2 Materials and Methods

↓19

2.1  Bacteria – Escherichia coli

2.1.1  Strains

E. coli TOP 10:

F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 lacX74 recA1 araD139 (ara- leu)7697 galU galK rpsL (StrR ) endA1 nupG
(Invitrogen, chemically competent)

E.coli Rosetta™(DE3) pLys:

F- ompT hsdS(rB -mB -) gal dcmTetr lacY1 (DE3) pLys SRARE (Camr)
(Novagen, chemically competent)

↓20

DE3 indicates that the E.coli Rosetta™(DE3) pLys strain is a lysogen of lambda DE3, and therefore carries a chromosomal copy of the T7 RNA polymerase gene. This gene is under control of the lacUV5 promoter, which is inducible by addition of IPTG.

The DNA encoding for the recombinant protein was under control of the T7 promoter. To avoid basal expression of the polymerase and thus unspecific expression of the cDNA encoding for the recombinant protein, the bacteria contained the pLys plasmid. This plasmid encoded for T7 lysoszyme, a natural inhibitor of T7 RNA polymerase (Studier, 1991;Zhang and Studier, 1997). To enhance the expression of eukaryotic proteins, the bacteria additionally contained tRNAs for seven codons rarely used in E. coli and other prokaryotes (AGA, AGG, AUA, CUA, GGA, CCC, and CGG). The tRNA genes were also encoded on the pLys plasmid that additionally carried a chloramphenicol resistance marker. This plasmid was compatible with the plasmid pET-28(a)+ which was used to express NE.

2.1.2 Growth conditions and media

E.coli strains used for plasmid amplification were cultured according to standard procedures (Sambrook and Russell, 2001) at 37°C in Luria-Bertani (LB) medium supplemented with either ampicillin (100 μg/ml) or kanamycin (50 μg/ml). E.coli Rosetta™(DE3) pLys used for protein expression was grown in LB medium supplemented with chloramphenicol (50 μg/ml). If the bacteria carried the expression plasmid pET-28a(+), the media was additionally supplemented with kanamycin (50 μg/ml). Subcultures were diluted 1:100 in LB medium without antibiotics.

2.1.3 Protein expression

↓21

E.coli Rosetta™(DE3) pLys were transformed with the empty expression plasmid (pET-28a(+)) or with the plasmid carrying the respective cDNA encoding for histidine tagged mature NE (pET-28a(+)/NE mature). Transformation was carried out according to the manufactures protocol. Transformed bacteria were plated on LB agar plates supplemented with chloramphenicol (50 μg/ml) and kanamycin (50 μg/ml). Overnight cultures were grown in LB medium with kanamycin (50 μg/ml) and subcultured at a 1:100 dilution. Protein expression was induced by addition of IPTG (1mM) to the subculture at an OD600 of 0,8 for 4h. To test for expression of the recombinant proteins, 1 ml aliquots of the subcultures were harvested and dissolved in Laemmli buffer (Laemmli, 1970). The samples were separated via SDS-PAGE and analyzed by immunoblotting or Coomassie staining.

2.1.4 Protein purification

Protein purification was carried out at 4°C or on ice. 2 l subculture of E.coli Rosetta™(DE3) pLys carrying pET-28a(+)/NE mature were harvested. The pellet was dissolved in 20 ml lysis buffer (150 mM NaCl, 50 mMTris-Cl, pH 8,0, 5 mM DTT, 10 mm Imidazole, 0,2 % v/v triton 20 μg/g E.coli DNAse) using sonication (Sonoplus 2070, Bandelin Corp, 5x 45sec, 40% power, level 5). After centrifugation (3 h, 22000 x g) the supernatant was applied to a nickel column (Ni-NTA Agarose, Qiagen) that had been equilibrated (10 mM imidazole, 150 mM NaCl, 25 mM sodium phosphate buffer, pH 8). The flowthrough was reapplied to the column. Following two washing steps (2 x 10 ml; 50 mM imidazole, 150 mM NaCl, 25 mM sodium phosphate buffer, pH 8), the proteins were eluted using a high imidazole concentration (250 mM imidazole, 150 mM NaCl, 25 mM sodium phosphate buffer, pH 8). At every purification step aliquots were taken and analyzed by SDS-PAGE and subsequent immunoblotting or Coomassie staining. The fractions of the eluate containing the histidine tagged recombinant NE protein were combined and dialysed for 14 h. The dialysis buffer was changed twice during that time (36 mM Na-acetate, 164 mM glacial acid, pH 4). The dialyzed eluate was subsequently lyophilized and dissolved in 500 μl pNE storage buffer (20 mM Na Acetat/150 mM NaCl, pH 4,0).

