham Pharmacia Biotech, Amersham place, England
Nitrocellulose membrane, hybond ECL
YT Recorder REC 111
MALDI-TOF software for Mass spectrometry
Biometra, Gottingen, Germany
PCR-Cycler
Bio-Rad, Munich
Bio-Rad Trans-blot SD, semi-dry transfer cell
BIOTEC-FISCHER, Reiskirchen, Germany
Light box
Calibrated imaging densitometry, California, USA
BIO–RAD GS-710
Definiens, Munich, Germany
Proteome Weaver software analysis program
Eppendorf, Hamburg, Germany
Thermo-shaker
Hugo-Sachs Electronic (Germany)
Software HEM Notocord
The Landgendorff-perfusion apparatus
Kodak, Rochester, NY
X ray films
Spectrophotometer UV-1201
Zeiss, Jena
Axioplan fluorescence microscope
MC 100 automatic camera
Amersham Pharmacia Biotech, Amersham place, England
Chemiluminescence’s reaction Kit
BstYI- restriction enzyme
Hind III- restriction enzyme
XbaI- restriction enzyme
Biogenes, Berlin, Germany
Anti-rabbit antibody
Bio-Rad, Munich
Tween 20
PBS
Diagnostic Chemicals Limited
isopropyl (-D)-thiogalactopyranoside
Invitrogen GmbH, Karlsruhe, Germany
BL21 (DE3) pLysS cells
Expression vector pRSETA
PCR-Kit
Merck, Darmstadt, Germany.
DNase
HCl
K2HPo4
KH2po4
MgSo4
NaHCo3
Na-K tartrat
Na4P2O7
NaPo4
Protease inhibitor mixture
proteinase K
Molecular Probes, Inc. USA
Secondary anti-mouse antibodies
Secondary anti-rabbit antibodies
Qiagen, Germany
NiNTA-agarose beads
Reanal-Budapest Hungary
Temed (N, N, N, N, teramethylethylene diamine)
Roth Karlsruhe
APS (ammonium peroxodisulfate)
EDTA
KCl
Methanol
NaCl
Na2Co3
Sodium lauryl sulfate (SDS)
Serva, Heidelberg, Germany
Acrylamid
Ampholyte mixture Servalyte
BSA (bovine serum albumin)
CaCl2
Coomassie blue R-256
DTT (dithiothreitol)
Glucose
Glycerol
Glycine
Ponceau S
Sodium dodecylsulfate (SDS)
Tris
Sigma Chemical Co., St. Louis, MO
Albumin
β-mercaptoethanol
Bromophenol blue
Chloral hydrate
CuSo4
Folin
Isopropanol
MgCl2
Monoclonal antibody against α-actinin
NaN3
Paraform aldehyde
Pepstatin A
RNAse A
Thiourea
Urea
For generation of the transgene construct, a full-length human ALC-1 (hALC-1) cDNA (Hemp4; -82-+768) was kindly provided by A. Starzinski-Powitz, Frankfurt, Germany (Zimmermann et al. 1990) and cloned downstream of the rat alpha-myosin heavy chain promoter (Hoffmann et al. 2001), followed by the polyadenylation signal of SV40 (Fig. 9).
The final 2.45-kb transgene construct was linearized with XbaI, purified by agarose gel electrophoresis, and used to generate transgenic rats as described (Popova et al. 2002) with the exception that oocytes from inbred (WKY) rats were used for pronuclear microinjection (Popova et al. 2002)..
The tails were overnight incubated in Tail Buffer (5mM Tris/HCL buffer, 100mM EDTA, 100mM Nacl & 1% SDS) & Proteinase K, placed in a thermo-shaker (Eppendorf, Hamburg) at 55c°.
The genomic DNA was extracted using 5M NaCl solution, RNAse A and isopropanol for pellet precipitation. The pellet was then washed with 70% ethanol and left for air-drying.
The pellet was dissolved in 100μl 1xTE buffer (10mM Tris/HCL, 1mM EDTA in sterile water) with OD spectrophotometeric measurement, the DNA concentration was estimated (UV-1201 spectrophotometer, Shimadzu Corporation, Kyoto Japan).
