| Aguirre-Arteta, Ana Maria: REGULATION OF DNA METHYLATION DURING DEVELOPMENT: ALTERNATIVE ISOFORMS OF DNA METHYLTRANSFERASE |
23
The Dnmt1 protein has a C-terminal (~500 amino acids) domain, sharing motifs (I-X) with over 100 prokaryotic 5mC MTases, linked to a N-terminal (~1000 amino acids) regulatory domain (see Fig. 1.7). The sequence similarities among mammalian and bacterial DNA MTases suggest a common evolutionary origin. A decade ago, it was proposed that the mammalian enzyme evolved via fusion of an ancestral prokaryotic restriction MTase gene with a second gene based on cDNA sequence and on similarity of the putative peptide to bacterial MTases . However, based on comparison of several eukaryotic MTases and deletion mapping of the enzymatic activity, we have suggested that MTases evolved by fusion of at least three separate genes .
At the beginning of this work additional 5‘ sequences were identified in the Dnmt1 cDNA as well as two different mRNA transcripts : one present only in testis (pachytene spermatocyte) and a second one characteristic of all somatic tissues.
In order to relate the functional motifs in the Dnmt1 protein with the exon-intron boundaries of the Dnmt1 gene and to study the regulation of the new isoforms, the elucidation of the genomic structure of the mouse Dnmt1 gene was undertaken. Furthermore, the sequence of the 5‘ end of the Dnmt1 gene was determined to establish the basis for investigating promoter regulation of the different Dnmt1 isoforms.
Overlapping phage clones, isolated from screening a mouse 129/Sv genomic library and subcloned into pSP72 (Promega) or pBluescript KS (pMET in Fig. 3.1, Stratagene), were generously provided by Dr. En Li (Charlestown, USA) . The region between pSP72RV10 and pSP72S5 was obtained by genomic PCR using DNA prepared from frozen 12 day old mouse embryos from strain C57BL6. The genomic DNA was extracted as indicated in the Materials and Methods section. One hundred ng of DNA in a reaction volume of 100 µl was amplified with a mix of Taq and Pwo DNA polymerases (Roche Molecular Biochemicals). The ~ 6 kb PCR product was directly cloned into pCRII vector (Invitrogen) and the resulting plasmid designated pCg6. The region upstream of pSP72S15 (pCg1 and pCg3) was obtained by a combination of genomic PCR and genome walking. The genome walking approach was used to obtain the fragment upstream the oocyte specific exon (pCg1) by using genomic DNA, which have been digested with five different enzymes and the resulting restriction fragments ligated to an adaptor primer. The upstream walk towards the putative promoter from the oocyte exon was then carried out following the instructions of the manufacturer (Clontech). PCR reactions with reverse primers located in the oocyte exon together with the adaptor primers of the genomic DNA fragments were done. The genomic PCR carried out to obtain the pCg3 fragment was done with a forward primer located on pCg1 and a reverse primer located on pSP72S15.
In order to determine the sizes of the introns, sequencing (GenBank accession numbers: AF 175410-175431, AF 234317-234318) and/or gel electrophoresis of the PCR products (Fig. 3.1) were performed. The PCR products containing genomic fragments were generated using primers located on both sides of the putative exon boundary. The mouse Dnmt1 cDNA was completely resequenced and the revised sequence has been submitted to GenBank (accession number AF 162282). The determination of the exon-intron boundaries (Table 3.1) was carried out by comparing genomic and cDNA sequences. Intron localizations at the 3‘ end of the Dnmt1 gene were obtained in collaboration with the group of Dr. R. J. Roberts (Beverly, USA).
In this thesis it has been elucidated that the mouse Dnmt1 gene consists of 39 exons and spans over 56 kb (Fig. 3.1). The exon sizes vary between 32 (exon 7) and 352 bp (exon 39) (Table 3.1). The region between the exon 1 and exon 29 contains introns of widely
24
different sizes as well as two very large introns. This region has a low exon density (number of exons per unit length). However, the region between exon 30 and 39 harbors introns that are smaller and much more uniform in size (Fig. 3.1), this region clearly has a higher exon density. The two different exon density patterns correspond to the division between catalytic and regulatory domains of the protein proposed before . Furthermore, the first exon is located in a CpG island (Fig. 3.8) and is separated from exon 2 by a 9.3 kb long intron, which is a typical feature of house keeping genes . The region spanning pCg1 until the end of exon 5 (Fig. 3.1) was completely sequenced (GenBank accession numbers AF 175410-175412). The TAG stop codon was found 39 bp into exon 39 and two polyadenylation signals (AATAAA) were found, the first one was mapped 290 bp downstream of the stop codon and the second one was identified 274 bp further downstream.During the process of this work the structure of the human Dnmt1 gene has also been published . A comparison between mouse and human DNA sequences reveals a similar genomic organization. Exon boundaries are conserved in 35 out of 38 cases. The only exception to a perfectly conserved intron-exon organization is the presence of an additional intron in the human gene whose corresponding location would be in mouse exon 37. Intron sizes, with the exception of two large introns after oocyte and spermatocyte specific exons, range between 77 bp and ~ 3kbp (Table 3.1). All 5‘ and 3‘ splice sites agree with the consensus found for rodents with the exception of the 5‘ donor site of intron 10 where the GT consensus is replaced by GC (Table 3.1). The human Dnmt1 gene has two exceptions to the GT/AG rule (Table 3.1), but none correspond to the one in the mouse gene. In one case GC replaces GT as splice donor of intron 11, while in the other case CT replaces AG as splice acceptor of intron 39 .
The location of the conserved motifs of the catalytic domain (Fig. 1.7) was compared with the intron-exon boundaries (Table 3.1). Three out of seven exon boundaries fall within highly conserved motifs and thus indicate that there is no correlation between proteins motifs and exon-intron boundaries.
25
Fig. 3.1. Genomic organization of the mouse Dnmt1 gene. At the top of the figure are depicted the exons and introns, the restriction map and the localization of the cloned genomic DNA fragments within the Dnmt1 locus. B: BamHI; E: EcoRI; S: SalI; X: XbaI. The clones denominated pSP72S5 and pSP72S11 share the SalI site in exon 17. Plasmid insert sizes are indicated in italics. At the bottom of the figure the intron size determinations by agarose gel electrophoresis are shown. MTase specific primers were selected within 50 bp on both sides of the putative intron boundary and used for PCR amplification. The PCR products were separated on an agarose gel and intron sizes were determined from the standard curve of the molecular weight markers. The results are summarized in the table 3.1.