2.2 Bacteria – Shigella flexneri

2.2.1  Strains

M90T:

wildtype strain of S.flexneri, serotype 5a

M09T ΔipaB + pUC19:

(Guichon, et al., 2001)

M90T ΔipaB pUC19/wt IpaB:

(Guichon, et al., 2001)

M90TΔipaB pUC19/Δ 8-10 aa IpaB:

(Guichon, et al., 2001)

2.2.2 Growth conditions and media

↓22

Shigella was grown on TSA plates (DifcoTM Tryptic Soy Agar, BD) including 0.01% Congo red. Shigella's ability to bind Congo red correlates with the presence of the virulence plasmid (Qadri, et al., 1988). For overnight cultures, a single colony from a plate was grown in 5 ml TSB-medium (BactoTM Tryptic Soy Broth, BD) at 37°C shaking at 200 rpm. S. flexneri carrying the pUC19 plasmid was cultured in TSB medium supplemented with 100 μg/ml ampillicin. Overnight cultures were subcultured 1:100 in TSB without antibiotics. An OD600 of 0.1 corresponds to a concentration of 4 x 107 bacteria/ml.

2.2.3 Cleavage of IpaB

Subcultures of M90T ΔipaB pUC19/wt ipaB and M90TΔipaB pUC19/Δ 8-10 aa ipaB were grown for 4-5 h at 37°C, shaking at 200 rpm. The bacteria were pelleted for 15 min at 40C, 17600 x g. The supernatant was filtered (0,22 μm pore size) on ice and mixed with sodium phosphate buffer (20 mM, ph 7,5). For the experiments shown in figure 3.2 and 3.7 the supernatant was used immediately. For all other IpaB cleavage experiments, supernatant of M90T ΔipaB pUC19/wt ipaB was generated once and stored in 1 ml aliqots at –200C. For the experiments aliquots were thawed and mixed with pNE or the individual cell lysates. To denature IpaB, thawed supernatant was heated for 10 min at 95°C and immediately cooled on ice prior to addition of pNE or the lysates. All cell lysates had been generated from 1x107 cells. The lysates had been incubated with the inhibitor cocktail for 15 min at RT prior to addition to the supernatant except for the experiments shown in figure 3.2 and 3.7. pNE and cell lysates were added to supernatant and incubated as indicated in the individual figure legends. Proteins were TCA precipitated and dissolved in Laemmli buffer (Laemmli, 1970). 1x108 bacterial equivalence were analyzed with SDS-PAGE at a polyacrylamide concentration of 12% and subsequent immunoblotting using an IpaB antibody.

2.2.4 Cleavage of IcsA and OmpA

M90T were grown overnight and subcultured for 2h. The concentration of the bacteria was determined at an OD of 600 nm wave-length. The bacteria were harvested for 10 min at 4°C, 5500 x g and the supernatant was discarded. The M90T were dissolved in 1x PBS (Gibco) at concentration of 3x109/ml and kept on ice during this procedure. 3x108 bacteria in 100 μl PBS were mixed with 900 μl IcsA-cleavage buffer (4,5 g NaCl, 4 g nutrient broth (BD) in 500 ml; 20 mM sodium phosphate, pH 7,4) and incubated with pNE and the individual cell lysates. All cell lysates had been generated from 1x107 cells and the lysates had been incubated with the inhibitor cocktail for 15 min at RT prior to addition to the bacteria. pNE and lysates were added to the bacteria as indicated in the individual figure legends and incubated for 1h at 37°C, shaking at 180 rpm. The bacteria were centrifuged for 5 min at 4°C, 12000 x g and dissolved in Laemmli buffer (Laemmli, 1970). For IcsA detection, 7,5x107 bacterial equivalence were analyzed by a SDS-PAGE at a polyacrylamide concentration of 10% and subsequent immunoblotting using an IcsA antibody. For OmpA detection, 2x107 bacterial equivalence were analyzed by SDS-PAGE at a polyacrylamide concentration of 15% and subsequent immunoblotting using an OmpA antibody.