The presence of the transgene in genomic DNA from tail biopsies was verified by PCR in a reaction volume 50μl using 20 ng from each tail sample, distilled H2o in addition to the PCR kit (50 mM MgCl2, 10x buffer without MgCl2, 10 Mm dNTP-Mix and Taq polymerase) (Invitrogen, Karlsruhe, Germany) in addition to the two primers: GCCAAGGGATCAAAGGAGGA and TTGGCTGCCTCCTTCTTAGG, which were
The anti-hALC-1 antibody was raised in New Zealand White rabbits against the synthetic peptide (PAPEAPKEPAFDPKS) according to a standard protocol (Haase et al. 1993). The antigenic epitope comprised the amino acids 29–43 of hALC-1: an epitope in which hALC-1 (Acc. No. P12829) and rat ALC-1 (Acc. No. P17209) share only 2 out of 15 amino acid residues.
The antibody-containing serum fractions were affinity purified on the peptide antigen column. The resulting affinity-purified antibody fraction was depleted of antibodies cross-reacting with rat cardiac proteins by incubation with acetone-treated rat cardiac tissue. A second round of affinity chromatography on the peptide antigen column recovered the human ALC-1 specific antibodies.
For cloning of the hALC-1 cDNA in a bacterial expression-system, the already established clone (Hemp4) was used (Fig. 9). An 812 bp BstYI-Hind III fragment carrying the complete protein-coding region of hALC-1 (594 nucleotides) was inserted into the BamH1-HindIII site of the expression vector pRSETA (Invitrogen, Karlsruhe, Germany) to yield hALC-1 as an N-terminally HIS-tagged fusion protein (hALC-1HIST) construct.
Single colonies of BL21 (DE3) pLysS cells (Invitrogen, Karlsruhe, Germany) were transformed with the hALC-1HIST. Protein expression was induced with 0.1 mM isopropyl (-D)-thiogalactopyranoside (Diagnostic Chemicals Limited) for 3-4 h at 37°C.
The cells were collected by centrifugation, resuspended and sonicated twice for 45s. The sonicated material was centrifuged and the supernatant was incubated with 1 ml of Ni-NTA-agarose beads (Qiagen, Germany). The beads were extensively washed and the hALC-1HISTfusion protein was then eluted. The purified hALC-1HIST had an apparent molecular mass of 35-kDa (see below).
Myosin was extracted and purified from the left ventricular tissues of TGR/hALC-1 and WKY rats. The ventricles were crashed in liquid nitrogen and extracted for 20 m at 4°C with 3.4 volumes (w/v) of a modified Guba-Straub solution (0.3M KCL, 0.1M NaPO4, 1 mM MgCl2, 10 mM Na4P2O7, 10mM EDTA, 1% NaN3 (w/v), 1% β-mercaptoethanol) pH 6.5.
The crude extract was used for purification of myosin as described (Offer et al. 1973)except that the actomyosin was dissociated in 150 mM Na4P2O7, 6mM EDTA, 3mM DTT, and 9mM ATP at pH 7, before ammonium sulphate fractionation.
The myosin was dialysed overnight in 0.5 M NaCl, 0.01 M Tris and 1mM EDTA at pH 7. Myosin concentration was determined at 280nm using the specific absorption coefficient (1mg/ml=0.52).
The protein composition of the human atrial tissues and the purified myosin of the transgenic and control rats (TGR/hALC-1, WKY) was analysed by SDS-polyacrylamide gel electrophoresis according to a modified laemmli gel method (Laemmli 1970). Mini-protean II dual slab cell (Biorad) was used which provides a gel with the following dimensions: 80 mm wide and 70 mm long and 1.5 mm thick. A 12 % separating gel (see table 1) was prepared and applied between the glass plates. The solution was covered with distilled water to provide a flat gel surface. After polymerisation, a 4% stacking gel (see table 1) was prepared and applied above the separating gel, after the water was poured off. A comb was placed into the stacking gel solution, and it was allowed to polymerise. After polymerisation, the comb was removed and each well was loaded with 70-µg proteins. The protein samples were diluted 1:3 with sample buffer (0.5 Tris-HCl, pH 6.8 12.5% (v/v); glycerol 10% (v/v); SDS 2% (w/v); 2-βmercaptoethanol 5% (v/v); bromophenol blue 0.001% (w/v)) and heated 5 minutes at 95 °C.
