2 Material und Methoden

↓20

2.1  Allgemeine Materialien

Chemikalien (soweit nicht anders angegeben):

Sigma, Roth, Merck

↓21

Lösungen:

PBS:

8,5 mM Na2HPO4, 1,5 mM KH2PO4, 137 mM NaCl, 3mM KCl

TBS:

10 mM Tris-Cl (pH 7,5), 150 mM NaCl

TTBS:

10 mM Tris-Cl (pH 7,6), 9 g/l NaCl, 0,1% Tween 20

TBE:

90 mM Tris, 90 mM Borsäure, 10 mM EDTA

TE:

10 mM Tris-Cl (pH 8,0), 1 mM EDTA ( pH 8,0)

Geräte:

↓22

Zentrifugen:

Tischzentrifuge

MicroMax IEC

Optima TLX Ultracentrifuge

Beckmann

CS15-R Centrifuge, CS-6R Centrifuge

Beckmann

RC- 313 Plus

Sorvall

Spektrophotometer

eppendorf BioPhotometer

Bakterien-Elektroporationstransformator

BioRad Gene Pulser

Spannungsgeräte

PowerPac 300- BioRad

Lumat LB9501

EG&G Berthold, Bad Wildbad

ELISA-Lesegerät

DYNATECH MR5000

PCR-Cycler

Eppendorf Master Cycler Gradient

MWG Biotec Omni Gene

LiCor dna sequencer model 4000

MWG Biotech

Geltrockner

Slab Gel Dryer SGD 4050 Savant

2.2 Bakterienkultur und Plasmidisolierung

Materialien:

↓23

LB-Medium

(Sambrock et al., 1989)

10 g/l Trypton-Pepton (mit Pankreaseenzymen verdautes Casein, DIFCO), 5 g/l Hefeextrakt (DIFCO), 10 g/l NaCl, 0,1 mg/ml Ampicillin

2YT-Medium

(Sambrock et al., 1989)

16g/l Trypton-Pepton, 10 g/l Hefeextrakt, 5g/ NaCl, 0,1 mg/ml Ampicillin

Lösung I

25 mM Tris-Cl (pH 8,0), 10 mM EDTA, 50 mM Glucose

Lösung II

0,2 M NaOH, 1% SDS

Lösung III

5M Kaliumacetat, 10% Essigsäure

Durchführung:

↓24

Alle Plasmide wurden in E.coli XL1-blue (Stratagene) propagiert. Durch Elektroporation (Dower et al, 1988) wurde dieser Bakterienstamm initial mit dem jeweiligen Plasmid transformiert. Dabei wurde ein Gene Pulser von der Firma Bio-Rad benutzt und den Anleitungen des Herstellers sowohl bei der Präparation elektrokompetenter Bakterien als auch bei der Elektrotransformation genau Folge geleistet. Um sie in Transfektionen einsetzen zu können, wurden alle Plasmide in größerem Maßstab präpariert und durch Zentrifugation in einem CsCl-Dichtegradienten gereinigt. Bei bereits im Labor vorhandenen Plasmiden erfolgte das Beimpfen der Stammkultur mit einer geringen Menge einer Glycerinkultur, während bei Plasmiden, die in eigener Arbeit im Rahmen der IE2-Mutagenese hergestellt wurden, hierfür der Rest einer Mini-Kultur verwendet wurde (siehe 4.). Diese Vorkultur wurde auf dem Warmluftschüttler bei 37°C und 140 Umdrehungen pro Minute (UpM) über Nacht kultiviert und am nächsten Tag 500 µl dieser Vorkultur zum Animpfen der 500 ml Hauptkultur (2YT-Medium) verwendet. Es folgte eine weitere Inkubation für 14 –18 h bei 37° C. Danach wurden die Bakterien abzentrifugiert, in 30 ml der Lösung I resuspendiert und durch Vermischen mit 60 ml der Lösung II lysiert. Durch nachfolgendes Vermischen mit 30 ml der eiskalten Lösung III wurde der Grossteil der bakteriellen Proteine und genomischen DNA ausgefällt und durch Zentrifugation abgetrennt. Die im Überstand verbliebenen Nukleinsäuren wurden durch Zugabe von 0,6 Volumenanteilen Isopropanol gefällt und nach 30 minütiger Inkubation bei Raumtemperatur für 10 min bei 10000 g und 4°C zentrifugiert. Das entstandene Pellet wurde in 8 ml TE gelöst und dieser Lösung zunächst 8,3 g CsCl und anschließend 0,8 ml einer Ethidiumbromidlösung (10 mg/ml) zugesetzt. Durch 5-minütige Zentrifugation bei 3000 g wurden noch einmal unlösliche Bestandteile entfernt und die Lösung dann für mindestens 14 h in einem TLA 100.4-Rotor (Beckmann) bei 234.000 g zentrifugiert. Danach wurde die intakte Plasmid-DNA enthaltende Bande aus dem entstandenen CsCl-Gradienten mittels einer Einmalspritze abgezogen und daraus das Ethidiumbromid durch 4 bis 6-maliges Ausschütteln mit TE-gesättigtem Butanol extrahiert. CsCl- und Butanolrückstände wurden durch zweimalige ethanolische Fällung (0,3 M Natriumazetat/75% Ethanol) entfernt und das DNA Pellet abschließend noch zweimal mit 75% Ethanol gewaschen. Die DNA wurde schließlich in TE gelöst. Die DNA-Konzentration der Plasmidlösung wurde durch Messung ihrer Absorption bei UV-Licht der Wellenlänge 260 nm bestimmt. Die Lagerung der Plasmide erfolgte bei –20°C.

Folgende im Labor bereits vorhande Plasmide wurden in dieser Arbeit verwendet:

1. pSG5-3HA

pSG5-Vektor mit einem Triple-HA-Epitop als Insertion

2. pSG5-CD20

pSG5-Vektor mit CD20-cDNA (Mensch) als Insertion

3. pSG5-3HA-IE2

pSG5-Vektor mit kompletter IE2 cDNA und Tripel-HA-Epitop

4. pSG5-3HA-IE2 (1-544)

pSG5-Vektor mit einer verkürzten Form der IE2 cDNA sowie Tripel- HA- Epitop

5. pSG5-3HA-IE2 (1-450)

pSG5-Vektor mit einer verkürzten Form der IE2 cDNA sowie Tripel HA- Epitop

6. pSG5-3HA-IE2 (195-580)

pSG5-Vektor mit einer verkürzten Form der IE2 cDNA sowie Tripel HA- Epitop

↓25

Die Plasmide Nr. 1-6 sind in vorangegangenen Arbeiten im Labor von Prof. Dr. Hagemeier hergestellt worden (Wiebusch und Hagemeier, 1999).