2.3 Cells

2.3.1  Cell line

↓23

RBL-1

rat basophilic leukemia cells

(DSMZ, #ACC 147)

2.3.2 Growth conditions and media

RBL-1 cells were cultured in RPMI media supplemented with 1% L-glutamine, 1% Na-pyruvate and 10% FCS (complete media) at 37°C, 5% CO2. Stably transfected cell lines were cultured in complete media supplied with geneticin (0,5 mg/ml; Gibco). All cell culture equipment was sterile and purchased from Gibco unless stated otherwise. The RBL-1 cells grow both non-adherent (3/4) and adherent (1/4). In order to split the cells, the adherent fraction was incubated with trypsin (0,05% w/v in PBS) and collected with the non-adherent fraction by centrifugation. The concentration of the cells was determined using a Neubauer counting chamber (0,0025 mm2, Labor Optik). Cells were seeded at a concentration of 1x106/ml.

2.3.3 Transient transfection

A total of 1x106 RBL-1 cells were seeded in a 10 cm petridish in complete media and co-transfected with either 4 μg pCS2+/NE and 1 μg pCS2+/βgal or with 4 μg pCS2+ and 1 μg pCS2+/βgal. In separate tubes, DNA and Lipofectamine 2000 (Invitrogen) were diluted in 250 μl Opti-MEM1 buffer and mixed gently. After an incubation period of 5 min at RT both solutions were combined, mixed gently and incubated for another 20 min at RT before addition to the cells. The cells were cultured for 24 h in complete medium without geneticin. Then theywere harvested, washed in 1x PBS and dissolved in 150 μl 250 mM Tris-Cl, pH 7,5. As a transfection control, 30 μl of the cells were analyzed for β-galactosidase activity. The remaining 120 μl were lysed according to the protocol described below. The complete lysate was tested for NE activity.

2.3.4 Stable transfection and single-cell dilution

↓24

RBL-1 cells were separately transfected with the empty expression vector (pcDNA3), the expression vector carrying the DNA encoding for the wildtype full-length NE protein (pcDNA3/NE), or with the expression vector carrying the DNA encoding for the different mutant full-length NE proteins (see table 2.1). 1x106 RBL-1 cells in a total volume of 2 ml were seeded in a single well of a 6-well plate and transfected as described above using 4 μg DNA. The following day, the media was exchanged and the cells were incubated in complete media for another 48h before addition of geneticin. Since the expression vector pcDNA3 carries a geneticin resistance marker, successfully transfected cells were viable in this media after an incubation period of 5 days. Geneticin resistant cells were separated from dead cells by Ficoll centrifugation (50 min at RT, 400 x g), and seeded into individual 96-wells at a concentration of 0,5 cells/well to obtain one cell per well. The single-cell derived clones were expanded and NE enzymatic activity was tested from several of the different clones after growth to confluence as described below.

2.3.5 Cell lysis

Cell lysates were generated according to a modified protocol described by (Li and Horwitz, 2001). Cells (1x105-8) were pelleted and washed in sterile 1x PBS (Gibco). The pellets were either stored at –80°C or resuspended in 120 µl of 250 mM Tris-Cl, pH 7,5. The concentration was adjusted to 100 mM Tris-Cl, pH 7,5, 1 M MgCl2, 0,1% Triton X-100 in a 300 µl volume followed by one freeze-thaw cycle at –20°C overnight. The cell suspension was thawed on ice and DNA was fragmented by sonication (2 x 20 sec, position 3, 20 % power; Sonoplus 2070, Bandelin). Following this, the volume of the suspension was increased to 500 µl (700 mM NaCl, 60 mM Tris-Cl, pH 7.5, 600 mM MgCl2, 0,1% Triton X-100). In order to purify the lysate from cell debris, it was centrifuged at 16000 x gat 4°C for 90 min. 450 µl supernatant was collected and adjusted to a final volume of 600 µl (100 mM Tris-Cl, pH 7,5, 1 M NaCl, 500 mM MgCl2, 0,1% Triton X-100).