Rats were sacrificed, the hearts were removed, and the ventricles were immediately frozen in liquid nitrogen. The tissue was stored at -80°C until protein preparation. The total protein fraction was extracted from frozen tissue specimens (20-40 mg) by homogenization with a motor-driven glass-teflon homogenizer in SDS-sample buffer (5% SDS, 50 mM Tris-HCl, pH 7.5, 250 mM sucrose, 75 mM urea, 10 mM dithiothreitol), denatured for 3 min at 95 °C, and cleared by centrifugation.
The supernatant containing the total SDS-extracted proteins was removed and the protein concentration was determined by a modified Lowry method using 10% SDS and the Lowry mixture (CuSo4, 2% NaK tartrat, 2% Na2co3 (Wang et al. 1975) using bovine serum albumin as the standard.
The nitrocellulose membrane was blocked with 15% ovalbumin (0.1% Tween; 20 mM Tris base and 137 mM NaCl). The transfers were incubated overnight with the affinity-purified anti-human ALC-1 antibody at a concentration of 0.5 µg IgG/ml and subsequently with the secondary peroxidase-conjugated anti-rabbit antibody (Biogenes, Berlin, Germany) for 1 h at room temperature. Between each step, the membranes were washed by TBS (20 mM Tris base, 137 mM NaCl, pH 7.6) and TBST (20 mM Tris base, 137 mM NaCl and 01% Tween)
Immunoreactive proteins were visualized with the enhanced chemiluminescence’s reaction Kit (ECL, Amersham) and X ray films (X-Omat, Kodak, Rochester, NY). The signals were scanned by densitometry using BIO–RAD GS-710 (calibrated imaging densitometry, California, USA).
For immunofluorescence detection of the hALC-1 in the ventricular tissues, animals were anaesthetized (30 mg/kg Chloral hydrate), the hearts were removed, and 1mm³ left ventricular tissue samples were taken from the hearts and fixed by incubation for 2 h at room temperature with 4% paraformaldehyde, 0.1M PBS and 0.18M sucrose.
The tissues were washed (3 times each for 5 m) with 0.1M PBS, then incubated overnight in 2.3M sucrose, 0.1M PBS, and subsequently frozen in liquid nitrogen. Tissue sections (1μm) were incubated with blocking buffer (20 mM Tris/HCL pH 8.4,630mM NaCl, 0.05%Tween 20, 0.02% NaN3, 1% BSA) for 30 m at room temperature.
The tissues were washed with the blocking buffer and incubated with secondary antibodies (Alexa 594, red) anti-rabbit antibodies (Alexa 488, green) anti-mouse antibodies (Molecular Probes, Inc. USA) (5μg/ml) for 1 h at 37 °C.
Fluorescence was detected using an axioplan fluorescence microscope with appropriate filter systems. Micrographs were followed with an MC100 automatic camera with KodaK Tmax 400 film.
Four TGR/hALC-1 and four WKY (12 weeks-old) rat ventricular tissues were used for 2D gel electrophoresis. Rat ventricular tissues in 2.2 parts v/w of 50 mM Tris buffer, pH 7.5, containing 50 mM KCL, 20 % v/v glycerol and 4 % w/v 3-[(3-chloramidopropyl) dimethylammonio-1-propanesulfonate (CHAPS)], were combined with protease inhibitor mixture [0.08 parts v/w of one Complete TM tablet (Molecular Biochemicals Roche, Mannheim, Germany), dissolved in 2 ml of 100 mM KCL, 20 % v/v glycerol and 50 mM Tris, pH 7.1. and 0.02 parts of 1 mM PMSF (phenylmethylsulfonylflouride) together with 1.4μM pepstatin A dissolved in ethanol].