7. pHM142

UL112/113 Promotorkonstrukt, das die Nukleotide –352 bis +37 des UL112/113 Promotors vor einem Luciferase Reportergen enthält; freundlicherweise zur Verfügung gestellt von T. Stamminger, Institut für Virologie, Erlangen

8. pfosCAT

c-fos Promotor-Reporterkonstrukt, das den murinen c-fos Promotor vor dem Gen für die Chloramphenicolacetyltransferase (CAT) enthält (Hagemeier et al., 1992)

9. pRR55

MIE Enhancer/Promotor-Konstrukt, das die HCMV AD169 IE1/IE2 Promotor/Enhancer Region zwischen den Nukleotiden –671 und +52 relativ zum Transkriptionsstart upstream eines CAT Reportergens enthält; freundlicherweise zur Verfügung gestellt von S. Prösch, Institut für Virologie, Charité

10. pRR55mut

wie Nr. 9, jedoch wurde die crs mutiert, so dass dieses Konstrukt von IE2 nicht autoreprimiert werden kann, da die Bindung von IE2 an die crs verhindert wird; freundlicherweise zur Verfügung gestellt von S. Prösch, Institut für Virologie, Charité

11. pIE1cat

MIE Enhancer/Promotorkonstrukt, das die Nukleotide –302 bis +72 des HCMV MIE Promotors vor einem CAT-Reportergen enthält (Shelbourn et al., 1989); freundlicherweise zur Verfügung gestellt von S. Prösch, Institut für Virologie, Charité

12. pGFP-IE86

IE2-Expressionsplasmid, das die cDNA des IE2 aus dem HCMV-Town-Stamm hinter dem MIE Promotor (mit mutierter crs) enthält.

Zusätzlich wird GFP über einen SV40-Promotor exprimiert (Murphy et al., 2000); freundlicherweise zur Verfügung gestellt von M. Stinski, University of Iowa, USA

13. pGFP-IE86HL

IE2-Expressionsplasmid, das die cDNA IE2 aus dem HCMV-Town-Stamm hinter dem MIE Promotor (mit mutierter crs) enthält. Der postulierte Zinkfinger des IE2 ist durch Substitution der Histidine (Pos. 447 und 453) durch Leucine zerstört worden.

Zusätzlich wird GFP über einen SV40-Promotor exprimiert (Murphy et al., 2000); freundlicherweise zur Verfügung gestellt von M. Stinski, University of Iowa, USA

2.3 Klonierung der IE2-Mutanten

Im Rahmen der Mutationsanalyse wurden verschiedene IE2-Mutanten mittels gerichteter Mutagenese hergestellt, wobei verschiedene Mutagenese-Methoden zum Einsatz kamen.

↓26

Für C-terminale Deletionsmutanten wurde die IE2-Sequenz mittels PCR aus dem Konstrukt pSG5-3HA-IE2, das die Wildtyp Sequenz des IE2 Proteins enthält, amplifiziert und über die verwendeten PCR-Oligonukleotide C-terminal an der gewünschten Stelle ein Stopcodon eingefügt.

Materialien:

Qiaquick PCR Purification Kit

Qiagen GmbH, Hilden

Qiaquick PCR Gel Extraction Kit

Qiagen GmbH, Hilden

↓27

Folgende PCR-Oligonukleotide wurden verwendet:

CH 49 IE1/IE2sense: 5’- TATGGATCCATGGAGTCCTCTGCCAAGAG-3’

BamH1-Schnittstelle, IE2-cDNA (codierender Strang ab Codon 1)

↓28

IE2-as513StopBglII: 5’-CGTAAGATCTAGACTACAGGGGCAGGCACAGGTTG-3’

BglII-Schnittstelle, IE2-cDNA (Gegenstrang ab Stop-Codon, Pos.513)

IE2-as497StopBglII: 5’-CGTAAGATCTAAGCGTGGATGATCATGTTG-3’

↓29

BglII-Schnittstelle, IE2-cDNA (Gegenstrang ab Stop-Codon, Pos.497)

IE2-as482StopBglII: 5’-CGTAAGATCTAGACTATTGGTGGGTGTGCAATT-3’

BglII-Schnittstelle, IE2-cDNA (Gegenstrang ab Stop-Codon, Pos.482)

↓30

Durchführung:

Die Starter-Oligonukleotide wurden von der Firma Metabion in lyophilisierten Zustand bezogen, in H2O gelöst (Konzentration 0,1nM) und bei –20°C gelagert. Die Durchführung der PCR erfolgte gemäß beschriebenem Protokoll (Sambrock et al., 1989). Nach Beendigung der PCR wurden die PCR-Produkte mithilfe des Quiaquick PCR Purification Kit nach den Angaben des Herstellers (Qiagen) gereinigt und mit den Restriktionsenzymen BamH1 und BglII geschnitten, indem Hälfte des aufgereinigten PCR-Produnkts mit jeweils 1U der beiden Enzyme für 2 h bei 37°C inkubiert wurden. Nach Beendigung des Restriktionsverdaus wurden die Amplifikate durch eine präparative Agarose-Gelelektophorese gereinigt und mit dem Qiaquick Gel Extraktion Kit eluiert.

Das so präparierte DNA-Fragment konnte nun mit dem Zielvektor ligiert werden. Der Zielvektor, in diesem Falle pSG5-3HA war für diesen Zweck wie folgt vorbereitet worden: 1 μg der Vektor-DNA wurden mit 3-4 U des Restriktionsenzyms BglII durch zweistündige Inkubation bei 37°C im OPA-Reaktionspuffer von Pharmacia (20 µl Reaktionsvolumen) geschnitten. Danach wurde das Enzym durch Inkubation bei 85°C für 10 min inaktiviert und die Vektor-DNA dephosphoryliert, um ein Religieren des Vektors zu verhindern. Dazu wurde 1 U Alkalische Phosphatase (alkaline Phosphatase, Roche) in 30 µl 1x Deposphorylierungspuffer dem Restriktionsansatz zugefügt und für 45 min bei 37°C inkubiert. Anschließend erfolgte eine weitere Inkubation für15 min bei 65°C. Ein weiteres Mal wurde 1 U der Alkalischen Phosphatase zugefügt und dieselbe Inkubationsabfolge durchlaufen. Dem Reaktionsansatz wurde danach DNA-Probenpuffer zugesetzt und der dephosphorylierte Vektor mittels präparativer Gelelektrophorese aufgereinigt. Zur Elution der Vektor-DNA wurde ebenfalls der Qiaquick Gel Extraction Kit verwendet und das Protokoll gemäß den Herstellerangaben durchgeführt.