2.4 Chemicals

All chemicals were obtained from Sigma-Aldrich unless stated otherwise.

2.5 Enzymatic Assays

2.5.1  β-galactosidase activity

↓25

Transiently transfected cells were assayed for β-galactosidase expression using the Galacto Light-Plus Kit from Applied Biosystems. 30 μl of each sample was mixed with 250 μl lysis buffer, centrifuged for 2 min at 40C, 13000 x g. 20 μl of supernatant were analyzed for β-gal activity using a microtiterplate luminometer (BD Biosciences) according to the manufacturers’ protocol Every measurement was done in triplicates.

2.5.2 Reagents to measure NE and CG activity

pNE and pCG were both purified from human sputum (Elastin Products Company). NE activity was measured using the NE peptide substrate N-methoxy-succinyl-alanine-alanine-proline-valine-pnitroanilide (MeO-Suc-AAPV-pNA, 20,3 mM in 1-methyl-2-pyrrolidinone). To specifically inhibit the NE protein, the inhibitor N-methoxy-succinyl-alanine-alanine-proline-valine-chloromethyl ketone (NE-CMK, 100 mM in DMSO) was utilized. In order to measure CG activity, the CG peptide substrate N-succinyl-alanine-alanine-proline-phenylalanine-p-nitroanilide (N-Suc-AAPF-pNA, 60,8 mM in 1-methyl-2-pyrrolidinone) was used. The activity of CG was specifically inhibited by the peptide benzyloxycarbonyl-glycine-leucine-phenylalanine-chloromethyl ketone (Z-GLF-CMK, 10 mM in DMSO).

To block degradation of IpaB and IcsA by endogenous RBL-1 proteases, cell lysates were mixed with an individually prepared inhibitor cocktail (IC) and incubated for 15 min at RT. The IC was composed of bestatin, chymostatin, E-64, EDTA, leupeptin, pepstatin A, and TPCK at a concentration of 1mM each. The individual inhibitors were dissolved according to the manufacturers’ instructions and combined in DMSO. The concentration of the IC in the cell lysates corresponded to 50 μM, except for the experiment shown in figure 3.9 were 20 μM was used

2.5.3 NE and CG activity of cell lysates

↓26

The NE and the CG peptide substrate consist of four specific amino acids coupled to a chromophore (nitroanilide) at the P1 position. Cleavage by NE or CG results in the release of the chromophore leading to an increase of the optical density (OD) when measured at 410 nm wave-length. The complete lysate of transiently transfected cells or 1x105 and 1x108 cell equivalents of stably transfected cell lines (final volume of 600 µl) were mixed with 20 µl NE peptide substrate or with 20 µl CG peptide substrate. The mixtures were incubated for 30 min at 37°C in the dark. The reaction was terminated by addition of 300 µl of PMSF/PBS [1mM PMSF in 1x PBS (Gibco)]. The OD was measured at 410 nm wave-length using a photometer (Ultrospec 2100, Amersham). The lysate from cells transfected with the empty expression vector (vector lysate) was used for normalization. Lysate of cells expressing wildtype NE (wt) or vector lysate containing pNE was used as positive control for NE activity. pCG was added to vector lysate and served as positive control for CG activity.

If NE and CG specific inhibitors were used, they were added to the lysates before adding the substrates and this mixture was incubated at room temperature for 15 min. The final concentrations of the purified enzymes or the cell lysates are indicated in the individual figure legends.