Al l components were ground to a fine powder in a motor placed in liquid nitrogen bath. Sonication was performed in a water bath by adding 0.034 parts of glass beads to the defrosted homogenate. The resulting extract was stirred for 30 min at 40 C in the presence of 0.023 parts v/w of 50 mM Tris buffer, pH 7.5, containing 50 mM KCL, 20 % v/v glycerol, 5 mM MgCl2 x 6 H2O and 0.025 parts v/w of DNase (Benzonase; Merck, Darmstadt, Germany).
Protein extracts were purified by large-gel 2D (Klose 1999).The gel format was 46.4 cm (isoelectric focusing, pH range 3 -10) × 30 cm (SDS-PAGE direction) × 0.75 mm. Exactly 6 μl (containing 120 μg protein) of total protein extract were loaded on an isoelectric focusing tube gel (0.9 mm diameter).
The proteins spots were visualized by an acidic silver staining procedure (Klose et al. 1995). The 2D silver-stained gels were analyzed visually on a light box (BIOTEC-FISCHER, Reiskirchen, Germany).
The total spot number of the protein expression-pattern was evaluated in both animal groups by using an automated software analysis program [Proteome Weaver imaging software 2.1.1 (Definiens)].
Mass spectrometry (MALDI TOF) was used for protein identification, 20 μl of each sample was loaded on 1.5 mm tube gels and stained with mass spectrometry compatible silver staining (Shevchenko et al. 1996).
Animal experiments were performed using 12, 24 and 36 weeks-old transgenic (TGR/hALC-1) rats and age-matched wild type WKY rats. The rats were kept on a 12h light-dark cycle with 55% humidity at an ambient temperature of 23±2°C and given food, tap water and libitum. The institutional animal care body in the state of Berlin, Germany approved the studies.
For the Langendorff heart preparations (Langendorff 1895), hearts were excised from anaesthetized (30 mg/kg Chloral hydrate ) and heparinized (500 U/kg) male transgenic and WKY rats after thoracotomy and then cannulated for retrograde aortic perfusion with a modified Krebs-Henseleit solution containing NaCl (118 mM), KCl (4.7mM), CaCl2 (1.5mM), MgSO4 (1.2Mm), NaHCO3 (25 mM), Na2EDTA (0.05 mM), KH2PO4, (0.23 mM), 2.5% albumin and glucose (11.1 mM). The solution was saturated with 95% O2 / 5% CO2 pH 7.4.
The perfusion apparatus was from Hugo-Sachs Electronic (Germany). Systolic pressure was measured with a latex balloon, filled with ethanol/H2O, which was inserted into the left ventricle through the left atrium via a catheter to a (Isotec) transducer. The pressure in the balloon was set from 14–18 mmHg. The stimulation frequency was fixed at 340 beats/min. The perfusion was carried out at 37°C with a constant aortic pressure of 70 mmHg. Signals were recorded on a linear-corder mark 8 WR 3500. Contractile data were monitored and recorded by computer software (HEM, Notocord, France).
The recorded functional parameters were coronary flow, perfusion pressure, developed left ventricular pressure (LVP), maximal rate of pressure increase (+dP/dtmax) and maximal rate of pressure decrease (-dP/dtmax).
Values are expressed as mean ± SEM. Analysis of significance was performed with the unpaired Student’s t- test.
The construct shown in Figure 9 was used to generate transgenic rats of the inbred WKY strain. The presence of the hALC-1 transgene in the genome was verified by a specific PCR protocol (Fig. 10) and Southern blot using DNA isolated from the tails of the animals. To the best of my knowledge this is the first transgenic rat model made on an inbred WKY background. Transgenic animals were morphologically normal. In particular, the heart weight/body weight ratio was not significantly different between TGR/hALC-1 and WKY control rats (Fig.11) indicating that the hALC-1 gene did not induce hypertrophic alterations in the heart of the transgenic animals.