26
Table 3.1. The start codon corresponds to the third ATG (ATG3) in exon 1 (Gaudet et al., 1998). The stop codon (TAG) is located 39 bp into exon 39 and is followed bz a 311 bp untranslated region. The lines separating exon 30 and 31 show the separation between catalytic and regulatory domains. Intron sizes were determined by sequencing (GenBank accession numbers: AF 175410-175431, AF 234317-234318) and/or gel electrophoresis (Fig. 3.1). Intron phases are defined as the position of the intron within the codon.
![]() |
27
In addition to the new 5‘ end exon reported by our group a small cDNA sequence of 155 bp detected in testis was found through searches in the EMBL database (EMBL accession number X 77486). Also, the presence of a ~ 1 kb larger Dnmt1 transcript in testis had been reported part of which could correspond to this new EMBL sequence entry. Taken together these results indicated the presence of alternative Dnmt1 isoforms in this tissue which interestingly is where profound changes in the overall DNA methylation level and pattern occur. Since the 155 bp cDNA sequence deposited in the database cannot account for the 1kb longer transcript found in testis, a screen for the missing cDNA sequence of this new Dnmt1 isoform was started. Comparison of the EMBL sequence with the Dnmt1 genomic sequence (GenBank accession number AF 175410; section 3.1; ) showed that the first 70 bp (depicted in dark blue in Fig.3.2) of the EMBL sequence are located between exons 1 and 2. This 70 bp part of the sequence is testis specific (thereafter referred to as testis-specific exon or t-exon) and it is located between nucleotides 1937-2005 (GenBank accession number AF 175411; ), the rest of the sequence up to 155 bp corresponds to exon 2 and 48 bp of exon 3 located between nucleotides 5242-5278 and 6041-6089 (GenBank accession number AF 175412; ) respectively. Taking a closer look at the Dnmt1 gene sequence, between the end of exon 1 and the first nucleotide of the 70 bp testis specific sequence there is a distance of approximately 800 bp. Therefore, the testis specific sequence could either continuously extend at its 5‘ end and/or arise from alternative splicing. The information obtained from the genomic localization of the testis specific sequence allowed the design of oligos at different positions upstream of this 70 bp sequence and the screening of the 5‘ end of the Dnmt1 gene by RT-PCR and RACE reactions (Fig.3.2).
Oligos located in the t-exon, exon 1 and exon 4 were selected for the RT-PCR and RACE reactions (Fig.3.2A) by using the Lasergene software program (Primer Selection, DNASTAR). Commercially available cDNA from mouse testis (Marathon cDNA, Clontech) was used for the RACE reactions. The RACE technique is a variation of the PCR method used to amplify cDNAs representing the region between a known point in a mRNA transcript and its 3‘ or 5‘ end . A short internal stretch of sequence must already be known from the mRNA of interest and from this sequence gene-specific primers are chosen that are oriented in the direction of the missing sequence. Extension of the partial cDNAs from the unknown end of the message back to the known region is achieved using primers that anneal to the preexisting poly A tail (3‘ end) or to an appended tail (5‘ end). For RT-PCR, poly A RNA (100 ng) or total RNA (1 µg) were first converted into cDNA by reverse transcription using random primers. The subsequent PCR reactions were done with 100 ng of cDNA and the primer pairs indicated (Fig. 3.2B). The cycling conditions were according to the respective primer pair annealing temperatures. Fresh PCR products were then cloned into the pCRII vector (Invitrogen) and sequenced.
28
The size, sequence and location of the oligos used are shown in the table below:
|
Oligo Nr. |
Location |
Used for: |
Sequence |
|
243 (F) |
exon1 |
RT-PCR |
5‘ AAG ATG CCA GCG CGA ACA 3‘ |
|
238 (R) |
exon4 |
RT-PCR |
5‘ TTG GCT TTT TGA GTG AGA 3‘ |
|
242 (F) |
exon1 |
RT-PCR |
5‘ GGC TCG CTC CCG GAC CAT 3‘ |
|
241 (R) |
t-exon |
RT-PCR |
5‘ TGC CAT CCC TCA CTC CTC 3‘ |
|
347 (R) |
exon4 |
RACE |
5‘ GGC TTT TTG AGT GAG AGT GTG TGT TCC G 3‘ |
|
348 (R) |
t-exon |
RACE |
5‘ TGC CAT CCC TCA CTC CTC GAA ATA AAC 3‘ |
Two new isoforms were obtained (Fig. 3.2C): one was obtained by RT-PCR showing a new splicing variant and the second one was obtained by RACE analysis containing an extension of 316 bp at the 5‘ end of the t-exon. Further RACE analysis showed that the t-exon in this isoform is ~ 800 bp. The new splicing variant starts with exon 1 and continues with 88 bp of the t-exon (Fig. 3.2C). The exon-intron boundaries for this splicing variant match the GT/AG consensus (see also section 3.1). Due to the low abundance of this new isoform and the difficulty to obtain it, this isoform was not further investigated. The next sections therefore refer to the isoform obtained by RACE analysis.
While this work was in progress a testis-specific Dnmt1 isoform was reported which corresponds to the one obtained by RACE, whose 5’ boundary is approximately 80 nucleotides downstream of the 3’ end of exon 1 of the ubiquitous mRNA (5.4 kb, Fig. 3.3). Furthermore in the ovaries a first exon specific to oocyte Mertineit, 1998 # 24 substitutes exon 1 and is located in the Dnmt1 gene 7 kb upstream of exon 1 (Fig. 3.10).
29
Fig. 3.2. Alternative dnmt1 isoforms in testis. (A) Short Dnmt1 genomic scheme with the location of the oligos used. (B) Agarose gels showing the products from the RT-PCR (this reaction was carried out in duplicate) and the RACE reactions, the oligos used are indicated on top of each of the gels. The PCR control without cDNA is indicated with a minus sign (-). (C) Two new alternative Dnmt1 isoform are depicted. By RT-PCR, with random oligos and subsequent nested PCR with the oligos indicated, a new alternative splicing form was found starting with exon 1 and continuing with 88 nucleotides of the testis specific exon (dark blue). By RACE analysis an extension (light blue) of the 5’ end of the t-exon was obtained using the oligos depicted in the panel B. A first RACE reaction was done with oligo 347 in combination with the adaptor primer 1 (AP1). An aliquot from this first reaction was then used in a second nested RACE reaction with oligo 348 in combination with adaptor primer 2 (AP2).