2.4 Ligation, Transformation und DNA-Minipräparation

↓31

Für die Ligation wurden je 4 μl des dephosphorylierten Zielvektors mit 4 μl des aufgereinigten PCR Produkts in einem Reaktionsvolumen von 10 µl mit 10 U T4-Ligase über Nacht bei 16°C inkubiert. Ein Mikroliter des Ligationsansatzes wurde anschließend für die Transformation von E.coli XL-1 Blue verwendet und ein Aliquot des Transformationsansatzes auf LB-Agarplatten ausgestrichen. Nach Übernacht-Inkubation bei 37 °C wurden die entstandenen Einzelkolonien zum Animpfen einer 2 ml-Schüttelkultur verwendet, die über Nacht bei 37°C und 200 UpM inkubiert wurde. Aus einem Teil dieser Minikultur wurde die Plasmid-DNA nach Methode der alkalischen Lyse aus den Bakterien präpariert, der Rest bei 4°C für eine spätere Verwendung gelagert. Die Bakterienlösung wurde in 1,5 ml Reaktionsgefäße überführt und für 1 min in einer Tischzentrifuge zentrifugiert. Das Pellet wurde anschließend in 100 μl der Lösung I (siehe 2.) suspendiert und die Zellen durch Zugabe von 200 μl Lösung II bei 0 °C lysiert. Die Lyse wurde durch Zugabe von 150 μl Lösung III abgestoppt und die dadurch ausgefällten Proteine und genomische DNA durch Zentrifugation abgetrennt. Vierhundert Mikroliter des Überstandes wurden mit 0,8 ml absolutem Ethanol versetzt und nach ca. 2-minütiger Inkubation bei Raumptemperatur wiederum für 3 min bei maximaler Geschwindigkeit in einer Tischzentrifuge zentrifugiert. Das DNA-Pellet wurden noch einmal mit 70% Ethanol gewaschen und das getrocknete DNA Pellet anschliessend in 50 µl TE Puffer resuspendiert. Die DNA wurde in einem analytischen Restriktionsverdau mit anschließender Geleletrophorese auf die gewünschte Mutation hin untersucht. Bei positiven Klone wurde der Rest der Minikultur zum Animpfen einer Maxikultur verwendet (siehe 2.).

2.5 Gerichtete in vitro Mutagenese nach der Kunkel-Methode

Die internen Deletions- und Aminosäureaustauschmutanten des IE2 Proteins wurden mittels gerichteter in vitro Mutagenese nach der Kunkel-Methode hergestellt.

Bei dieser Methode wird das zu mutierende Plasmid, in diesem Falle pSG5-3HA-IE2, vor der Mutagenese in einem E.coli Stamm (RZ1032) propagiert, der eine Mutation in der dUTPase- (dut-) und der Uracil-Glykosilase- (ung-) Aktivität trägt. Die dut- Mutation führt zu einem erhöhten dUTP-Spiegel in der Zelle, was zur Folge hat, dass während der DNA Replikation ein gewisser Prozentsatz Uracil anstelle von Thymidin eingebaut wird. Diese Uracil Reste würden normalerweise von der Uracil-Glykosilase entfernt werden, in den ung- Zellen bleiben sie jedoch erhalten. Als Folge davon produzieren dut- ung- E.coli Vektor-DNA, die einen Anteil Uracil-Reste enthält. Da die verwendeten Plasmide einen Replikationsorigin für filamentöse Phagen enthalten, führt die Infektion der E.coli-Zellen mit einem Helferphagen zur Produktion einzelstängiger Plasmid-DNA, die anschließend in einer in vitro Mutagenese Reaktion verwendet werden kann. Das Ergebnis einer solchen Mutagenesereaktion ist ein DNA-Hybrid, in dem der nicht-mutierte Strang Uracil-Reste enthält, der mutierte jedoch nicht. Wird ein Aliquot der Mutagenesereaktion in einen ung+ E.coli Stamm transformiert, so wird der Uracil- enthaltende nicht-mutierte Strang durch die Uracil-Glycosilase abgebaut, so dass zugunsten des mutierten Stranges selektiert wird.

↓32

Materialien:

LB/ Amp-Platten

PEG/Ammoniumacetat

3,5 M Ammoniumazetat, 20% (w/v) Polyethylenglykol 800 (PEG)

Annealing Puffer

500 mM NaCl, 100 mM Tris-pH 8,0, 100 mM MgCl2 * 6 H2O, 50 mM DTT; steril filtriert, Lagerung bei –20°C

Ligasepuffer

Boehringer Mannheim GmbH

Phenol

Roth

Chloroform/Isoamylalkohol

Roth

R408-Phagenstammlösung

Stratagene

Durchführung:

↓33

1. Herstellung einer Helferphagen-Stammlösung

Aus einer Übernachtkultur eines F’-E.coli-Stammes (XL1-blue) werden 100 µl in 10 ml frisches LB-Medium in einem 50 ml Glaskolben gegeben und bei 37°C und 225 rpm so lange inkubiert, bis die OD600 ca. 0,2 erreicht (midlog-Phase). Diese Kultur wird dann mit 1 µl der Phagen-Stammlösung angeimpft und weitere 6 h bei 37°C und 225 rpm inkubiert. Danach werden die Zellen bei 5000 g für 10 min zentrifugiert, der Überstand durch einen 0,45 mm Filter mit einer sterilen 10 ml Spritze filtriert und in sterilen Falcon-Röhrchen gesammelt. Diese Falcon-Röhrchen wurden anschließend für 10 min bei 60°C inkubiert, um eventuell noch lebende Bakterien abzutöten. Danach wurde die Lösung aliquotiert und bei 4°C gelagert.

