METHODS

Transgene construction and generation of transgenic rats

For generation of the transgene construct, a full-length human ALC-1 (hALC-1) cDNA (Hemp4; -82-+768) was kindly provided by A. Starzinski-Powitz, Frankfurt, Germany (Zimmermann et al. 1990) and cloned downstream of the rat alpha-myosin heavy chain promoter (Hoffmann et al. 2001), followed by the polyadenylation signal of SV40 (Fig. 9).

The final 2.45-kb transgene construct was linearized with XbaI, purified by agarose gel electrophoresis, and used to generate transgenic rats as described (Popova et al. 2002) with the exception that oocytes from inbred (WKY) rats were used for pronuclear microinjection (Popova et al. 2002)..

Genotyping of the genomic DNA from the transgenic-rat tails.

The tails were overnight incubated in Tail Buffer (5mM Tris/HCL buffer, 100mM EDTA, 100mM Nacl & 1% SDS) & Proteinase K, placed in a thermo-shaker (Eppendorf, Hamburg) at 55c°.

The genomic DNA was extracted using 5M NaCl solution, RNAse A and isopropanol for pellet precipitation. The pellet was then washed with 70% ethanol and left for air-drying.

The pellet was dissolved in 100μl 1xTE buffer (10mM Tris/HCL, 1mM EDTA in sterile water) with OD spectrophotometeric measurement, the DNA concentration was estimated (UV-1201 spectrophotometer, Shimadzu Corporation, Kyoto Japan).

The presence of the transgene in genomic DNA from tail biopsies was verified by PCR in a reaction volume 50μl using 20 ng from each tail sample, distilled H₂o in addition to the PCR kit (50 mM MgCl₂, 10x buffer without MgCl₂, 10 Mm dNTP-Mix and Taq polymerase) (Invitrogen, Karlsruhe, Germany) in addition to the two primers: GCCAAGGGATCAAAGGAGGA and TTGGCTGCCTCCTTCTTAGG, which were specific for the transgene and amplified a 606 bp fragment. The reaction was run for 28 cycles in the PCR-Cycler (Biometra T-Gradient).

Figure 9 . Schematic representation of the construct used to generate the transgenic rats.b The hALC-1 cDNA is linked to the α-MHC promoter followed by the polyadenylation signal of SV40. Relevant restriction sites are represented on the diagram. The final transgene construct was linearized with XbaI, purified by agarose gel electrophoresis and used to generate transgenic rats. Arrows indicate primers used for genotyping of the transgenic rats by PCR.

Generation of the hALC-1 specific antibody

The anti-hALC-1 antibody was raised in New Zealand White rabbits against the synthetic peptide (PAPEAPKEPAFDPKS) according to a standard protocol (Haase et al. 1993). The antigenic epitope comprised the amino acids 29–43 of hALC-1: an epitope in which hALC-1 (Acc. No. P12829) and rat ALC-1 (Acc. No. P17209) share only 2 out of 15 amino acid residues.

The antibody-containing serum fractions were affinity purified on the peptide antigen column. The resulting affinity-purified antibody fraction was depleted of antibodies cross-reacting with rat cardiac proteins by incubation with acetone-treated rat cardiac tissue. A second round of affinity chromatography on the peptide antigen column recovered the human ALC-1 specific antibodies.

Recombinant human ALC-1

For cloning of the hALC-1 cDNA in a bacterial expression-system, the already established clone (Hemp4) was used (Fig. 9). An 812 bp BstYI-Hind III fragment carrying the complete protein-coding region of hALC-1 (594 nucleotides) was inserted into the BamH1-HindIII site of the expression vector pRSETA (Invitrogen, Karlsruhe, Germany) to yield hALC-1 as an N-terminally HIS-tagged fusion protein (hALC-1_HIST) construct.

Single colonies of BL21 (DE3) pLysS cells (Invitrogen, Karlsruhe, Germany) were transformed with the hALC-1_HIST. Protein expression was induced with 0.1 mM isopropyl (-D)-thiogalactopyranoside (Diagnostic Chemicals Limited) for 3-4 h at 37°C.