To find out the transcript size, tissue distribution and expression level of the Dnmt1 isoforms Northern blot analysis was performed. Blots containing poly A RNA from mouse
30
testis (Clontech) were used. Three different cDNA probes were used for the Northern hybridizations are represented by color coding in Fig.3.3 and these are: a 377 bp (nucleotides 674 to 1050) and a 950 bp (nucleotides 2946 to 3895) corresponding to the N-terminal and C-terminal region of Dnmt1 respectively (GenBank accession number AF 162282; ) depicted in green in Fig.3.3. After hybridization with these probes, signals were detected and the blots were stripped by boiling with SDS solution (0.5% SDS) twice for 15 min, before being rehybridized with the next probe. Also a 396 bp probe (nucleotides 1621-2016, GenBank accession number AF 175411; ) was used, this fragment corresponds to the testis specific exon (Fig. 3.2C and also Fig. 3.3 depicted in blue). Finally, a mouse
-actin probe was hybridized to the blots to control for RNA loading. Labelling of the probes, hybridization, washes and exposure were done as described before (see Materials and Methods). The blots were exposed to a phosphorimager screen, scanned on a phosphorimager with the Image Quant software (Molecular Dynamics) and the results are shown in Fig. 3.3.
The use of two probes, depicted in green in Fig. 3.3, detected a Dnmt1 transcript of 5.4 kb that is present in all tissues assayed. Its size was determined by comparing with the standard curve generated from the molecular weight markers. When differences in the amount of RNA loaded (as determined by probing the blot with
-actin) were taken into account, the 5.4 kb Dnmt1 transcript was most abundant in heart and brain. Examination of the phosphorimages after longer exposure showed the presence of a slower migrating mRNA transcript of 6.2 kb that was present in testis and in skeletal muscle.
To investigate the structure of these longer transcripts blots were stripped and reprobed with a new probe containing testis specific sequences. If the slower mRNA transcript band (detected with the green depicted probes (Fig. 3.3)) contains the same sequences in testis and skeletal muscle, then it was expected to see this transcript in both organs when using a testis specific probe (depicted in blue in Fig. 3.3). However, the 6.2 kb transcript was detected by the testis specific probe only in testis and not in skeletal muscle. It might be that this slower migrating band in testis differs from the one present in skeletal muscle, or that the levels of the skeletal muscle transcript are so low that its presence is difficult to detect by Northern blot analysis. Higher amounts of RNA from skeletal muscle were tried but did not give interpretable results in part due to the lack of separation of high amounts of RNA on formaldehyde gels.
31
Fig. 3.3. Expression of Dnmt1 mRNA in different mouse tissues. The figure shows Northern blots containing polyA RNA from the mouse tissues indicated. The blots were hybridized with three probes as indicated by the color coding. The black vertical bar indicates the separation between the N- and C-terminal domains. In the case of brain and heart tissue where Dnmt1 mRNA levels were high, a shorter exposure is shown underneath the corresponding blot. All blots were reprobed with a
-actin probe as a loading control.

The RACE and RT-PCR as well as the Northern blot analysis have shown that at least two major isoforms of Dnmt1 are present, one that is ubiquitously expressed and the other that is detected in testis and in skeletal muscle. To analyze the localization of these isoforms at the cellular level, the in situ hybridization technique was used. The following is a brief introduction to the morphology and development of the testis to allow the identification of the mouse testis cells where the Dnmt1 isoforms were localized.
The testis has two major components: the intertubular or interstitial compartment (interstitium) and the seminiferous tubule compartment. The interstitial compartment contains the blood and the lymphatic vessels. The seminiferous tubules are convoluted loops that have their two ends connected into the beginning of the rete testis. Although numerous convolutions are present in each loop, the tubules straighten between convolutions and travel largely in the long axis of the testis (Fig. 3.5C). As a result of this pattern of organization, a transverse histological section through the long axis of the testis can be used to visualize cross-sectioned tubules (Fig. 3.5C).
The adult mammalian testis contains male germ cells in all stages of development as well as several somatic cell types, including Sertoli, Leydig, and interstitial cells. The process of spermatogenesis can be divided into three main phases; a mitotic phase in which stem cells, called spermatogonia, replicate DNA and divide; a meiotic phase in which spermatocytes undergo genetic recombination and meiosis; and a differentiation phase, spermiogenesis, in which haploid cells, spermatids, acquire the specialized flagellum, Golgi, nucleus and mitochondria of the mature spermatozoon. During the differentiation or spermiogenesis, the spermatids transform themselves into cells structurally equipped to reach and fertilize the egg (Fig. 3.4 and Fig. 3.5 C). The cells in the first meiotic prophase, primary spermatocytes, can be further subdivided according to the stages of
32
meiosis, preleptotene, leptotene, zygotene, pachytene and diplotene. The haploid phase can also be subdivided into a series of steps based on the morphology of the developing spermatids. The number and morphological characteristics of the steps differ slightly among mammals, in the case of mice 16 can be distinguished. In mice, cells in steps 1-8, round spermatids, are characterized by round, decondensed nuclei; cells in steps 9-early 12 are known as elongating spermatids, because the nuclear shape changes from round to elongated; and cells in the remaining steps are referred to in general as elongated spermatids (Fig. 3.4).
Fig.3.4. Map of the cycle of the seminiferous epithelium of the mouse . The developmental progression of a cell is followed horizontally until the right hand border of the cycle map is reached. The cell progression continues at the left of the cycle map one row up. The vertical columns, designated by Roman numbers, depict cell associations (stages), meaning the different cell types that can be found in a testis cross section. In, intermediate spermatogonia; B, type B cells; Pl, preleptotene; L, leptotene; Z, zygotene; P, pachytene; D, diplotene.