2.5.4 NE and CG kinetics / activity units

The NE peptide substrate (10 µl/ml assay buffer: 500 mM NaCl, 200 mM Tris-HCl, pH 8) and the CG peptide substrate (70 µl/ml assay buffer: 100 mM Tris-HCl, ph 8,3) were dissolved in the individual assay buffers and protected from light. 750 µl of the respective substrate/assay buffer mixture were added to a plastic cuvette and normalized. PNE, pCG or cell lysates were subsequently added at a volume of 250 μl and the cleavage of the respective peptide substrate was monitored by measuring the OD at a wave-length of 410 nm over 3 min every 30 sec. The NE and the CG peptide substrates consist of four specific amino acids coupled to a chromophore (nitroanilide) at the P1 position. Cleavage by NE or CG results in the release of the chromophore leading to an increase of the optical density (OD) when measured at 410 nm wave-length.

↓27

The final concentrations of the purified enzymes or the cell lysates are indicated in the individual figure legends. If necessary, the volumes of the samples were increased to 250 μl with HBSS+/10mM HEPES buffer. Within each experiment the amount of HBSS+/10mM HEPES added was equal.

If the kinetics of the individual samples were linear, the NE or CG activity units could be calculated by subtracting the OD410 measured after 90 sec from the one measured after 150 sec. The resulting OD/min represented the unit of NE or CG activity.

2.6 Molecular cloning techniques

Standard molecular cloning techniques were performed according to (Sambrook and Russell, 2001). Plasmids and primers used in this study are listed in Table 3.1. The individual cloning strategies for expression of NE in E. coli and RBL-1 cells and the protocol for mutagenesis of ELA2 (NE gene) are described below. The sequences of all cloned NE fragments were confirmed by sequencing. All restriction enzymes used in this study were purchased from NEB Biolabs. Plasmids were amplified using chemically competent E. coli (TOP10, Invitrogen) according to manufacturers’ guidelines. Plasmid DNA was extracted from E. coli by the alkaline lysis procedure (Sambrook and Russell, 2001), and further purified using the Qiagen plasmid kits.

2.6.1  Cloning of NE for expression in E. coli

↓28

The DNA encoding for the human mature NE protein was amplified by PCR from the cDNA of NE (RZPD, #p998K167196). The PCR product was ligated into the expression vector pET-28a(+) using the restriction enzymes BspH I and Xho I, thereby joining the 3’-end of the NE DNA to a 6x hisitidine tag encoded in the vector. The relevant restriction sites had been introduced in the PCR primers of the NE amplicon. Furthermore, the forward primer contained five basepair exchanges (table 3.1, in bold) that did not alter the amino acid composition of the protein but disrupted continuous “GC” stretches at the 5’-end of the wildtype NE DNA. These basepairs were selected based on the software program PROTEOXPERT from Roche [www.proteoexpert.com (Roche-Applied-Science, )]. The PCR reaction was carried out in a 50 μl volume containing 2.5 U Pfu Turbo polymerase (Stratagene), 5 μl of the respective 10x polymerase buffer, 125 ng of each of the two primers and 0.25 mM of each dNTP. Template DNA was added in variable concentrations (by default 100 pg DNA). The amplification reaction was as following: 5’ 95°C, 30 cycles [1’ 95°C, 45’’ annealing at 60°C, 1’ elongation at 72°C], and 10’ final elongation at 72°C.

2.6.2 Cloning of NE for expression in RBL-1 cells

The DNA encoding for the human full-length NE protein was amplified by PCR from the cDNA of NE (RZPD, #p998K167196). The PCR product was ligated into the expression vector pCS2+ (Rupp, et al., 1994;Turner and Weintraub, 1994) using the restriction enzymes EcoR I and Xba I. The same restriction enzymes were used to subclone the NE fragment into the expression vector pcDNA3 for stable transfection of RBL-1 cells. The PCR reaction was identical to the one described above except that the annealing temperature was increased to 62°C.

2.6.3 Mutagenesis of ELA2 (NE gene)

Site-directedmutations in the DNA encoding for the human full-length NE protein were created using pcDNA3/NE as template. Mutations were introduced using theQuickChange site-directed mutagenesis kit (Stratagene) accordingto the manufacturer's protocol. This method uses complementaryoligonucleotides encoding the desired mutation. The sense strandoligonucleotides used in the mutagenesis reactions are listedin table 3.1 and the introduced basepairs are highlighted in bold. All mutations were confirmed by sequencing.

↓29

Table 3.1: Plasmids and Primers used in this study.