2. Herstellung einzelsträngiger Phagemid-DNA

↓34

Der Ausgangsvektor mit der intakten IE2 cDNA (pSG5-IE2-3HA) wurde wie beschrieben in E.coli RZ1032 Zellen transformiert und ein Aliquot der Reaktion auf LB-Amp Platten ausplattiert. Hiervon wurden je 2 Kolonien zum Animpfen von 5 ml LB-Medium verwendet, welches dann bei 37°C und 225 rpm so lange inkubiert, bis die OD600 ca. 0,2 erreicht hatte. Die Kultur wurde dann mit 10 µl Phagenstammlösung R408 infiziert und weitere 5-6 h bei 37°C und 250 –265 rpm inkubiert. Danach wurde die Kultur in drei 1,5 ml Reaktionsgefäße überführt und 5 min bei 11000 g in einer Tischzentrifuge zentrifugiert. Währenddessen wurden je 250 ml 20%-PEG in 3,5 M Ammoniumazetat in drei neue 1,5 ml Reaktionsgefäße vorgelegt. Nach der Zentrifugation wurde je 1 ml Überstand zu der PEG-Lösung gegeben, die Lösung durch Schütteln gemischt und über Nacht bei 4°C inkubiert, um die Phagen DNA auszufällen. Anschließend erfolgte eine Zentrifugation für 15 min bei 16000 g und 4°C. Der Überstand wurde abgenommen und die Proben ein weiteres Mal für 2 min wie beschrieben zentrifugiert, um noch vorhandenen Überstand entfernen zu können. Die Pellets wurden in jeweils 100 µl TE resuspendiert und die Inhalte der drei Reaktionsgefäße vereinigt. Nun wurden 150 ml Phenol zu dem Ansatz gegeben, auf dem Vortex gemischt und anschließend bei 13200 rpm für 1 min zentrifugiert. Die obere Phase wurde in ein neues Reaktionsgefäß gegeben und mit einem Volumen Chloroform-Isoamyl-Alkohol (24:1) gemischt, gefolgt von einer weiteren Zentrifugation. Die obere Phase wurde wiederum in ein neues Gefäß überführt und durch Zugabe von 0,1 Volumen 3 M Na-Azetat und 2 Volumen eiskaltem Ethanol die DNA für 30 min bei –20 °C gefällt. Die Lösung wurde anschließend für 10 min bei 4°C zentrifugiert, der Überstand entfernt, und das Pellet mit 70 %igem Ethanol gewaschen, erneut wie oben zentrifugiert und der Überstand mit einer Pasteurpipette aspiriert. Das trockene Pellet wurde in 40 µl TE resuspendiert und bei –20°C gelagert. Ein Aliquot der präparierten DNA wurde auf einem 1% igem Agarosegel analysiert, um die Präparation zu überprüfen und die DNA-Konzentration abzuschätzen.

3. Phosphorylierung der Mutageneseprimer

Zur Phosphorylierung der Mutageneseprimer wurden ca. 150 pmol Primer in 1x Ligasepuffer mit 2 µl T4 Polynukleotidkinase (16 U, Boehringer Mannheim) für 30 min bei 37°C inkubiert. Anschließend wurde die Kinase durch 10-minütige Inkubation bei 65°C inativiert und der phosphorylierte Primer bei –20°C gelagert.

↓35

Über die verwendeten Oligonukleotide gibt die nachfolgende Tabelle Auskunft.

Tabelle 1: Oligonukleotide für die Mutagenesereaktionen

Name

Sequenz von 5’ nach 3’

pm501-508

CACGCTGCCACCCCCGCGGCCGCGGCCGCGGCTGCCAACCTGTGCCTGCCC

pm510-517

GGCGCTCTCAACCTGGCCGCGGCGGCCGCGGCAGCGTTTCCCAAACAGGTC

pm519-526

GATGCAAAAGTTTCCCGCAGCGGCGGCCGCGGCCGCCTTCTCCACCAACCAG

pm528-535

GTGCGCATCTTCTCCGCCGCCGCGGCCGCGGCCGCGCTGCCTATCTACGAG

pm537-544

GGGTTCATGCTGCCTGCCGCCGCGGCCGCGGCGGCGGCCTACGCCGTGGGG

del 230-249

CCTTCCACCGGCAGCGGCACGCCCTTGGGCCGGCCCGATG

del 260-279

GGCCCGATGAAGATAGTTCCAAATGCAGCAGTGGCGGAGG

del 290-309

GTGGCGGAGGAGCATCCGTGTGCGGCCATCAGAGCAGCGG

del 330-349

CGCAAGAAGAAGAGCAAACGCTGCACACCCAACGTGCAGAC

del 380-399

CCAATCGCTCTCTTGAGTACTGCAAAACCATGCAGGTGAAC

del 430-449

GAGGTGGATGCGGTGCGGTGTCCCGTGACACATCCACCCGAAG

del 470-489

CGATGCTTGTAACGAAGGCGTCTACCGCAACATGATCATCCAC

4. In vitro Mutagenese

↓36

Fünf Mikroliter einzelsträngige Plasmid-DNA-Präparation (ca. 1 µg einzelsträngige Plasmid-DNA) wurden mit 2 µl des Primer-Phosphorylierungsansatzes und 1 µl Annealingpuffer in 10 µl Gesamtvolumen 5 min bei 65°C in einem Wasserbad inkubiert und zur Abkühlung ca. 30 min bei Raumtemperatur stehen gelassen. Diesem Annealingansatz wurden dann 2 U T4-DNA-Ligase, 2,5 U T4 DNA Polymerase, Ligase Puffer, dNTPs (0,5 mM) sowie ATP (0,5 mM) hinzugefügt und das Gemisch für 10 min bei Raumtemperatur und anschließend für 2 h bei 37°C inkubiert.

5. Selektion gegen den nicht mutierten Strang

Zur Selektion wurde 1 µl des Mutageneseansatzes in kompetente E.coli XL1-blue transformiert. Da dieser Stamm ung+ ist, wird der uracilhaltige nichtmutierte Strang spezifisch abgebaut, so dass in der Regel 1/3 bis 2/3 der resultierenden Kolonien ein Plasmid mit der Mutation enthalten. Dementsprechend wurden von 3-5 Kolonien Minikulturen (2 ml-Kulturen) angesetzt und eine Mini-DNA-Präparation durchgeführt. Die DNA wurde dann mittels Restriktionsanalyse und DNA-Sequenzierung auf das Vorhandensein der Mutation sowie auf korrekte IE2-Sequenz hin überprüft.