To determine transgene expression at the protein level, a unique peptide antibody against human ALC-1 sequence was developed. Figure 13 illustrates a typical immunoblot analysis of the total protein fractions extracted from the ventricles of WKY or TGR/hALC-1 rats. The anti-human ALC-1 antibody specifically recognized a 28-kDa protein in the TGR/hALC-1 animals, i.e. the expected molecular mass of the human ALC-1. This apparent molecular mass is consistent with the migration of the immunostained ALC-1 in human atrial tissue extracts (Fig. 14B). The antibody did not cross-react with the ventricular light chains of WKY rats or any other proteins on Western blots of total rat ventricular proteins (Fig. 14B).
Recombinant HIS-tagged hALC-1 migrating at 35 kDa was used as standard to quantify the amount of expressed hALC-1 by Western blot analysis (Fig.12A). There was a linear relationship between the optical density of ECL-signals and recombinant h-ALC-1 which was used as standard curve (Fig. 12B).
Densitometric analysis of proteins extracted from 12-week old rats revealed an average amount of 17 ± 4μg hALC-1 per mg of SDS-extracted ventricular proteins (n=7). Assuming myosin represents 45% of the whole SDS-soluble protein and the MLC-1 is 10% of the whole myosin (Swynghedauw 1986), therefore the expressed hALC-1 represents 37% of whole MLC-1. Moreover an age-dependent decline in transgene expression was observed in the same animal line.
By quantifying hALC-1 expression in 24 and 36-week old TGR/hALC-1, the average amount of hALC-1 expression in the 24 weeks-old rats declined significantly (p<0.05) to 9.5 ± 3μg hALC-1 per mg of whole SDS-soluble protein (n=8), which represents 21% of the whole MLC-1. In the 36-week old TGR/hALC-1 rats, hALC-1 expression was significantly reduced to 4.8 ±2μg hALC-1 per mg of whole SDS-soluble protein (n=10), which represents about 10% of the total MLC-1.
Figure 14A illustrates an SDS-PAGE gel for the separation of human atrial tissue SDS-extract (hAT) and left ventricular purified myosin preparations of TGR/hALC-1 and WKY animals, with assessment of the stoichiometry of the total MLC-1 isoforms (28 kDa) versus total MLC-2 isoforms (18kDa).
The bands were scanned densitometrically and the MLC-1/MLC-2 ratio was 1.2±0.1 (n= 4) and 1.3±0.03 (n= 4) respectively in the transgenic and WKY rats, showing no difference in MLC pattern in both animal groups.
Native hALC-1 (from human atrial tissue SDS-extract) as well as the rat VLC-1 co-migrated in SDS-PAGE (28 kDa) (Fig. 14A).
The anti-human ALC-1 antibody recognized specifically the hALC-1 in the myosin preparations of all TGR/hALC-1 animals (TGR/hALC-1) and the native hALC-1 in the human atrial tissue extract on immunoblot analysis (Fig. 14B) of human atrial tissue extract and left ventricular purified myosin preparations of TGR/hALC-1 and WKY rats. The TGR/hALC-1 revealed an identical molecular weight (28 kDa) to the native hALC-1.
To estimate the amount of replacement of the rat-endogenous VLC-1 by the hALC-1 left ventricular purified myosin preparations (20μg) of TGR/hALC-1 and WKY rat were separated by SDS-PAGE on a 12% resolving gel and transferred to a nitrocellulose membrane in a typical immunoblot analysis. hALC-1HIST was used as standard to quantify the amount of expressed hALC-1 in the myosin preparations. The amount of hALC-1 associated with the purified TGR/hALC-1 myosin represented 20±2% (n=4) of whole transgenic rat MLC-1.
Ventricular tissue sections from the transgenic animals were analysed using specific anti-hALC-1 antibodies and anti α-actinin antibodies. TGR/hALC-1 were investigated by double-labelling immunofluorescence microscopy, Z-lines were identified by alpha-actinin specific fluorescence, showing regular striated pattern that is consistent with labelling of the sarcomere (Fig. 15A).
The specific fluorescence of hALC-1 (Fig. 15B) in the sarcomere could be localized between the Z-lines by overlaying the hALC-1 and α-actinin labelling patterns, (Fig.15C). These observations confirm the appropriate placement of the hALC-1 into the contractile machine.