The Northern blot analysis indicated the presence of two (6.2 and 5.4 kb) Dnmt1 transcripts in two tissues. The next step was to find out where these transcripts were localized at the cellular level in the organs that showed the new slower migrating transcript (6.2 kb) by Northern blot analysis. Dnmt1 cDNA fragments (containing the areas depicted in Fig. 3.5A and B as blue and green) were cloned in the pCRII vector (Invitrogen). This vector contains T3 and T7 promoters in opposite sides of the multiple cloning site, allowing RNA to be transcribed in vitro from either strand of the insert. The cDNA fragments were cloned downstream from the T7 (depicted in blue) and from the T3 (depicted in green) RNA polymerase dependent promoter (Fig. 3.5A and B). The single stranded antisense (sense for the control) RNA probes were synthesized with the appropriate RNA polymerase and radioactive nucleotides by using an in vitro transcription
33
system (Promega). The radioactively labeled RNA transcripts were then hybridized with cryo sections of testis and skeletal muscle. The appropriate Dnmt1 RNA probe was diluted in hybridization buffer and hybridized with the tissue sections overnight. The prehybridization times and the temperature for hybridization were optimized. The optimal conditions were found to be 37oC for prehybridization for a minimal of 4 hours and 42oC overnight for hybridization. Under these conditions the maximum sensitivity and the lowest background was obtained. Concurrently with the slides containing the antisense probe, adjacent tissue sections were also included containing a sense RNA probe as control for genomic DNA hybridization and unspecific binding. Signals were detected as described in Materials and Methods.34
Fig. 3.5. Localization of Dnmt1 mRNA in different adult mouse tissues and embryo. (A) and (B) show cryo sections of mouse testis, skeletal muscle and 13 day-old embryo. The hybridizations were done using probes as indicated by the color coding. Sagittal sections were used for skeletal muscle and embryo and for testis cross sections. Very weak signals (black dots) are seen in skeletal muscle (A) using the probe (depicted in blue) which also highlights the 6.2 kb band corresponding to the testis mRNA in the Northern blots (Fig. 3.3). When using the same probe in testis sections clear signals are localized on the cells closest to the lumen (spermatids). However, when using a probe that spans most of the cDNA (depicted in green), the signals are seen in most of the cells. The probe, depicted in blue, was used for embryo sections (B). Areas localized in the ear such as the lateral wall of right posterior semicircular canal (1) and right tubo tympanic recess (2) and also areas on the hip joint such as acetabular fossa (3) showed the presence of this transcript in embryo sections. The exposure times were 2 weeks for testis and embryo and 4 weeks for skeletal muscle. Negative controls (sense probe) were hybridized to adjacent sections. (C) Cross section of a seminiferous tubule. The schematic outline was taken from Clermont et al., and the diagram showing the different types of cells on a cross section from testis was taken from Setchell et al., . SG; spermatogonia, SC; primary spermatocyte, SD; spermatid, S; sertoli cell. (D)The ear and the hip anatomy are shown and the schematic outlines were taken from http://www.bcm.tcm.edu/oto/studs/anat/tbone.html and http://www.acay.com. au/~dissi/sbc/hipdys.htm , respectively. Ear anatomy, (1) Semicircular canals and (2) Tympanic membrane are indicated in the figure. Hip anatomy, (1): Centre of the femoral head; (2): Cranial acetabular edge; (3): Acetabular fossa; (4): Cranial effective acetabular edge; (5): Dorsal acetabular edge; (6): Caudal acetabular edge; (7): Femoral head/neck reconturing; (8): Femoral ahead reconturing.

When the probe which detects the ubiquitously expressed isoform (depicted in green in Fig. 3.5A) was hybridized to cross sections from mouse testis, all the cells that surrounded the lumen were labeled as shown by the black dots. When a probe that recognizes a sequence localized in the testis isoform was used (depicted in blue in Fig. 3.5A) the signals were more specific and localized to the spermatids which are the cells closer to the lumen. Adjacent cross sections that were labeled with a sense probe were used as a negative control and the absence of black dots in the whole section indicates the specificity of both antisense probes. The exposure times for the testis sections were ~10 days. A larger form of Dnmt1 mRNA (which corresponds to the form depicted in blue in Fig. 3.5A) was shown to be present only in pachytene spermatocytes (see also Fig. 3.4). In these experiments isolated populations of male germ cells were used to prepare RNA for Northern blots . In these type of experiments it would be difficult to have pure populations of each cell type and thus contaminations by other cell types are difficult to avoid.
The same probe that hybridizes only to spermatids in testis sections (depicted in blue) was also used for skeletal muscle (sk. muscle) (Fig. 3.5A). Sagittal skeletal muscle sections were hybridized with the mentioned probe and after 4 weeks exposure very weak signals were detected, which suggests a low abundance of this transcript in this tissue. The sense control showed no signal.
35
To investigate whether this isoform is expressed during development and if so in which cell types, sagittal sections of whole mouse embryos (day 13) were hybridized to the probe corresponding to the t-exon (depicted in blue in Fig. 3.5A and B). The positive signals obtained were localized in cartilages of the ear and hip. Two areas of the ear where this isoform was localized were the lateral wall of right posterior semicircular canal and the right tubo tympanic recess (Fig. 3.5B; 1 and 2 respectively). Briefly, the ear can be divided into two areas the middle and the inner ear. It is in the inner ear where the cochlea which is the hearing part and the semicircular canals (Fig. 3.5D; ear anatomy) are located. The semicircular canals are not part of the hearing function, they are part of the balance system. For example, when a movement is done to turn the head, the fluid in the canal moves the tiny hairs of the nerve endings and bend them. Nerve impulses travel to the brain, giving information about the direction in which the head is moving. The other area in the embryo expressing the new isoform is the acetabular fossa which forms part of the hip (Fig. 3.5D, 3; hip anatomy). The new transcript has been detected in cartilages located in the ear (Fig. 3.5B, 1 and 2) and the area of the hip where this alternative transcript was present has also been reported to contain a cartilage covered part . The skeletal muscle showed no detectable signals, in the 13 day-old embryo, when using the probe depicted in blue.In summary, two Dnmt1 transcripts are present: one that is ubiquitously expressed (5.4 kb) and a larger transcript (6.2 kb), which is present only in adult mouse testis and skeletal muscle. The slower migrating transcript has been further analyzed at the cellular level in testis sections and localized to the spermatids.
Overall DNA methylation changes dramatically during gametogenesis (see section 1.2.1) and therefore, in addition to the mRNA analysis, the level and localization of the Dnmt1 protein was studied in sections from ovaries and testis by immunohistochemistry.