2.6 DNA-Sequenzierung

↓37

Materialien:

Sequenzierkit

Thermo Sequenase Labelled Primer Cycle Sequencing Kit with 7-deaza-dGTP- Amersham Biosciences RNP2438

Oligonukleotide:

Alle für die Sequenzierung verwendeten Oligonukleotide enthalten eine wurden von der Firma MWG bezogen und trugen eine Fluoreszenzmarkierung (IRD800) am 5’-Ende.

T7-Oligonukleotid

5’- AATACGACTCACTATAG-3’

SG5-antisense

5’- ACCACAACTAGAATGCAG-3’

IE2 sense pos.808

5’- TCGGACTCGGAGAGTGAG-3’

IE2 antisense pos.943

5’- TGCTCTGATGGCCGCAGC-3’

Durchführung:

↓38

Alle neu klonierten Plasmide wurden unter Verwendung des Thermo Sequenase-Sequenzierkits von Amersham sequenziert. Hierfür wurden 3 µg template DNA mit 2 µl des IRD-markierten Oligonukleotids (ungefähr 1 pmol) in einem Gesamtvolumen von 20 µl gemischt und jeweils 5µl in einer PCR-Reaktion mit jeweils 2µl der A-, C-, G-, oder T-Reagenz eingesetzt. Nach der PCR wurden jeweils 1,2 µl der Reaktion auf ein Sequenziergel aufgetragen. Die Datensammlung und –analyse erfolgte mit dem Li-Cor dna sequencer model 4000 (MWG Biotech) sowie dem Programm Base ImagIR Program v.4.1 (Li-COR). Die Auswertung und der Vergleich der Sequenzen wurde mittels des Programms Dnasis durchgeführt.

2.7 Zellkultur

Materialien:

DMEM

Gibco-BRL, Katalog-Nr. 61965-026

Fötales Kälberserum (FKS)

Biochrom, Berlin

Neugeborenen Kälberserum (NKS)

Biochrom, Berlin

Penicillin/Streptomycin

Biochrom, Berlin

Trypsin

Gibco-BRL, Katalog-Nr.

Plastikmaterialien

Greiner bio-one, Falcon, TPP-Switzerland

↓39

Folgende adhärente Zelllinien wurden verwendet:

U373-MG

humane Astrozytomzelllinie, bezogen von Cell Line Services, Heidelberg

HeLa

humane Adenokarzinomzelllinie, bezogen von AG T.Kloetzel

Durchführung:

↓40

Alle Arbeiten mit Zellen wurden unter sterilen Bedingungen duchgeführt. Die Zellen wurden als adhärent wachsende Monolayer in DMEM, dem 100 U/ml Penicillin/Steptomycin und jeweils 5% FKS und NKS zugesetzt worden war, bei 5% CO2, 37°C und 95% Luftfeuchtigkeit kultiviert. Zur Passage der Zellen wurde alle drei Tage das Zellmedium entfernt, die Zellen mit sterilem PBS gewaschen und dann in einer Trypsin/EDTA-Lösumg ca. 3 min bei 37°C inkubiert, bis sie sich vom Plastikuntergrund abgelöst hatten. Die Trypsinierung wurde durch Zugabe von frischem Medium abgestoppt und die Zellen in einem Verhältnis von 1:3 im Falle der U373-Zellen, bzw. 1:10 bei den HeLa Zellen in frischem Medium verdünnt und auf neue Schalen ausplattiert.

2.8 Transfektionen

Materialien:

Plasmid DNA

↓41

CaCl2

2,5 M, steril filtriert

2x BBS

50 mM BES, 280 nM NaCl, 1,5 mM Na2HPO4, pH 6,95

Durchführung:

Plasmid-DNA wurde nach der von Chen und Okayama modifizierten Calciumphosphat-Kopräzipitationsmethode (Chen C. , 1987) in die Zellen transfiziert.

↓42

Die Mengenangaben des folgenden Protokolls beziehen sich auf einen Milliliter Medium in den zu transfizierenden Zellkulturschalen.

Insgesamt 2 µg Plasmid-DNA (das jeweilige Verhältnis von Effektor- und Marker- bzw. Reporterplasmid ist in Tab. 2 angegeben) wurde in einem Volumen von 56,25 ml TE-Puffer (0,1x) gemischt. Dieser Lösung wurde nacheinander 6,25 ml der CaCl2-Lösung und 62,5 ml 2xBBS zugegeben. Zehn bis zwanzig Minuten später wurde die inzwischen trübe Lösung dem Kulturmedium der Zellen hinzugefügt, die ca. 24 h zuvor passagiert (siehe 7.) worden waren. Die Zellen wurden in diesem Transfektionsmedium 14-16 h bei 3% CO2 inkubiert, bevor dieses wieder entfernt und zurückgebliebenes Präzipitat mit TBS weggewaschen wurde. Bis zur Ernte (siehe 9.) weitere 32 h später, wurden die Zellen in frischem Kulturmedium gehalten.

Tabelle 2: Mengenverhältnis von Effektor zu Reporterplasmid im Transfektionsansatz

Art des Assays

Schale (Ø)

Mediumvol.

Effektorplasmid

CD20-bzw. Reporterpl.

