[Seite 47↓]

3.  Ergebnisse

3.1. Fragestellung und Lösungsansätze

Bis auf wenige Ausnahmen können alle Cyanobakterien, eine unbekannte Zahl anderer Eubakterien sowie Organismen, bei denen die Cyanophycin-Synthetase heterolog exprimiert wird, Cyanophycin im Cytoplasma akkumulieren. Diese in vivo-Akkumulation führt zu einer Bildung von teilweise mehr als 10% Cyanophycinanteil am Trockengewicht. Die von mir untersuchte, heterolog in E. coli (BL21[DE3]) exprimierte Cyanophycin-Synthetase aus Anabaena variabilis ATCC 29413 bildete Cyanophycin, d.h. es wurden große Mengen des Polymers als unlösliche Granula gebildet. Identische Ergebnisse bei heterologer Expression anderer Cyanophycin-Synthetasen in verschiedenen Organismen erzielten Aboulmagd et al. (2001). Die Molmasse des Cyanophycins beträgt in Cyanobakterien zwischen 25 kDa und 100 kDa, bei heterologer Expression liegt sie zwischen 25 kDa und 30 kDa.
Nicht untersucht wurde bisher der Mechanismus der Synthese, d.h. die Richtung der Polymerverlängerung, die Reihenfolge des Substrateinbaus und der Ablauf der Kondensationsreaktion zwischen den Aminosäuren. Die im Rahmen dieser Arbeit synthetisierten Peptide erlaubten erstmalig eine qualitative Untersuchung dieser bislang ungeklärten Fragestellungen. Zusätzlich konnten mit Hilfe dieser Peptide bekannte Ergebnisse zur Substratspezifität der Cyanophycin-Synthetase aus A. variabilis ATCC 29413 bestätigt und ergänzt werden. Mittels ortsgerichteter Mutagenese der Cyanophycin-Synthetase konnte zudem eine Zuordnung zwischen Bereichen des Enzyms und Teilschritten seiner katalytischen Funktion erreicht werden.

3.1.1.  In vitro-Synthese von Cyanophycin

Bei in vitro-Inkubation der Cyanophycin-Synthetase mit synthetischen Primern und den konstituierenden Aminosäuren Aspartat und Arginin, ATP, Mg2+- und K+-Ionen, sowie einem Thiolreagenz wie Dithiothreitol oder Mercaptoethanol wurde eine Bildung von Cyanophycin im Größenbereich von 25 kDa bis 30 kDa beobachtet, das heißt mit der gleichen Molmasse wie bei Expression der Synthetase in E. coli. Ohne Primer konnte keine in vitro-Synthese von Cyanophycin festgestellt werden. Dies ist in Übereinstimmung mit bislang allen veröffentlichten Arbeiten zur biochemischen Charakterisierung verschiedener Cyanophycin-Synthetasen (siehe Abschnitt 1.7.).


[Seite 48↓]

Abschätzungen der Menge des gebildeten Produktes ergaben, dass nie mehr Cyanophycinmoleküle als eingesetzte Primermoleküle gebildet wurden. Es gelang also in vitro lediglich eine Elongation und keine de novo-Synthese. In vivo kann jedoch auch durch heterologe Expression von Cyanophycin-Synthetasen in mehreren Organismen Cyanophycin gebildet werden (Tab. 2, Abschnitt 1.7.). Ob ein Primer, der in mehreren nicht verwandten Organismen vorkommt, existiert oder ob die gewählten Synthesebedingungen in vitro möglicherweise nicht denen in vivo entsprechen, bleibt ungeklärt. Die Zugabe des Überstandes eines Rohextraktes von E. coli DH5α, Anabaena variabilis oder einer in der Aktivität der Cyanophycin-Synthetase (CphA) defizienten Mutante von Anabaena variabilis (freundliche Gabe von Dr. Karl Ziegler) führte zu keiner Cyanophycinbildung (Ergebnisse nicht gezeigt).

3.2. Versuche, die CphA-Anreicherung zu optimieren

Es wurde versucht Cyanophycin-Synthetase aus A. variabilis in E. coli (BL21[DE3]) über andere Reinigungsmethoden effektiver zu reinigen. Weder hydrophobe Interaktionschromatographie (Methyl-, Octyl- und Phenylsepharose (keine Bindung bei mit 1M (NH4)2SO4 ergänztem Puffer), Hydroxyapatit-Säulenmaterial (Elution mit Phosphatgradient), DEAE-Cellulose, noch Arginin- oder Aspartat-Agarose-Säulenmaterial (Elution mit entsprechendem Aminosäuregradient) erwiesen sich als nützlich (Ergebnisse nicht gezeigt). Für Versuche mit der Wildtyp-Synthetase wurde anschließend mit pET19b-Konstrukten gearbeitet, da die N-terminal zusätzlich exprimierten zehn Histidinreste eine sehr einfache Anreinigung durch Bindung an Nickel-NTA-Agarose und anschließende fraktionierte Elution mit Imidazol ermöglichten. Der überwiegende Anteil der Synthetase eluierte bei Imidazolkonzentrationen zwischen 200 und 500 mM. Punktmutierte Cyanophycin-Synthetasen (Abschnitte 3.7. bis 3.9.) wurden als pET-22b-Konstrukte eingesetzt. Qualitative biochemische Unterschiede zwischen pET-19b- und pET-22b-Konstrukt (Abschnitt 2.2.6.8.1., Expression ohne His10-tag) wurden nicht gefunden.