In the female mouse the germ cells pass throught several oogonial divisions and reach the oocyte stage during embryonal development. About 3 days after birth the oocytes reach a static state known as the dictyate stage, which is maintained until a few hours before ovulation. A few days after birth some antra appear and the ovum reaches its maximum size at the time that antrum formation begins. Once oogenesis has begun, it continues in regular 4 1/2 to 5 day cycles throughout the reproductive life to about 12 or 14 months of age. A brief summary of the stages of oogenesis is depicted in the Fig. 3.6A. Briefly, after ovulation, the dominant follicle, reorganizes to become the corpus luteum. Thus, following rupture of the follicle, capillaries and fibroblasts from the surrounding stroma proliferate and penetrate the basal lamina and a rapid vascularization of the corpus luteus takes place. The granulosa cells present undergo morphological changes and this process is referred to as luteinization. These latter cells, the surrounding interstitial cells and the invading vasculature, give rise to a corpus luteum. It is this endocrine gland which is the major source of sex steroid hormones secreted by the ovary during the postovulatory phase of the cycle.
Ovaries and testis which were previously embedded in paraffin were sectioned and stained with the antibody pATH5, which recognizes multiple epitopes within the region between aminoacids 255-753 , which are present in both isoforms. The Dnmt1 protein is very abundant in oocytes as seen in Fig. 3.6B where mainly the cytoplasm is stained. In Fig. 3.6B a mature follicle is shown where the antrum (Fig. 3.6A and B) is already formed and the oocyte harbored in this cavity is intensively stained. The oocytes used were from adult female mice which explains the strong cytoplasmic staining. Mertineit et al. recently showed
36
dramatic changes in the amount and localization of Dnmt1 during oogenesis. Growing oocytes showed intense nuclei and substantial cytoplasmic staining. At later stages of oocyte growth, Dnmt1 is no longer detectable in nuclei but accumulates to high levels in the cytoplasm. The Dnmt1 protein was also detected in the lutein cells (Fig. 3.6B).
Fig. 3.6. Localization of Dnmt1 during oogenesis. (A) Scheme of the development of an ovarian follicle is depicted (figure modified from R. Rugh). (B) Localization of the Dnmt1 protein by immunofluorescence staining with the rabbit polyclonal pATH5 antibody, detected with the Rhodamine conjugated anti-rabbit IgG antibody. The DNA counterstaining was performed with Hoechst 33258 to locate cell nuclei. The Dnmt1 protein is localized on the cytoplasm of the oocyte as indicated by the intense staining with the pATH5 antibody. - Ab control: represents the control without the first antibody.

37
Fig. 3.7. Localization of Dnmt1 in seminiferous tubules. The figure shows the localization of the Dnmt1 protein by inmunofluorescence staining with the rabbit polyclonal pATH5 antibody, detected with the Rhodamine conjugated anti rabbit IgG antibody. The DNA counterstaining was performed with Hoechst 33258 to locate the cell nuclei. The Dnmt1 protein is localized in spermatogonial cells which are the cells with a basal localization. The Dnmt1 is also seen in spermatids which are the cells closer to the lumen. -Ab control: indicates the control without the first antibody.

38
The Dnmt1 staining in testis was localized to the spermatogonia, which are the mitotically active stem cells that lie at the basal side of the seminiferous epithelium, and in some primary spermatocytes, which are the next type of cells found in a testis cross section and are less basal than the spermatogonia cells. The spermatids also showed positive signals in some of the testis sections. These are the most specialized testis cells and correspond to a stage just previous to the formation of spermatozoon, in which the spermatids undergo morphological modification in a process called spermiogenesis (Fig. 3.4). However, the background level in the spermatids is high which makes it difficult to evaluate the signal observed in these cells. It is interesting that the new alternative Dnmt1 transcript has also been localized to these cells by in situ hybridization (Fig. 3.5A), suggesting that this Dnmt1 protein staining (Fig. 3.7) could correspond to this isoform. That would contradict a recent report proposing that this transcript is not translated.
In mammals, levels of 5mC increase not only during gametogenesis but also after implantation when tissue specific patterns are established . During differentiation, when tissue specific genes begin to be expressed, the promoter regions of many of these genes are demethylated while the ones from inactive genes are methylated. One of the best characterized systems to study establishment of tissue specific gene expression is the skeletal muscle system, but conflicting data have been published concerning the role of DNA methylation during skeletal myogenesis. Thus on one hand, artificially induced demethylation seems to stimulate myogenic differentiation , which is in accordance with the observation that the somatic Dnmt1 isoform is downregulated during myogenesis . On the other hand ectopic overexpression of a truncated Dnmt1 protein in undifferentiated myoblasts leads to changes in gene expression and induction of myogenic differentiation . The Northern blot analyses presented in Fig. 3.3 indicated the presence of two transcripts of 5.4 and 6.2 kb not only in testis but also in skeletal muscle. The shorter transcript corresponds to the ubiquitously expressed Dnmt1 described before but the longer transcript in muscle had not been previously reported and could correspond to an alternative isoform with potentially new properties. To isolate the cDNA corresponding to this alternative transcript, a combination of RACE and RT-PCR was used.
The Dnmt1 cDNA has been shown to have 39 exons and to span over 56 kb (see section 3.1. Genomic structure). RT-PCR products from skeletal muscle RNA were compared with the previously described somatic isoform of Dnmt1 from exon 5 to 37 to search for potential alternatively spliced exons (Fig. 3.8B). The oligos used in the PCR reactions as well as their exon localization and sequence are shown on the table below where the primer pairs are separated by horizontal lines.
39
|
Oligo Nr. |
Location | |
|
58 (F) |
exon20 |
5‘ GAG CCA GGT AGA GAG TTA 3‘ |
|
61 (R) |
exon23 |
5‘ CAC CGC CAA GTT AGG ACA 3‘ |
|
52 (F) |
exon5 |
5‘ ACC ATC ACG GCT CAC TTC 3‘ |
|
55 (R) |
exon12 |
5‘ TCC TTG GGT CTC CGT TTG 3‘ |
|
70 (F) |
exon35 |
5‘ CCC TTC CGA ACC ATC ACC 3‘ |
|
72 (R) |
exon37 |
5’ GCA GGC ACC AGG GGA TGA 3‘ |
|
60 (F) |
exon23 |
5‘ GGC GGT GAA GGA GGC AGA 3‘ |
|
63 (R) |
exon25 |
5‘ AGG GGC TTT GTA GAT GAC 3‘ |
|
54 (F) |
exon12 |
5‘ AAC GGA GAC CCA AGG AAG 3‘ |
|
57 (R) |
exon17 |
5‘ ACA CCC AGA AAA GTA GAG 3‘ |
|
62 (F) |
exon25 |
5‘ AAG GTC AAG GTC ATC TAC 3‘ |
|
65 (R) |
exon28 |
5‘ TTC TCC CCT TGA TGT AGT 3‘ |
|
56 (F) |
exon17 |
5‘ GGG CAC CTG TGT CCT GTC 3‘ |
|
59 (R) |
exon20 |
5‘ TGG GGG TCT CAT CAT CGT 3‘ |
|
64 (F) |
exon28 |
5‘ TCG GTC GGA TAA AAG AGA 3‘ |
|
72 (R) |
exon37 |
5’ GCA GGC ACC AGG GGA TGA 3‘ |
The oligos were 18 mers with low melting temperatures, thus annealing temperatures used in the PCR reactions were in the range of 40-45oC.