Zellzyklus

9 cm

10 ml

16 µg

4 µg

Transaktivierung

6 cm

4 ml

4,6 µg

1,6 µg

Autorepression

6 cm

4 ml

6 µg

2 µg

2.9 Zellernte für die Durchflußzytometrie

↓43

Für die Bestimmung der Zellzyklusverteilung wurden die Zellen in 9 cm Schalen mit je 16 µg IE2 Effektorplasmid und 4 µg CD20 transfiziert. Nach 48 h erfolgte die Ernte der Zellen für die weitere Verwendung in der Durchflußzytometrie. Hierfür wurde der Kulturüberstand in ein 15 ml Falcon-Röhrchen überführt, Medienreste durch einmaliges Waschen mit PBS entfernt und die Zellen dann in einer Trypsin/EDTA -Lösung solange bei 37°C inkubiert, bis sie sich vom Plastikuntergrund ablösten. Mithilfe einer Pasteurpipette wurden die Zellen suspendiert und dann in dem vorgelegten Kulturüberstand aufgenommen. Nach einer fünfminütigen Zentifugation bei 200 g wurden die Zellen in PBS resuspendiert und erneut für 5 min bei 200 g pelletiert. Nach diesem Waschschritt wurde das Zellmaterial für die weitere Markierung verwendet und 1/10 des Zellmaterials für eine Zellextraktion abgenommen. Um die CD20 Expression der transient transfizierten Zellen zu messen und somit eine Auskunft über die relative Transfektionsstärke einzelner Zellen zu bekommen, wurden die Zellen mit einem FITC-gekoppelten CD20-spezifischen Antikörper (Klon 2H7, Pharmingen) gefärbt. Hierzu wurden die geernteten Zellen in 50 ml Kulturmedium resuspendiert, welches 0,125 µg des Antikörpers enthielt. In dieser Lösung wurden die Zellen für 30 min bei 0°C inkubiert und dann durch Zugabe von 10 ml PBS/1% FKS und nachfolgende Zentrifugation (5 min bei 200 g) gewaschen. Um parallel zu der FITC-Fluoreszenz den DNA-Gehalt der transfizierten Zellen im Durchflußzytometer bestimmen zu können, mussten die Zellen permeabilisiert und mit Propidioumjodid gefärbt werden. Dazu wurden die Zellen nach der Antikörperfärbung in 1 ml PBS suspendiert und unter ständigem Aufwirbeln mit 3 ml absolutem Ethanol versetzt, welches auf -20°C temperiert war. Dann wurden sie für mindestens 14 h bei 0°C gelagert und anschließend 3 min bei 400 g zentrifugiert. Nach Resuspension in 1 ml PBS und nochmaliger Zentrifugation bei 200 g wurde das Zellpellet je nach Größe in 250 – 500 ml Färbelösung (PBS, 50 µg/ml Propidiumjodid, 100 U/ml Rnase A) aufgenommen und darin für 30 min bei Raumtemperatur inkubiert.

Anschließend erfolgte die durchflußzytometrische Analyse der Zellen mit einem FACScan-Gerät und dem Computerprogramm CellQuest (beides Beckton Dickinson). Zur Überprüfung erfolgte eine zusätzliche Auswertung mit dem Programm Modfit. Gemessen wurde jeweils die FITC-Fluoreszenz als auch das Propidiumiodid-Fluoreszenzsignal, das den DNA-Gehalt angibt. Die Kompensation der bei dieser Zweifarbenanalyse benutzten Fluoreszenzkanäle des Zytometers wurde wie beschrieben durchgeführt (Coligan, 1991). Zusätzlich wurden mittels des Dubletten-diskriminierungsmoduls des Zytometers anhand des Propidiumiodid-Fluoreszenzsignals die aneinanderhaftenden Zellen ausgegrenzt. Wie in der Literatur beschrieben (van den Heuvel und Harlow, 1993) wurden diejenigen der transfizierten Zellen für die DNA-Analyse verwendet, die ein mindestens 20-fach stärkeres FITC-Signal aufwiesen als die untransfizierte Subpopulation.

2.10 Zellextraktion zur Immunoblot-Analyse

Nach der Ernte (siehe 9.) wurde ein Aliquot der Zellen in 1x RIPA Puffer (150 mM NaCl, 1% NP-40, 0,5 % Na-deoxycholat, 0,1% SDS, 50 mM Tris pH 8,0 t) suspendiert und für 30 min bei 0°C lysiert. Anschließend wurden die Lysate 20 min bei 20000 g und 4°C zentrifugiert. Die resultierenden Überstände wurden bei –80°C gelagert. Die Proteinkonzentration der Extrakte wurde mithilfe des DC Protein Assay der Firma Bio-Rad bestimmt, welcher auf der Lowry-Methode (Waterborg und Matthews, 1994) beruht. Dazu wurden 2 ml des Extraktes mit 198 ml H2O verdünnt, 0,1 ml der kurz zuvor im Verhältnis 2:100 gemischten Reagentien „S“ und „A“ hinzugefügt, und dann mit 0,8 ml Reagenz „B“ gemischt. 10 min später wurde die Lichtabsorption der entstandenen Lösung bei 750 nm im Photometer gemessen. Als Nullkontrolle diente 1x Ripa-Puffer, als Proteinstandard eine BSA-Verdünnungsreihe.

2.11 SDS-Polyacrylamidgelelektrophorese

↓44

Materialien:

DNA-Probenpuffer

MBI Fermentas Loading Buffer Pack

Polyacrylamid

Rotiphorese® Gel 30 (37,5:1) – Roth

Laufpuffer

125 mM Tris, 1,25 M Glycin, 0,5% SDS

Durchführung:

↓45

Der Nachweis der Expression der transfizierten Proteine erfolgte mithilfe der Verfahren der SDS-Polyacrylamidgelelektrophorese (SDS-PAGE) nach Laemmli und anschließender Immunoblot-Analyse.

Die Proteinproben wurden im Verhältnis 1:4 mit dem DNA-Probenpuffer gemischt, 3 min aufgekocht und anschließend elektrophoretisch aufgetrennt. Dazu wurde das Mini Protean II-System der Firma Bio-Rad benutzt, wobei das untere Trenngel 8% Polyacrylamid enthielt, sowie 375 mM Tris (pH 8.8) und 0,1% SDS, und das obere Sammelgel 5% Polyacrylamid, 125 mM Tris (pH 6,6) und 0,1% SDS. Die Polymerisierung wurde durch Zugabe von 0,1% APS und 0,1% TEMED eingeleitet. Die Elektrophorese erfolgte bei einer konstanten Spannung von 200 V so lange, bis die Lauffront das untere Ende des Gels erreicht hatte.

2.12 Immunoblot-Analysen

Materialien:

↓46

Membran

PVDF Western Blotting Membranes, Roche Diagnostics GmbH, Mannheim

Transferpuffer

20% Methanol, 25 mM Tris, 190 mM Glycin

Milchpulver

SUCOFIN®

Primärantikörper:

α-HA-Antikörper

monoklonaler Antikörper gegen das HA-Epitop

Klon 16B12 (Maus, IgG1; 1 mg/ml); Covance

α-IE2-pHM178

polyklonales Antiserum gegen das IE2-Protein (Exon 5), freundlicherweise zur Verfügung gestellt von T. Stamminger, Institut für Virologie, Erlangen

Sekundärantikörper:

α-Maus Antikörper

polyklonaler Antikörper (Ziege), Sigma

α-Kaninchen Antikörper

polyklonaler Antikörper (Ziege), Dianova

Die Antikörper waren jeweils in TTBS/6% Trockenmilch gelöst. Diese Lösung wurde durch Zugabe von 0,1% NaN3 haltbar gemacht, bei 4°C gelagert und mehrfach verwendet.