Furthermore, by double-labelling analysis using anti hALC-1 (Fig. 16B) and anti-MHC antibodies (Fig. 16A), mosaic patterns of transgene expression in cardiomyocytes were observed. The specific hALC-1 fluorescence signals of cardiomyocytes revealed different signal intensities, ranging from strong signals to undetectable levels of hALC-1.
In a 2D-PAGE comparative analysis of the whole rat ventricular protein expression-patterns (4 pairs of 12 weeks-old TGR/hALC-1 and WKY rats), I was able to resolve approximately 3000 protein spots in each pattern.
The whole protein expression patterns in both animal groups showed no differences with the exception of the transgenic spot (Fig.17A and B) that was absent in all the WKY rats and present in all the TGR/hALC-1, but other spot variations existed in between the same animal group. The transgenic protein spot was identified by molecular weight and mass spectrometry and proved to be hALC-1.
Cardiac functions in the TGR/hALC-1 and WKY rats were evaluated by examining the isolated perfused hearts. Hearts were obtained from 12-24-36-week old animals.
Left ventricular functions were evaluated and there was a statistically significant improvement (p<0.001) in the contractile functions of the 12-week old TGR/hALC-1 (n=7) compared to their age-matched control (WKY) (n=7) animals. This improvement is represented in an increase in: the developed left ventricular pressure (LVP) by 2.17-fold (Fig. 18), the maximum rate of pressure increase (contraction rate, +dP/dtmax) by 2.11- fold (Fig. 19) and the maximum rate of pressure decrease (relaxation rate, -dP/dtmax) by 1.91-fold (Fig. 20) in the TGR/hALC-1 compared to the age matched WKY rats.
While evaluating the contractile functions of the 24 and 36 weeks-old rats compared to the 12 weeks-old rats, there was an age-dependent decline of the improved contractility parameters tightly associated with a decline in transgene expression levels in the 24 and 36-week old TGR/hALC-1 (n=8 and 10-respectively) (Fig. 18, 19, 20).
In contrast, there was an age-dependent increase in contractility in the 24, 36 weeks-old WKY rats compared with 12 weeks old animals (Fig. 18 19, 20). Therefore, improved contractile functions of TGR/hALC-1 levelled-off to normal in 36 weeks-old animals.
Myosin is a motor protein, which acts as the cross-bridge in the contractile apparatus of all muscle types. It interacts cyclically with the thin (actin) filament thus producing force and shortening while consuming ATP. Myosin cross-bridge action therefore represents an important process determining cardiac systolic and diastolic function (Lowey et al. 1971). Two types of myosin light chains (MLC), essential and regulatory, are associated with the neck region of the myosin heavy chains (MHC) (Moncrief et al. 1990).
Expression of the atrial-specific essential MLC (ALC-1) is tissue specific and developmentally regulated. ALC-1 is expressed in large amounts in the whole heart of human embryos (Barton et al. 1985), then is only restricted to the atrium in early postnatal development (Fallot 1963). The hALC-1 gene is located on chromosome 17q21b and encodes a protein of 196 amino acids (Seharaseyon et al. 1990). Regulation of cardiac contractility in the human ventricles by ALC-1 provided an alternative to the MHC regulatory mechanisms seen in a rodent-overloaded heart that responds by a MHC isoform shift from α-MHC (high ATPase activity) to β-MHC (low ATPase activity) (Morano et al. 1997; Morano et al. 1996; Sutsch et al. 1992). It was previously reported that human ventricular skinned fibers revealed an increase in maximal shortening velocity, rate of tension development, isometric force generation, and calcium sensitivity of isometric force generation upon partial replacement of VLC-1 by ALC-1 (Morano et al. 1997; Morano et al. 1996). Furthermore, there was a significant positive correlation between ALC-1 expression and dP/dtmax in patients with hypertrophic obstructive cardiomyopathy (HOCM) (Ritter et al. 1999).