The PCR product from the plasmid containing the ubiquitously expressed cDNA was always run on the left hand side from the PCR product obtained with cDNA from skeletal muscle as seen in part B from Fig. 3.8. Negative controls were also included in the reactions: one negative control for the PCR reaction which has all the PCR reagents except the cDNA and a RT negative control which includes all the reagents necessary to perform the RT reaction but not the enzyme (reverse transcriptase). The PCR products were in the range of 417-475 bp except for one that was 1500 bp long, due to the difficulties to find good primer pairs in the region. The negative controls showed no bands indicating the specificity of the PCR and RT reactions. No differences were found from exon 5 to exon 37 when screening for the presence of alternative exons by comparing RT-PCR products from skeletal muscle cDNA with a plasmid containing the ubiquitously expressed Dnmt1 cDNA .
The next step was to test whether new 3‘ or 5‘ exons are present in this alternative transcript by performing RACE reactions using gene-specific primers located in exon 37 and 4, respectively. The products obtained in both reactions were cloned and sequenced. From the 3‘ RACE reaction the sequences obtained (Fig. 3.8A) contained exons 37 to 39 from the previously described somatic isoform of Dnmt1 and utilization of the first polyadenylation site (red box in Fig. 3.8A, see section 3.1. Genomic structure) , and therefore can not account for the longer mRNA found by Northern blot analysis in skeletal muscle (6.2 kb in Fig. 3.3). However, from the 5‘ RACE reactions two different size products were obtained and the respective sequences contained either exon 1 to 4 of the previously described ubiquitously expressed isoform
40
or the t-exon followed by exons 2 to 4 (Fig. 3.8C). Since no longer RACE products were obtained, RT-PCR reactions using primers located at different positions in the genomic region upstream of the 5‘ end of the RACE product corresponding to the testis specific isoform were used to map the beginning of this exon in the skeletal muscle isoform. The oligos used in these RACE and PCR reactions as well as their exon localization and sequence are shown on the table below where primer pairs are separated by horizontal lines. Primers 371 and 347 were used in RACE reactions.
|
Oligo Nr. |
Location | |
|
371 (F) |
exon1 |
5‘ AAT TCA GCA CCC TCA TCC CCT GGT GCC T 3‘ |
|
347 (R) |
exon4 |
5‘ GGC TTT TTG AGT GAG AGT GTG TGT TCC G 3‘ |
|
297 (F) |
t-/sk.m ex. |
5‘ GCC CCC GCC CTA TTA TTT TA 3‘ |
|
401 (R) |
exon5 |
5‘ TGA TGG TGG TCT GCC TGG T 3‘ |
|
297 (F) |
t-/sk.m ex. |
5‘ GCC CCC GCC CTA TTA TTT TA 3‘ |
|
420 (R) |
exon4 |
5‘ TTC CCC TCT TCC GAC TCT TC 3‘ |
|
297 (F) |
t-/sk.m ex. |
5‘ GCC CCC GCC CTA TTA TTT TA 3‘ |
|
403 (R) |
t-/sk.m ex. |
5‘ CTG GTG TGA CGT CGA AGA CT 3‘ |
|
320 (F) |
t-/sk.m ex. |
5‘ ATG CGC GGG GCA GCG TTT 3‘ |
|
316 (R) |
t-/sk.m ex. |
5‘ TAA AAT AAT AGG GCG GGG GC 3‘ |
The primers used for these reactions were 18-20 mers and the annealing temperature used in the PCR reactions was 55oC. Some of the primer combinations and reaction products are shown in Fig. 3.8C .
The sequence of the longest 5‘ extension product amplified from skeletal muscle RNA is shown at the bottom of Fig. 3.8C (GenBank accession number AF 175432). This sequence turns out to be identical to the one identified in testis (section 3.2.1).
42
Fig. 3.8. Cloning of the skeletal muscle Dnmt1 isoform. (A) 3‘ RACE was used to screen for differences at the 3‘ end which could account for the novel Dnmt1 transcript in skeletal muscle. A forward oligo in exon 37 (371) in combination with the adaptor primer (AP) were used. The PCR reaction was carried out in duplicate and the agarose shows the PCR products obtained whose size corresponds to approximately 800 bp. The PCR products were then cloned into the pCRII vector (sequence in capital letters) and sequenced. sk.m, corresponds to PCR product from skeletal muscle cDNA; -, represents the minus cDNA control PCR. The sequence obtained shows no new exons (from exon 37 to 39) and utilization of the first polyadenylation signal (indicated by a red box)(section 3.1 and ). (B) Screening for the presence of alternative exons by comparing RT-PCR products from skeletal muscle cDNA with a plasmid containing the ubiquitously expressed Dnmt1 cDNA. Skeletal muscle RNA was reverse transcribed using random primers. Different PCR reactions were done using oligo pairs as indicated, spanning the known Dnmt1 cDNA from exon 5 (ex. 5) to exon 37 (ex. 37). -RT, corresponds to the negative control without reverse transcriptase; -, corresponds to the negative control for the PCR reaction without cDNA template; C, PCR product from the plasmid; sk. m, PCR product from skeletal muscle cDNA. (C) To screen for new 5‘ end and/or alternative exons, a combination of oligos were used in 5‘ RACE and RT-PCR reactions using skeletal muscle mRNA. The corresponding location of the primers used and the 5‘ genomic structure (see also Fig. 3.10) of the ubiquitous Dnmt1 (exon 1 to 9) as well as the testis specific isoform (indicated in blue) are depicted in the diagram. Reverse transcriptase reactions were done both with random and with and oligo (403) located in exon 9, and the RACE reaction with an oligo positioned in exon 4. -RT, as in (B); -, as in (B); +, positive PCR control. All the PCR products were cloned into pCRII and sequenced. From the RACE reactions two isoforms were obtained multiple times, which contain either exon 1 or the isoform isolated from testis (section 3.2.1). RT-PCR analysis using primers at different positions of the testis specific exon further confirmed the presence of this isoform in skeletal muscle mRNA. The sequence of the longest PCR product (GenBank accession number AF 175432) is shown underneath and the different exons are color coded as in the genomic structure.