Plasmids

Primers

Sourcea

pCMV-Sport6/human NE cDNA

RZPD

pET-28a(+)

Novagen

pET-28a(+)/ NE mature

FWb: 5’ –cgtcggtcatgattgtaggtggtcgtcgtgcgcggccccacgc– 3’

RVc: 5’ -ccgctcgagttggatgatagagtcg– 3’

pCS2+

R. Rupp

pCS2+/βgal

R. Rupp

pCS2+/NE

FWb: 5’ -gacttcaggaattcgccaccatgaccctcggccgccgactcg- 3’

RVc: 5’ -gacttcagtctagatcagtgggtcctgctggccgggtccgg-3’

pcDNA3

Invitrogen

pcDNA3/NE

pcDNA.3/NE 35-41

5’ -gcccttcatggtgtccctgcagatccagagcccagcaggtcagagcag

atgcggcgccaccctgattgcgc- 3’

pcDNA.3/NE 58A-6l

5’ –cgtcatgtcggccgcgcactgctggggaagcaatataaatgtcgcggtg

cgggtggtcctgggagcc- 3’

pcDNA.3/NE N98A

5’ –cggctacgaccccgtagctttgctcaacgacatcg- 3’

pcDNA.3/NE N98L

5’ –cggctacgaccccgtactgttgctcaacgacatcg- 3’

pcDNA.3/NE F192A

5’ –gaggggccggcaggccggcgtctgtgccggggactccggcagccccttg

gtctgc- 3’

pcDNA.3/NE F192K

5’ –gaggggccggcaggccggcgtctgtaaaggggactccggcagccccttg

gtctgc- 3’

pcDNA.3/NE A213V

5’ –gctaatccacggaattgtgtccttcgtccggggag- 3’

pcDNA.3/NE F215A

5’ –gctaatccacggaattgcctccgccgtccggggaggctgcgcctcag- 3’

pcDNA.3/NE F215Y

5’ –cgtcatgtcggccgcgcactgctggggaagcaatataaatgtcgcggtg

cgggtggtcctgggagcc- 3’

pcDNA.3/NE 216-218

5’ –ctaatccacggaattgcctccttcggcaaaagctcctgcgcctcagggctc

taccccg- 3’

pcDNA.3/NE 216-224

5’ –ctaatccacggaattgcctccttcggaaagtcgtcaggggttcctcccga

tgcctttgccccggtg- 3’

aUnless indicated otherwise, plasmids were constructed during the course of this study.
bFW = forward primer
cRV = reverse primer

2.7 Protein analysis

2.7.1  Determination of protein concentrations

The total protein concentration of the cell lysates and of pNE as well as pCG was determined by Bradford analysis (Bradford, 1976) using the BioRad protein assay reagent and bovine serum albumin (Promega) as protein standard.

2.7.2 TCA precipitation

10% trichloroacetic acid (TCA; Merck) was added to the bacterial supernatants and incubated on ice for 30 min. The samples were centrifuged at 15000 x g for 30 min and the pellet dissolved in acetone to reduce TCA contamination. After a 10 min centrifugation step at 15000 x g the acetone was removed and the sample left to dry (Rehm, 2002). The precipitated proteins were dissolved in Laemmli buffer (Laemmli, 1970).

2.7.3 SDS polyacrylamide gel electrophoresis (SDS-PAGE)

↓30

Denaturing gel electrophoresis can resolve complex protein mixtures into hundreds of bands on a gel. In SDS polyacrylamide gel electrophoresis (SDS-PAGE) separations, migration of the proteins is determined not by intrinsic electric charge of polypeptides but by molecular weight. Sodium dodecyl sulphate (SDS) is an anionic detergent that denatures proteins by wrapping the hydrophobic tail around the polypeptide backbone and thus confers a net negative charge to the polypeptide in proportion to its length. Because molecular weight is essentially a linear function of the peptide chain length, the proteins separate by molecular weight (Rehm, 2002).