The cells were collected by centrifugation, resuspended and sonicated twice for 45s. The sonicated material was centrifuged and the supernatant was incubated with 1 ml of Ni-NTA-agarose beads (Qiagen, Germany). The beads were extensively washed and the hALC-1_HISTfusion protein was then eluted. The purified hALC-1_HIST had an apparent molecular mass of 35-kDa (see below).

Myosin purification.

Myosin was extracted and purified from the left ventricular tissues of TGR/hALC-1 and WKY rats. The ventricles were crashed in liquid nitrogen and extracted for 20 m at 4°C with 3.4 volumes (w/v) of a modified Guba-Straub solution (0.3M KCL, 0.1M NaPO₄, 1 mM MgCl₂, 10 mM Na4P₂O₇, 10mM EDTA, 1% NaN3 (w/v), 1% β-mercaptoethanol) pH 6.5.

The crude extract was used for purification of myosin as described (Offer et al. 1973)except that the actomyosin was dissociated in 150 mM Na₄P₂O₇, 6mM EDTA, 3mM DTT, and 9mM ATP at pH 7, before ammonium sulphate fractionation.

The myosin was dialysed overnight in 0.5 M NaCl, 0.01 M Tris and 1mM EDTA at pH 7. Myosin concentration was determined at 280nm using the specific absorption coefficient (1mg/ml=0.52).

Composition analysis of purified myosin and human atrial tissue
The protein composition of the human atrial tissues and the purified myosin of the transgenic and control rats (TGR/hALC-1, WKY) was analysed by SDS-polyacrylamide gel electrophoresis according to a modified laemmli gel method (Laemmli 1970). Mini-protean II dual slab cell (Biorad) was used which provides a gel with the following dimensions: 80 mm wide and 70 mm long and 1.5 mm thick. A 12 % separating gel (see table 1) was prepared and applied between the glass plates. The solution was covered with distilled water to provide a flat gel surface. After polymerisation, a 4% stacking gel (see table 1) was prepared and applied above the separating gel, after the water was poured off. A comb was placed into the stacking gel solution, and it was allowed to polymerise. After polymerisation, the comb was removed and each well was loaded with 70-µg proteins. The protein samples were diluted 1:3 with sample buffer (0.5 Tris-HCl, pH 6.8 12.5% (v/v); glycerol 10% (v/v); SDS 2% (w/v); 2-βmercaptoethanol 5% (v/v); bromophenol blue 0.001% (w/v)) and heated 5 minutes at 95 °C.

The gels were stained with coomassie blue R-256 and scanned to determine the relative content of myosin light chains. The same protein samples were also separated by SDS-polyacrylamide gel electrophoresis and then processed for Western blot analysis.

Separating gel
(12%)

Stacking gel
(4%)

Acrylamid 30 %

4 ml

0.66 ml

0.75 M Tris-HCl, pH 8.8, 0.2% SDS

5 ml

0.25 M Tris-HCl, pH 6.8, 0.2% SDS

2.5 ml

Distilled water

0.78 ml

1.72

Temed 10%

70 μl

50 μl

APS 10%

140 μl

100 μl

Table 1 . Recipes for separating and stacking polyacrylamide gels, based on the buffer system of Laemmli.

Quantification of transgene expression.
Rats were sacrificed, the hearts were removed, and the ventricles were immediately frozen in liquid nitrogen. The tissue was stored at -80°C until protein preparation. The total protein fraction was extracted from frozen tissue specimens (20-40 mg) by homogenization with a motor-driven glass-teflon homogenizer in SDS-sample buffer (5% SDS, 50 mM Tris-HCl, pH 7.5, 250 mM sucrose, 75 mM urea, 10 mM dithiothreitol), denatured for 3 min at 95 °C, and cleared by centrifugation.