The functional properties of the human atrial essential myosin light chain (hALC-1) has never been evaluated in an intact heart preparation at the whole organ level. Only correlations between the hALC-1 and hemodynamic data have been reported, such as systolic, end-diastolic pressure, end-diastolic volume index, mean pressure gradient and wall stress (Brodie et al. 1977; Grossman et al. 1972). Previous research has identified the beneficial functional effects of hALC-1 in-vitro cardiac preparations (human ventricular skinned fibers) of patients expressing hALC-1 (Morano et al. 1997; Morano et al. 1996; Ritter et al. 1999). Cardiac-specific overexpression of mouse ALC-1 was accomplished in transgenic mice. The changes at the motor protein and fiber levels
This functional discrepancy between the human and mouse ALC-1 was supported by a considerable amino acid sequence variation of the atrial essential myosin light chains in both species (Fig. 21). Interestingly, the human-mouse amino acid differences are mostly located at the N-termini of both sequences, with a close similarity between the mouse and rat ALC-1. It has been demonstrated that the amino-terminal domain of the MLC-1 isoforms interacts with the carboxyl-terminal domain of actin (Stepkowski 1995; Sutoh 1982; Timson et al. 1998). This interaction could be of functional importance since inhibition of this interaction using synthetic peptides increased the force production and the shortening velocity of human heart fibers (Morano et al. 1995), which may explain the functional variation in both the human and mouse ALC-1.
Besides the main interest in the molecular therapy of human heart disease, the considerable difference between the human and mouse ALC-1 sequences and function, provided the initiative to undertake this study aiming to characterize, for the first time the effect of human ALC-1 at the intact whole heart contraction level. To achieve this aim, transgenesis was used to direct an essential light chain isoform switch in the rat heart.
Analyzing the morphological data of the transgenic model, no significant difference in the heart weight/bodyweight relationship between the TGR/hALC-1 and control animals was observed, which suggests the absence of hypertrophic response in the hearts of the rat models. Moreover, to confirm the absence of hypertrophy, the expression of alpha-myosin heavy chains, which is essentially down-regulated during hypertrophy (Swynghedauw 1986) was studied by using quantitative Western blot analysis. No change in the expression levels of alpha-MHC in TGR/hALC-1 compared to WKY could be detected.
I observed a significant improvement in the contractile parameters of the 12-24-week old TGR/hALC-1 compared with age-matched WKY animals. Interestingly, aged TGR/hALC-1, especially 36-week old animals, revealed no significant differences in their contractile parameters when compared to age-matched WKY. This normalization of heart function with age could be explained, firstly by the age-dependent attenuation of transgene expression discussed below, and secondly by the age-dependent increase in contractility in the WKY rats, which is in accordance with the findings of previous studies (Nair et al. 2001; Qi et al. 1997).
The 12 weeks old TGR/hALC-1 expressed a reasonable amount of hALC-1 in their ventricles, but a decline in the transgene expression upon aging was observed, that was closely associated with a decline in the improved contractility seen in young TGR/hALC-1. This confirms that the improved contractile functions were associated with the hALC-1 expression. The phenomenon of age-dependent transgene down-regulation was also observed in a previous study using the same α-MHC promoter (Hoffmann et al. 2001). This observation could be due to the attenuation of alpha-MHC expression in WKY rats with age (Morano et al. 1988). I suggest that the improved contractile functions observed in the transgenic rat model were due to the hALC-1 expression rather than to abnormal gene modification(s) caused by random transgene integration. Except for the transgene, there were no obvious changes in the expression levels of the proteins in TGR/hALC-1 compared to the WKY rats as revealed by 2D-proteome analyses. The hALC-1 transgenic protein was localized by immunofluorescence analysis, which showed that hALC-1 was correctly incorporated in-between the Z lines of the sarcomere of the ventricular contractile apparatus.
In a different set of analytical studies using immunofluorescence microscopy, a mosaic pattern of expression for hALC-1 was observed in the cardiomyocytes. These variegated expression patterns have been commonly observed in various transgenic studies in mammals (Dobie et al. 1996; Opsahl et al. 2002).