3.3.  In vitro-Elongation mit Hilfe synthetischer Primer

Unter Annahme der in Abbildung 2 (Abschnitt 1.1.) gezeigten verzweigten Struktur des Cyanophycins stellt sich die Frage nach der Richtung der Polymerverlängerung. Für die Untersuchung der Richtung der Elongationsreaktion und um ein einheitliches


[Seite 49↓]

Substrat für Einbauversuche zur Verfügung zu haben, wurden die in Abbildung 5 gezeigten Primer synthetisiert:

Abbildung 5: synthetische Primer

Ahx: 6-Aminohexansäure


[Seite 50↓]

Die Verbindungen (DR)3 und (DR)3-D sind zwei kurze Cyanophycinmoleküle, die Verbindungen (DR)3-(Ahx)2 und (Ahx)2-(DR)3 sind C- bzw. N-terminal durch eine jeweils aus zwei Molekülen 6-Aminohexansäure (Ahx) bestehende Schutzgruppe blockiert.

3.4. Test verschiedener Peptide als Aminosäuresubstrat bzw. Primer

Abbildung 6 zeigt, dass der Einsatz des synthetischen Primers (DR)3 zur Bildung eines Polymers mit einer Größe zwischen 25 kDa und 30 kDa führte, also der gleichen Größenverteilung wie die des Polymers, das in vivo von der heterolog in E. coli exprimierten Cyanophycin-Synthetase aus A. variabilis gebildet wird (Abb. 6, Spur 1). Die Wirksamkeit des synthetisierten verzweigten Peptides als Primer ist ein Beleg dafür, dass die Struktur dieses Primers dem Aufbau von Cyanophycin ähnlich sein könnte (vergleiche identischer Aufbau der Strukturen in Abb. 2. und 5., Abschnitt 1.1. und 3.3). Ansätze ohne Primer oder ohne eines der Substrate führten nicht zu einer Polymerbildung (Abb. 6, Spuren 2 bis 5).

Abbildung 6: Test des Peptides (DR)3 als Primer, SDS-PAGE (15% Acrylamid)

Es wurden ca. 10 µM des synthetischen Primers (DR)3 mit gereinigter Synthetase über Nacht bei Raumtemperatur inkubiert. Die Ansätze wurden anschließend mittels SDS-PAGE und Coomassie-Färbung analysiert. Es wurden 2 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa).
Spur 1: kompletter Reaktionsansatz
Spur 2: ohne Aspartat
Spur 3: ohne Arginin
Spur 4: ohne ATP:
Spur 5: ohne (DR)3
Spur 6: kompletter Reaktionsansatz, aber Synthetase gekocht

Um die Elongationsrichtung festzustellen, wurden Versuche mit N-, bzw. C-terminal blockierten Primern durchgeführt. Die Abbildung 7 zeigt, dass eine Blockierung des C-Terminus des Primers die Elongation verhindert, eine Blockierung des N-Terminus jedoch nicht. Die Elongation vollzieht sich also durch Aktivierung der Carboxylgruppe, in Übereinstimmung mit den aufgeklärten Reaktionen strukturell verwandter Enzyme wie D-Alanin: D-Alanin Ligase aus E.coli (Fan et al., 1995) oder MurC (Bouhss et al. 1997) und MurD (Bertrand et al. 1997).


[Seite 51↓]

Abbildung 7: Elongationsansätze unter Verwendung C- oder N-terminal blockierter Peptide als Primer, SDS-PAGE (15% Acrylamid)

Verschiedene Primer wurden mit einem ansonsten vollständigen Reaktionsansatz über Nacht bei Raumtemperatur inkubiert. Es wurden 2 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa).

Desweiteren wurde das Peptid (DR)3-D und das Dipeptid β-Asp-Arg auf Wirkung als Primer bzw. als Substrat untersucht:

Abbildung 8: Test des Primers (DR)3-D und Test des Dipeptides β-Asp-Arg als Primer und als Substrat, SDS-PAGE (15% Acrylamid)

Spur 1: kein Primer
Spur 2: DR als Primer, [β-Asp-Arg] = 55 µM
Spur 3: (DR)3 als Primer, ohne Arg
Spur 4: (DR)3 ohne ATP
Spur 5: (DR)3 als Primer
Spur 6: (DR)3-D als Primer
Spur 7: Primer DR und Substrat, [β-Asp-Arg] = 1 mM, ohne Asp, ohne Arg
Spur 8: (DR)3 als Primer, ohne Asp
Die Abbildung 8 zeigt weitere Versuche mit verschiedenen Peptiden als Primer. Die Proteinbande bei ca. 65 kDa ist vermutlich ein Abbauprodukt der Synthetase und beeinträchtigt nicht ihre biochemische Aktivität. Es wurden 2 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa).