The supernatant containing the total SDS-extracted proteins was removed and the protein concentration was determined by a modified Lowry method using 10% SDS and the Lowry mixture (CuSo₄, 2% NaK tartrat, 2% Na₂co₃ (Wang et al. 1975) using bovine serum albumin as the standard.

Ventricular SDS-extracted proteins (80μg) and different concentrations of the hALC-1_HISTwere separated by SDS-PAGE on a 12% resolving gel which was equilibrated for 10 minutes at room temperature in a transfer buffer (25 mM Tris base; 192 mM glycine and methanol 20% (v/v). The proteins were electrophoretically transferred (Bio-Rad Trans-blot SD, semi-dry transfer cell) from the gel to nitrocellulose membrane (Hybond-C, Amersham) for 2 h at 250 mA. Following transfer, the membrane was incubated with Ponceau staining solution for 10 minutes at room temperature.

The nitrocellulose membrane was blocked with 15% ovalbumin (0.1% Tween; 20 mM Tris base and 137 mM NaCl). The transfers were incubated overnight with the affinity-purified anti-human ALC-1 antibody at a concentration of 0.5 µg IgG/ml and subsequently with the secondary peroxidase-conjugated anti-rabbit antibody (Biogenes, Berlin, Germany) for 1 h at room temperature. Between each step, the membranes were washed by TBS (20 mM Tris base, 137 mM NaCl, pH 7.6) and TBST (20 mM Tris base, 137 mM NaCl and 01% Tween)

Immunoreactive proteins were visualized with the enhanced chemiluminescence’s reaction Kit (ECL, Amersham) and X ray films (X-Omat, Kodak, Rochester, NY). The signals were scanned by densitometry using BIO–RAD GS-710 (calibrated imaging densitometry, California, USA).

Immunofluorescence microscopy.
For immunofluorescence detection of the hALC-1 in the ventricular tissues, animals were anaesthetized (30 mg/kg Chloral hydrate), the hearts were removed, and 1mm³ left ventricular tissue samples were taken from the hearts and fixed by incubation for 2 h at room temperature with 4% paraformaldehyde, 0.1M PBS and 0.18M sucrose.

The tissues were washed (3 times each for 5 m) with 0.1M PBS, then incubated overnight in 2.3M sucrose, 0.1M PBS, and subsequently frozen in liquid nitrogen. Tissue sections (1μm) were incubated with blocking buffer (20 mM Tris/HCL pH 8.4,630mM NaCl, 0.05%Tween 20, 0.02% NaN3, 1% BSA) for 30 m at room temperature.

Tissue sections were incubated with anti hALC-1 antibody (rabbit antibodies) and anti-MHC antibodies (mouse antibodies) for 2 h at 37°C (2μg/ml). In a different set of experiments, tissue sections were incubated with the anti hALC-1 antibody and a monoclonal antibody against α-actinin (Sigma, St. Louis, Mo).

The tissues were washed with the blocking buffer and incubated with secondary antibodies (Alexa 594, red) anti-rabbit antibodies (Alexa 488, green) anti-mouse antibodies (Molecular Probes, Inc. USA) (5μg/ml) for 1 h at 37 °C.

Fluorescence was detected using an axioplan fluorescence microscope with appropriate filter systems. Micrographs were followed with an MC100 automatic camera with KodaK Tmax 400 film.

Analysis of the ventricular proteome by 2D-PAGE. Preparation of the protein samples:
Four TGR/hALC-1 and four WKY (12 weeks-old) rat ventricular tissues were used for 2D gel electrophoresis. Rat ventricular tissues in 2.2 parts v/w of 50 mM Tris buffer, pH 7.5, containing 50 mM KCL, 20 % v/v glycerol and 4 % w/v 3-[(3-chloramidopropyl) dimethylammonio-1-propanesulfonate (CHAPS)], were combined with protease inhibitor mixture [0.08 parts v/w of one Complete ^TM tablet (Molecular Biochemicals Roche, Mannheim, Germany), dissolved in 2 ml of 100 mM KCL, 20 % v/v glycerol and 50 mM Tris, pH 7.1. and 0.02 parts of 1 mM PMSF (phenylmethylsulfonylflouride) together with 1.4μM pepstatin A dissolved in ethanol].