The MLC-1/ MLC-2 ratio was similar in WKY and TGR/hALC-1 ventricular purified myosin preparations, thus the ectopically expressed hALC-1 replaces the endogenously expressed rat VLC-1 with no net increase in the whole MLC-1 content. These data are compatible with previous results in which different myosin light chains were expressed in human ventricles (Morano et al. 1996) and transgenic mice (Gulick et al. 1997). In 12 weeks-old TGR/hALC-1, I observed around 20% replacement of the rat left ventricular VLC-1 by hALC-1 in purified myosin preparations. Meanwhile, hALC-1 represented about 37% of rat left ventricular whole MLC-1 in whole SDS-soluble transgenic ventricular tissue extracts. Therefore, I suggest that a fraction of the expressed transgene (about 1/3) seems to exist in a free non-bound state in cardiomyocytes.
The moderate replacement of rat VLC-1 by hALC-1 in the 12 weeks-old rat model was accompanied by marked alterations in whole heart mechanics, represented by significant increase in the pressure development, contraction rate, and relaxation rate.These data are consistent with the previous idea that partial replacement of endogenous MLC-1 by hALC-1 is sufficient to improve the contractile functions of the heart (Morano et al. 1996). Furthermore, it is demonstrated that the hALC-1 in rat is more functionally efficient than the corresponding mouse essential myosin light chain isoform in mouse: maximal contraction and relaxation rates were increased by around
Articles
Abdelaziz AI, Segaric J,Bartsch H, Petzhold D, Schlegel WP, Kott M, Seefeldt I, Klose J, Bader M, Haase H and Morano I. Functional characterization of the human atrial essential myosin light chain (hALC-1) in a transgenic rat model (2004). J. Mol. Med. (IN press).
Abdelaziz AI, Pagel I, Schlegel WP, Kott M, Monti J, Haase H and Morano I. The human atrial myosin light chain (hALC-1) attenuates heart failure (accepted) (2004) Adv. Epx. Med. Biol. (In press).
Abstracts
Abdelaziz AI, Schlegel WP, Kott M, Bader M, Klamm U, Ganten U, Haase H and Morano I. Improved cardiac function by human atrial essential myosin light chain (hALC-1) in a transgenic rat model. J Muscle research and cell motility 24:342 (2003).
Personal Data:
Education:
Honours & Scholarships:
Training courses & Programs:
Linguistic Skills:
English: Fluent, written & spoken
Arabic: Mother tongue
French: Well
First and foremost I would like to thank Prof. Dr. Ingo Morano, who gave me the opportunity to carry out this project, and always supported and encouraged through the time course of my Ph.D. His enormous knowledge, enthusiasm and good mood were my stimulating initiative.
I would also like to thank Dr. Hannelore Haase, Dr. Peter Karczewski and Dr. Michael Bader for their sincere help, advice and valuable discussions during the course of this work. I would like to express my intense and deep gratitude for Dr. Ursula Ganten for the production of the transgenic rats involved in the project.
Special thanks go to Dr. Monika Kott for the immunofluorescence microscopy, Wolfgang-Peter Schlegel for the Langendorff-perfusion and Steffen Lutter for his helpful technical assistance.
I would like to express my sincere thanks to all my lab-mates who shared my daily life, for their help, support and making me feel at home. Special thanks for Christiane Woischwill, Petra Pierschalek, and Daria Petzhold for being very special friends.
I am thankful for the collaboration with the Institute of Human Genetics at the Charité, and I really appreciate the extensive effort made by Jadranka Segaric in performing the whole proteome analysis by 2DE.
Finally, I am grateful for the GraduirtenKolleg (Research Training Group in: myocardial hypertrophy, gene expression & function) -Charité medical University/Berlin and VACSERA (The Egyptian Org. for Biological Products and Vaccines) for suppoting this project.
Hiermit erkläre ich, dass ich die vorliegende Dissertation selbständig und ohne unzulässige Hilfe Dritter angefertigt habe. Die benutzten Hilfsmittel sowie die Literatur sind vollständig angegeben
Berlin, den
Ahmed Ihab Abdelaziz