43
The identification of this alternative Dnmt1 isoform in skeletal muscle raises the question of when it is expressed during myogenic differentiation. To answer this question a well characterized in vitro differentiation system that is based on the ability of C2C12 mouse myoblasts (MB) to spontaneously differentiate into myotubes (MT) upon mitogen withdrawal (Fig. 3.9A) was used in this study. RNA from proliferating myoblasts as well as from differentiated myotubes was isolated and the expression of the two Dnmt1 isoforms was analyzed by RT-PCR using upstream primers located either in exon 1 or in the t-/skeletal muscle specific exon (Fig. 3.9B). The ubiquitously expressed isoform containing exon 1 was present in both myoblasts and myotubes albeit at a lower level in differentiated cells (Fig. 3.9C). This is in agreement with a previous report showing a similar transcription rate but a shorter half-life of the mRNA for Dnmt1 in differentiated mouse myotubes using a different myoblast cell line . The new isoform, however, was not detectable in undifferentiated myoblasts and was only expressed in differentiated myotubes (Fig. 3.9C). Equal amounts of input cDNA were present in both cases as shown by the similar amounts of GAPDH specific PCR fragment obtained using the same cDNA samples (Fig. 3.9 C). As a differentiation control primers specific for the mouse myogenin cDNA , a skeletal muscle specific transcription factor, which is expressed only after the onset of terminal differentiation , were used. As expected, myogenin could only be amplified from myotube RNA (Fig. 3.9C). These results show that this alternative Dnmt1 isoform is specifically expressed in myotubes during myogenesis.
44
Fig.3.9. (A) The images and diagram above illustrate the myogenic differentiation system. Upon serum deprivation myoblasts (MB) fuse to form multinucleated myotubes (MT) which express several muscle-specific proteins such as the basic helix-loop-helix transcription factor myogenin. (B) Location of the oligos used for RT-PCR. (C) RT-PCR products (with and without reverse transcriptase, + and -) were analyzed in agarose gels. A 343 bp fragment was obtained in MT but not in MB using oligos located in the testis/skeletal muscle exon (depicted in blue) and in exon 4. For the ubiquitously expressed isoform, oligos located in exon 1 and exon 4 were used in the RT-PCR reaction, and the expected fragment of 264 bp was obtained in MB and at lower level in MT. RT-PCR with GAPDH specific oligos was used as a loading control giving rise to the 463 bp product seen at equal amounts in MB and MT. As a control for myogenic differentiation oligos that amplify a 450 bp fragment of the myogenin transcription factor were used and, as expected, a product is obtained in MT and not in MB.

The most prominent Dnmt1 isoforms seem to be generated by alternative transcriptional start sites. Therefore the 5‘ end of the Dnmt1 gene was sequenced (GenBank acession number AF 175410-175413; about 26 kbp from the oocyte-specific exon to exon 9). In Fig. 3.10 the structure of the 5‘ end of the three Dnmt1 isoforms identified so far is shown together with their genomic localization and their tissue distribution. Since these three alternative exons are not expressed in single tissues and to avoid confusion by exons identified in the future, they were renamed according to the chronological order of their identification: 1a, exon 1 ; 1b, spermatocytes , spermatids and skeletal muscle exon (this work); 1c, oocyte exon .
To identify CpG islands in the 5‘ end of the Dnmt1 gene the CpG versus GpC sites (Fig. 3.10) are shown. The only CpG island identified between exon 1c and exon 3 is located around exon 1a, the start of the ubiquitously expressed isoform, and stretches till the start of tissue-specific exon 1b. In comparison, no CpG island could be identified around exon 3, which had previously been described as transcriptional start site of the ubiquitously expressed isoform . Since transcriptional start sites of housekeeping genes are typically associated with CpG islands, these results further support a transcriptional start of the ubiquitously expressed form with exon 1a.
45
Fig. 3.10. The mouse Dnmt1 gene contains at least three alternative exons at the 5‘ end. The diagram depicts the genomic structure of the 5‘ end of murine Dnmt1. Three alternative 5‘ exons have been identified: one is specific to the oocyte, one to the testis and skeletal muscle and one to somatic cells. The exons of Dnmt1 are represented to scale with respect to their size and relative position in the gene (GenBank accession number AF 175410-175412). The exons present in each isoform are indicated and are renamed following the chronological order of identification: 1a, exon 1 ; 1b, spermatocytes , spermatids and skeletal muscle exon (this work); 1c, oocyte exon . CpG and GpC incidence diagrams are plotted below to scale. The presence of a CpG island around exon 1a is a typical feature of housekeeping genes and fits well with the ubiquitous expression of this isoform.

Sequence analysis of the alternative Dnmt1 transcript expressed in skeletal muscle and in testis revealed several short ORFs (Fig. 3.11). The first ATG is in-frame these short upstream ORFs has been previously proposed to prevent translation of this isoform in spermatocytes . The expression of an untranslatable mRNA, however, could hardly play an active role in the regulation of DNA methylation. Also, the 5‘end of the Dnmt1 transcript found in oocytes contains several short upstream ORFs and yet is highly expressed in vivo (Fig. 3.6). Even the ubiquitously expressed form includes in the first exon (1a) three ATGs and only the third one is utilized in vivo .