Al l components were ground to a fine powder in a motor placed in liquid nitrogen bath. Sonication was performed in a water bath by adding 0.034 parts of glass beads to the defrosted homogenate. The resulting extract was stirred for 30 min at 4⁰ C in the presence of 0.023 parts v/w of 50 mM Tris buffer, pH 7.5, containing 50 mM KCL, 20 % v/v glycerol, 5 mM MgCl₂ x 6 H₂O and 0.025 parts v/w of DNase (Benzonase; Merck, Darmstadt, Germany).

Urea (6.5 M) and 2 M thiourea were dissolved in the sample. After dissolving, 0.01 parts v/w 70 mM DTT and 0.01 parts v/w ampholyte mixture Servalyte 2-4 (Serva, Heidelberg, Germany) were added and the homogenates were stirred for 30 min at 4^o C. The samples were stored at – 80^oC.
2D electrophoresis:
Protein extracts were purified by large-gel 2D (Klose 1999).The gel format was 46.4 cm (isoelectric focusing, pH range 3 -10) × 30 cm (SDS-PAGE direction) × 0.75 mm. Exactly 6 μl (containing 120 μg protein) of total protein extract were loaded on an isoelectric focusing tube gel (0.9 mm diameter).
Silver staining, spot detection and mass spectrometry
The proteins spots were visualized by an acidic silver staining procedure (Klose et al. 1995). The 2D silver-stained gels were analyzed visually on a light box (BIOTEC-FISCHER, Reiskirchen, Germany).

The total spot number of the protein expression-pattern was evaluated in both animal groups by using an automated software analysis program [Proteome Weaver imaging software 2.1.1 (Definiens)].

Mass spectrometry (MALDI TOF) was used for protein identification, 20 μl of each sample was loaded on 1.5 mm tube gels and stained with mass spectrometry compatible silver staining (Shevchenko et al. 1996).

Isolated perfused hearts (Langendorff method)
Animal experiments were performed using 12, 24 and 36 weeks-old transgenic (TGR/hALC-1) rats and age-matched wild type WKY rats. The rats were kept on a 12h light-dark cycle with 55% humidity at an ambient temperature of 23±2°C and given food, tap water and libitum. The institutional animal care body in the state of Berlin, Germany approved the studies.

For the Langendorff heart preparations (Langendorff 1895), hearts were excised from anaesthetized (30 mg/kg Chloral hydrate ) and heparinized (500 U/kg) male transgenic and WKY rats after thoracotomy and then cannulated for retrograde aortic perfusion with a modified Krebs-Henseleit solution containing NaCl (118 mM), KCl (4.7mM), CaCl₂ (1.5mM), MgSO₄ (1.2Mm), NaHCO₃ (25 mM), Na₂EDTA (0.05 mM), KH₂PO₄, (0.23 mM), 2.5% albumin and glucose (11.1 mM). The solution was saturated with 95% O₂/ 5% CO₂ pH 7.4.

The perfusion apparatus was from Hugo-Sachs Electronic (Germany). Systolic pressure was measured with a latex balloon, filled with ethanol/H₂O, which was inserted into the left ventricle through the left atrium via a catheter to a (Isotec) transducer. The pressure in the balloon was set from 14–18 mmHg. The stimulation frequency was fixed at 340 beats/min. The perfusion was carried out at 37°C with a constant aortic pressure of 70 mmHg. Signals were recorded on a linear-corder mark 8 WR 3500. Contractile data were monitored and recorded by computer software (HEM, Notocord, France).

The recorded functional parameters were coronary flow, perfusion pressure, developed left ventricular pressure (LVP), maximal rate of pressure increase (+dP/dtmax) and maximal rate of pressure decrease (-dP/dtmax).

Statistical analysis
Values are expressed as mean ± SEM. Analysis of significance was performed with the unpaired Student’s t- test.