SDS-PAGE was always performed with the vertical Mini-PROTEAN® 3 system from BioRad. Samples were dissolved in Laemmli buffer (Laemmli, 1970) and applied onto precast polyacrylamide gels (Biorad) with varying polyacrylamide concentrations. The NE samples from the bacterial expression of NE were run on 15% acrylamide SDS gels. The IpaB, IcsA and OmpA samples were run on 12, 15, and 10% acrylamide SDS gels respectively. The acrylamide gels were completely covered with running buffer (25 mM Tris, pH 8.6, 192 mM glycine and 0.1% SDS) and the proteins of the samples were separated for 1,5 h at 150 V. The separated proteins were either visualized by immunoblotting or by Coomassie staining.

2.7.4 Immunoblotting

Sufficiently separated proteins in an SDS-PAGE can be transferred via an electric current to a solid membrane for immunoblot analysis, also called Western Blot analysis. Transfer to nitrocellulose membranes (Amersham Pharmacia) was accomplished by blotting with the BIO-RAD Tank Transfer System for 1 hour at 100 V in transfer buffer (39 mM glycine, 48 mM Tris, 0.037% SDS, 20% methanol). The membranes were blocked with 3% (w/v) bovine serum albumine (BSA) dissolved in PBS (Gibco) containing 0.1% (v/v) Tween for 1 hour at RT or overnight at 4oC. The primary antibodies, dissolved in the blocking buffer supplemented with 0,02% (v/v) Na-azide, were incubated with the membranes for 1-2 h at RT. The primary antibody was washed off in PBS with 0,1% (v/v) Tween three times for 10 min. The membrane was then incubated with the appropriate secondary antibody, which was dissolved in the blocking buffer, for 30-60 min at RT. The secondary antibody was also washed off in PBS with 0,1% (v/v) Tween three times for 10 min. All secondary antibodies (Jackson Laboratories Inc) were horseradish-peroxide (HRP) conjugated and bands were visualized by the ECL Western blotting detection reagents (Amersham Pharmacia). Horseradish peroxidase catalyses the oxidation of luminol, which in its excited state emits light (chemiluminescence). Enhanced chemiluminescence is achieved by the addition of chemical enhancers such as phenols, which increases the light output approximately 1000 fold. Primary and secondary antibodies used are listed in table 3.2.

↓31

Table 3.2: Primary and secondary antibodies used in this study.

Primary Antibodies

Dilution

Source

anti-pentahistidine, monoclonal

1:2000

Qiagen

anti-IpaB; monoclonal

1:5000

P.J. Sansonetti

anti-IcsA; polyclonal raised in goat

1:1000

P.J. Sansonetti

anti-OmpA; polyclonal raised in goat

1:1000

K. S. Kim

Secondary Antibodies

anti-mouse

1:5000

Jackson Laboratories Inc

anti-rabbit

1:5000

Jackson Laboratories Inc

2.7.5 Coomassie staining

After electrophoresis the acrylamide gels were incubated with the Coomassie Blue solution (0.1% w/v Coomassie Brilliant Blue R-250 [BioRad], 20% MeOH, 10% acetic acid) at RT between 2 and 16 h to visualize proteins. Gels were destained in 50% (v/v) MeOH with 10% (v/v) acetic acid until protein bands were clearly visible.

2.8 Structure analysis

↓32

The structures of NE and CG were analyzed using PYMOL (DeLano, 2002). Unless stated otherwise, the structures were presented as cartoons showing the backbones of the structures. Secondary structures like β-sheets and α-helices are depicted as flat arrows and helices respectively. Individual amino acids were highlighted and shown as sticks. The superimposition of the NE and CG structures was achieved using Swiss-PdbViewer (Guex, 1997). 190 α-carbonyl atoms of the proteins were superimposed with a root mean square deviation (RMSD) of 0,9 Å. In detail, the following segments were aligned: I16-Q34,
R41-W59, S61, N65-H91, Q93-G151, D153-R164, G167-C168, Q180-G184, E187-K217
S219-G220, and P225-M242. The nomcenclature and numbering is based on cathepsin G. The RMSD describes the difference in localization of the α-atoms at similar positions in the two proteins. Therefore the RMSD measures the similarity of the three dimensional structures. A RSMD of zero means that the structures are identical in conformation (Maiorov and Crippen, 1994).


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML generated:
14.11.2006