Detektionskit

Western Lightning PerkinElmer Life Sciences

↓47

Durchführung:

Nach Beendigung der Elektrophorese wurden die Proteine auf eine PVDF-Membran im Tankblotverfahren transferiert. Dazu wurde eine Mini Trans-Blot Transfer Cell der Firma Bio-Rad benutzt, der Transfer erfolgte für eine Stunde bei 80 V und konnte anhand des vorgefärbten Proteinstandards kontrolliert werden. Nach erfolgtem Transfer wurde die Membran in TTBS mit 60 mg/ml gelöstem Trockenmilchpulver für 30 min bei Raumtemperatur oder bei 4°C über Nacht inkubiert, um auf diese Weise unspezifische Proteinbindungsstellen zu blockieren. Die Membranen wurden dann mit dem gegen das zu untersuchende Protein gerichtete Primärantikörper inkubiert, wobei hier in der Regel ein gegen das HA-Epitop gerichteter Antikörper verwendet wurde. Im Falle der Zellextrakte aus der Virusinfektion kam ein IE2-spezifisches Antiserum zum Einsatz. Die Inkubation erfolgte bei Raumtemperatur für eine Stunde, danach wurde die Membran viermal für jeweils 10 min in TTBS gewaschen. Anschließend wurde die Inkubation mit dem Sekundärantikörper auf gleiche Weise wie beim Primärantikörper durchgeführt. Nach wiederum viermaligem Waschen der Membran mit TTBS erfolgte die Detektion der antikörperbindenden Proteinbanden durch Chemilumineszenz-nachweis der gleichfalls gebundenen Peroxidaeaktivität mittel des Western Lighting Kit von PerkinElmer Life Sciences. Durch kurze Exposition eines Röntgenfilms (Kodak X-Omat) wurde das Ergebnis festgehalten.

2.13 Proteinbestimmung nach Bradford

Materialien:

↓48

Bradford Reagenz

BioRad

BSA

Roth

Durchführung:

Soweit nicht anders angegeben erfolgte die Proteinbestimmung mittels des Bradford Reagenz der Firma Bio-Rad. Hierfür wurden 0,2 ml Bradford Reagenz mit 0,8 ml H2O gemischt und dem ganzen je 1 μl des Extraktes hinzugegeben. Die Lichtabsorption der entstandenen Lösung bei 595 nm im Photometer gemessen. Als Nullkontrolle diente der jeweilige Lysepuffer bzw. TGA, als Proteinstandard eine BSA-Verdünnungsreihe.

2.14 CAT-Elisa

↓49

Materialien:

CAT-ELISA Kit

Roche

Durchführung:

↓50

Die Bestimmung der CAT Aktivität in den transfizierten Zellen erfolgte mithilfe des CAT ELISA-Kit der Firma Roche, welches nach den Herstellerangaben durchgeführt wurde. Hierfür wurden die Zellen wie folgt geerntet. Nach dem Absaugen des Mediums wurden die Zellen dreimal mit kaltem PBS gewaschen und nach dem letzten Waschgang selbiges gründlich entfernt. Pro 6-cm-Schale wurde nun 1 ml Lysepuffer auf die Schalen gegeben und für 30 min bei Raumtemperatur inkubiert. Anschließend konnten die Zellextrakte in eine 1,5 ml Reaktionsgefäß überführt werden. Die Zelltrümmer wurden durch Zentrifugation für 15 min bei 20.000 g und 4°C abgetrennt und der Überstand in ein neues Reaktionsgefäß überführt. Diese Extrakte wurden in siedendem Stickstoff eingefroren und bei –80°C gelagert. Die Bestimmung der Proteinkonzentration erfolgte mittels des Bradford Reagenz (BioRad). Für die Bestimmung der CAT Aktivität im CAT-ELISA wurden gleiche Mengen des Extraktes eingesetzt und der ELISA gemäß den Herstellerangaben durchgeführt, wobei für jede Probe ein Doppelwert ermittelt wurde. Aufgrund der aktivierenden oder reprimierenden Effekte des IE2 Proteins auf zahlreiche Promotoren, wurde auf die Transfektion eines internen Kontrollvektors verzichtet. Stattdessen wurden, wie in der IE2-Literatur üblich, die Transfektionen mindestens dreimal wiederholt, wobei unterschiedliche DNA-Präparationen zum Einsatz kamen (Harel und Alwine, 1998;Hermiston et al., 1990). Die Auswertung des ELISA erfolgte mittels des DYNATECH ELISA-Readers und des Programms Revelation.

2.15 Luciferase-Assay

Materialien:

Lysepuffer

Reporter Lysis Buffer 5x

Promega

Luciferinlösung

Luciferase Assay Buffer

Promega

↓51

Durchführung:

Zur Bestimmung der Luciferase-Aktivität wurden die Zellen 38 h nach Transfektion geerntet. Das Medium wurde abgesaugt und die Zellen einmal mit PBS gewaschen. Anschließend wurden 900 ml PBS auf die Zellen gegeben und diese hierin mittels eines Zellschabers von der Platte abgeschabt. Die Zellen wurden dann mittels Zentrifugation in einer Tischzentrifuge pelletiert und das Pellet in 200 μl des 1x Luciferase-Lysepuffer aufgenommen. Nach einer ca. einminütigen Inkubation bei Raumtemperatur wurden die Zellen durch Einfrieren in siedendem Stickstoff und Auftauen im Wasserbad bei 37°C lysiert. Durch 1-minütige Zentifugation bei 7000 g wurden die Zelltrümmer pelletiert. Der Überstand wurde sofort für den Luciferase-Assay verwendet.

Pro Probe wurden hierfür 20 μl Extrakt in ein FACS-Röhrchen gegeben und nach Injektion von 50 µl einer 10 mM Luciferinlösung 10 sec im Lumat (LB9501, EG&G Berthold, Bad Wildbach) gemessen, wobei von jeder Probe Doppelwerte bestimmt wurden.