To answer the question whether the skeletal muscle and testis Dnmt1 transcript could be translated in vivo, a set of mammalian expression constructs containing the entire exon 1b as well as 5‘ truncated forms that contain only some of the short upstream ORFs were generated. The different Dnmt1 pCR3.1 expression plasmids are designated 1a-9, 1b-9, 1b‘-9, 1b‘‘-9 and 3-9 (numbers correspond to exons present; see Fig. 3.10 for nomenclature of exons). To generate these constructs paired fragments of double stranded DNA, containing a common region that can be annealed after denaturation were used (see diagram on Fig.3.11A). Briefly, for each construct two paired PCR products of double stranded DNA were mixed with all the reagents necessary for a PCR reaction except the oligos. The oligo sequence and exon localization are indicated on the table below (oligo pairs are separated by horizontal lines). The oligo pairs were as follows: (584-582, 583-578) for 1a-9, (320-316, 579-578) for 1b-9, (579-581, 577-578) for 1b‘-9. The mixture was then allowed to denature, anneal and extend for one cycle on a PCR
46
machine (Biometra). After this initial cycle, oligos flanking the newly formed double stranded DNA were added to the reaction and the PCR was carried out for another 30 cycles. The reverse oligo used in the latter reaction was the same in all the cases (616-R) which contains the FLAG sequence (indicated in bold letters). For the constructs 1b‘‘-9 and 3-9, PCR reactions with oligos 577-578 and 325-616 respectively were carried out. The resulting PCR products were placed under the control of the CMV promoter by cloning into the pCR3.1 mammalian expression vector (Invitrogen).
|
Oligo Nr. |
Location |
Sequence |
|
584-F |
exon1a |
5´TAGCCAGGAGGTGTGGGTGCCTCCGTTGCGC 3´ |
|
582-R |
exon 3 |
5´CTGTTTGCAGGAATTCATGCAGTAAGTTTAATTTCTCC 3´ |
|
583-F |
exon 3 |
5´GCTCAAAGACTTGGAAAGAGATGGCTTAACAGAAAAG 3´ |
|
578-R |
exon 9 |
5´CTTCTTGTCATCGTCGTCCTTGTAGTCTCTGGTGTGA 3´ |
|
320-F |
exon1b |
5‘ ATGCGCGGGGCAGCGTTT 3‘ |
|
316-R |
exon1b |
5‘ TAAAATAATAGGGCGGGGGC 3‘ |
|
579-F |
exon1b |
5‘ GCCCGGCTGTCAAGTCCTAGGACCTTTTCTCTCTCAT 3‘ |
|
578-R |
exon 9 |
5´CTTCTTGTCATCGTCGTCCTTGTAGTCTCTGGTGTGA 3´ |
|
579-F |
exon1b |
5‘ GCCCGGCTGTCAAGTCCTAGGACCTTTTCTCTCTCAT 3‘ |
|
581-R |
exon1b |
5‘ TTCCCCTCTTCCGACTCTTCCTTGGGTTTCCGTTTAGT 3‘ |
|
577-F |
exon1b |
5‘ GCCCCCGCCCTATTATTTTAGCCCCTGTAAACCAGT 3‘ |
|
578-R |
exon 9 |
5´CTTCTTGTCATCGTCGTCCTTGTAGTCTCTGGTGTGA 3´ |
|
325-F |
exon 3 |
5‘GAATCCCTGCAAACAGAAATAAAAAGCCAGTTGTGTGAC 3‘ |
|
616-R |
FLAG |
5‘ CTTCTTGTCATCGTCGTCCTTGTAGTC 3‘ |
All these constructs include exons 1b to 9 followed by the FLAG epitope sequence that is in frame with the Dnmt1 ORF and transcription is controlled by the CMV promoter (Fig. 3.11B). In these constructs the expression of the FLAG epitope is only possible when translation initiation takes place at ATG4 in exon 4. As a positive control, a construct containing most of exon 1a of the ubiquitously expressed form was generated. Plasmid DNA was prepared from these constructs and used for transfection of COS-7 cells. Three days after transfection, expression of the FLAG tagged Dnmt1 protein was analyzed by immunofluorescence staining and Western blotting using an anti-FLAG mouse monoclonal antibody. All the constructs were able to generate tagged Dnmt1 truncated protein in COS-7 cells as indicated by the positive FLAG signal in the immunofluorescence images shown in Fig. 3.11D. The non-specific background fluorescence under the same conditions is shown in the image of the stained mock transfected COS-7 cells.
Protein extracts from transfection experiments with a construct containing exon 1b‘‘ and a control containing instead exon 1a were compared by Western blot analysis with antibodies against the FLAG epitope tag. Both constructs, 1a-9 and 1b‘‘-9, gave rise to single bands on the western blot (Fig. 3.11C lanes 1 and 2 respectively). ATG4 is the only possible translation initiation site in the exon 1b constructs that is in frame with the FLAG epitope. These results clearly show that transcripts starting with exon 1b are
47
translatable and that a truncated Dnmt1 protein isoform is made, which could play an active role in the change of DNA methylation patterns during gametogenesis and myogenesis.48
Fig. 3.11. The skeletal muscle Dnmt1 transcript is translatable. Different expression constructs were designed to test whether the skeletal muscle isoform could generate a truncated Dnmt1 protein. (A)The strategy followed to generate some of the Dnmt1 expression constructs is depicted. In the first PCR cycle all the reagents necessary for a PCR reaction but the flanking oligos were included. The first cycle allows the annealing and extension of the overlapping area between the two denaturated DNAs (DNA1 and DNA2). In the next cycles the oligos were added and amplification of the desired area occurs. (B) The different epitope tagged Dnmt1 expression constructs used to transfect COS-7 cells; 1a-9, 1b-9, 3-9, 1b‘-9 and 1b‘‘-9 (b‘ and b‘‘-9 correspond to nucleotides 651 to 1418, respectively from GenBank sequence accession number AF 175432). The exons included in each of the constructs are indicated (see Fig. 3.10 for exon nomenclature). The dotted lines in exon 1b, which is found in testis and skeletal muscle cDNA, represent the areas which were deleted in the specific construct. The small flags at the end of each construct represent the 8-amino acid FLAG coding sequence which was added to each of them. ORFs starting at ATG2 and ATG4 in exons 1a and 4 respectively of the ubiquitous Dnmt1 isoform cDNA and finishing in the FLAG tag are shown in thick lines and the short ORFs are shown in thin lines. The short vertical lines correspond to ATGs in the particular reading frame and the stars represent stop codons. The different expression plasmids were used for transient transfection of COS-7 cells. (C) The two types of Dnmt1 protein bands obtained are shown in the Western blot and were detected with the anti-FLAG M2 mouse monoclonal antibody, using the Dnmt1 constructs 1a-9 (lane1) and 1b‘‘-9 (lane2). (D) Expression of the FLAG tagged Dnmt1 protein (thick lines) was analyzed by immunofluorescence staining with the anti-Flag M2 mouse monoclonal antibody. The DNA counterstaining was performed with Hoechst 33258 and the corresponding phase contrast (PC) images are also shown. The mock transfection is depicted at the top using similar conditions.

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
|
DiML DTD Version 2.0 |
Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin |
HTML - Version erstellt am: Tue Sep 17 12:11:03 2002 |