2.16 Electrophoretic Mobility Shift Assay (EMSA)

↓52

Materialien:

TGA-Puffer

10 mM Tris pH 8,0; 10% Glycerin, 0,5 mM EDTA, 1mM DTT

BSA

Roth

Durchführung:

↓53

1. Präparation der Zellextrakte

Jeweils 24 h nach der Transfektion im Falle der HeLa Zellen und 48 h nach der Transfektion der U373 Zellen, wurden die Zellen geerntet. Hierfür wurde das Medium entfernt, die Zellen einmal mit kaltem PBS gewaschen und in 5 ml PBS mittels eines Zellschabers geerntet. Die Zellen in PBS wurden in 15 ml Falcons überführt, 5 min bei 200 g abzentrifugiert und das Pellet noch einmal zum Waschen in PBS resuspendiert und in 1,5 ml Eppendorf Reaktionsgefäße überführt. Nach einer weiteren Zentrifugation wurde der Überstand gründlich entfernt und die Zellen in 3 Volumen TGA-Puffer resuspendiert. Anschließend erfolgte die Präparation der Extrakte mittels Ultraschall (Vibra cell sonicator, Sonics & Materials). Die Zellen wurden bei Verwendung einer schmalen Spitze und 80% „output control“ zweimal mit je 3 Impulsen à 1 sec beschallt. Dazwischen wurden die Proben auf Eis gelagert, um ein übermäßiges Erhitzen zu verhindern. Zur Klärung der Extrakte wurden diese für 10 min bei 20.000g zentrifugiert, die Überstände aliquotiert und bei –80°C gelagert.

2. Radioaktive Markierung der Zielsonde

↓54

Als Zielsonde diente eine Duplex-DNA-Fragment des Bereichs von -40 bis +17 des MIE Promotors. In dieser Sonde ist also neben der crs auch die TATA Box vorhanden.

Folgende Oligonukleotide wurden für die Hybridisierung zur Targetduplex verwendet:

MIEP sense

↓55

In den crs-mut Oligonukleotiden ist die crs durch Punktmutationen so verändert, dass keine Bindung des IE2-Proteins mehr erfolgen kann. Die Mutation ist hierbei die gleiche wie die in dem verwendeten mutierten MIE Promotorkonstrukt (pRR55mut), das durch IE2 nicht mehr reprimiert wird.

Die Oligonukleotide wurden von der Firma MWG bezogen. Der jeweilige sense-Strang der Duplex trägt am 5’-Ende eine Biotin-Markierung für weitere Anwendungen.

Zur Hybridisierung der Duplex wurden gleiche Mengen des sense und des antisense- Stranges miteinander gemischt, für 5 min bei 95°C inkubiert und für mindestens 30 min bei Raumtemperatur stehen gelassen. Hundert Nanogramm der Duplex wurden dann mit 2 ml Eco Pol Puffer (New England Biolabs (NEB)), 0,5 mM dNTP-Mix, 2,5 U Klenow (NEB) und 20 μCi of [α-32P]dATP für 30 min bei 37° C inkubiert. Zur Inaktivierung des Enzyms schloss sich eine weitere Inkubation für 5 min bei 65 °C an. Um nichteingebaute Nukleotide zu entfernen, wurde der Markierungsansatz über eine Nick-Säule aufgereinigt, wobei dieser mit 30 μl TE auf 50 μl aufgefüllt und dann auf eine zuvor mit TE equilibrierte Nick-Säule gegeben wurde. Nach einmaligem Waschen mit 0,4 ml TEPuffer wurden 0.4 ml TE auf die Säule gegeben und der Durchfluß als Sonde verwendet. Die markierte Sonde wurde bei –20°C gelagert.

3. Bindungsansatz

In einem Gesamtvolumen von je 20 μl pro Ansatz wurden 20 μg Protein mit in TEPuffer mit 3 μg/μl BSA, 5% Glycerin, 1mM MgCl2, 12,5 ng/μl poly(dA-dT)·(dA-dT) und 5 ng/μl denaturierter, sonizierter Heringssperm DNA für 10 min bei Raumtemperatur inkubiert. Anschließend erfolgte die Zugabe von 1,5 μl radioaktiv markierter Zielduplex (~20.000 cpm, ca. 50 fmol) und eine weitere Inkubation bei Raumtemperaturfür 10 min. Nach der Bindungsreaktion wurden je 5 μl eines Ansatzes auf ein 4%iges natives Polyacrylamidgel aufgetragen und für 1,5 h bei 200 V elektophoretisch aufgetrennt. Das Gel wurde nach dem Lauf getrocknet und ein Kodak X-Omat-Film (Kodak X-Omat, Sigma, Deisenhofen) belichtet. Nach einer in der Regel 24-stündigen Exposition bei –80°C erfolgte die Auswertung mittels Autoradiographie.

α-IE Antikörper

monoklonaler Antikörper gerichtet gegen das Exon2 des IE2- Proteins, Klon E13, ARGENE Biosoft (720 μg/ml)

α-HA Antikörper

monoklonaler Antikörper gegen das HA-Epitop Klon 16B12, Covance (1mg/ml)

α-IE2-Antiserum

polyklonales Antiserum gegen das IE2-Protein (Exon 5), Konzentration unbekannt, freundlicherweise zur Verfügung gestellt von T. Stamminger, Institut für Virologie, Erlangen

rdU-Antikörper

monoklonaler Antikörper gegen Bromdeoxyuridin (BrdU) Klon 3D4, Pharmingen, (0,5 mg/ml)

α-CD20 Antiköper

monoklonaler Antikörper gegen den CD20-Oberflächenmarker Klon 2H7, Pharmingen, (0,5 mg/ml)

Für die Kompetitionsexperimente mit nicht-markierter spezifischer Kompetitor-DNA wurde dem Reaktionsgemisch gleichzeitig mit Zugabe der radioaktiv markierten Zielsequenz ein 1-, 5-, 10-, 50- oder 100-facher Überschuss der nicht markierten wt bzw. mutierten Zielsequenz zugegeben. Die quantitative Auswertung erfolgte mittels eines Fluorescent Image Analyzer (Fuji, FLH-3000 Series) und des Programms Aida Image Analyzer v.3.11.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
12.10.2006