Die Abbildung 8 belegt, dass sowohl (DR)3 (Spur 5) als auch (DR)3-D (Spur 6) biochemische Aktivität als Primer besitzen. Das Dipeptid β-Asp-Arg wurde jedoch weder als Primer (Spur 2), noch als Substrat anstelle von Aspartat und Arginin (Spur 7) akzeptiert.


[Seite 52↓]

Zur Klärung der Frage, ob β-Asp-Arg in höherer Konzentration und in Kombination mit Primer (DR)3 eine Elongation bewirkt, wurden erneut mehrere Ansätze untersucht (Abb. 9).

Abbildung 9: Test des Dipeptids β-Asp-Arg als Aminosäuresubstrat, SDS-PAGE (15% Acrylamid)

Spur 1: ohne Primer
Spur 2: (DR)3Spur 3: (DR)3 + β-Asp-Arg, [β-Asp-Arg] = 1 mM
Spur 4: kein Primer, [β-Asp-Arg] = 1 mM
Spur 5: kein Primer, [β-Asp-Arg] = 30 mM
SDS-PAGE: Reaktionsansätze unter Verwendung erhöhter β-Asp-Arg-Konzentrationen, [(DR)3] = 35µM, [Asp] = 0,8 mM, [Arg] = 0,4 mM, Asp und Arg waren nur in den Ansätzen 1 und 2 enthalten. Es wurden 2 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa).

Die Kombination aus Primer (DR)3 und Substrat β-Asp-Arg führte ebenfalls nicht zur Bildung des Polymers (Abb. 9, Spur 3).
Weiterhin wurden andere Dipeptide, die entweder eine Peptidbindung oder eine Isopeptidbindung enthalten, auf ihre Wirkung als Primer untersucht (Abb. 10). Keines der untersuchten Dipeptide wirkte als Primer.
Um zu überprüfen, ob ein Faktor mit Primerwirkung mitgereinigt wurde, ist die Synthetase in höherer Menge eingesetzt worden (Abb. 10, Spuren 13 und 14). Die Spuren 13 und 14 zeigen keine andere Proteinbande als die der Cyanophycin-Synthetase. Eine erhöhte Menge eingesetzter Synthetase bzw. möglicher anhaftender Faktoren führte nicht zu einer erkennbaren Bildung von Cyanophycin. Offenbar enthielt die Synthetase-Präparation keine Moleküle, die als Primer der Elongationsreaktion dienen könnten.


[Seite 53↓]

Abbildung 10: Test verschiedener Dipeptide und hoher Synthetasekonzentrationen, SDS-PAGE (15% Acrylamid)

Spur 1: kein Primer, keine Aminosäuren
Spur 2: (DR)3Spur 3:β-Asp-Ala
Spur 4: γ-Glu-Leu
Spur 5: β-Asp-Phe
Spur 6: β-Asp-Gly
Spur 7: β-Asp-Lys
Spur 8: Enzym gekocht
Spur 9: β-Asp-Leu
Spur 10: β-Asp-His
Spur 11: α-Asp-Arg
Spur 12: α-Arg-Asp
Spur 13: 30fache Enzymkonz.
Spur 14: 10fache Enzymkonz.
Die Dipeptide wurden in einer Endkonzentration von 1 mM eingesetzt, der Primer in einer Konzentration von ca. 14 µM, die Menge eingesetzter Cyanophycin-Synthetase betrug 0,5 µg pro Ansatz (Ausnahmen: Spuren 13 und 14, Proteinbande bei ca. 100 kDa).

3.5. Abfolge des Einbaus der Aminosäuresubstrate

Unter Annahme einer einheitlichen Struktur des Cyanophycins und aufbauend auf die Ergebnisse aus Abschnitt 3.4. (C-terminale Verlängerung) ergeben sich drei Möglichkeiten der Kettenverlängerung:

Zur Überprüfung der oben genannten Möglichkeiten wurden zwei unterschiedliche Methoden verwendet.
Zu ansonsten kompletten Reaktionsansätzen mit synthetischem Primer wurden nur die radioaktiv markierten Aminosäuren [³H]-Aspartat oder [³H]-Arginin eingesetzt und das Reaktionsgemisch anschließend an einer Biogel P2-Säule aufgetrennt, um anhand einer Kalibrierung der Säule ein möglicherweise


[Seite 54↓]

entstehendes Produkt finden und seine Größe abschätzen zu können (siehe Abschnitt 2.2.5.5.).
Für eine Produktanalyse durch MALDI-MS wurden Reaktionsansätze unter Verwendung nichtmarkierter Substrate in dem flüchtigen Ammoniumbicarbonat-Puffersystem präpariert. Die Ansätze wurden nach Lyophilisation und Aufnahme in dem Laufmittel (0,1 M Essigsäure) anschließend ebenfalls über eine Biogel-P2-Säule aufgetrennt. Die Verwendung eines flüchtigen Puffersystems und die Auftrennung an der P2-Säule hatte die Funktion, die Proben von Salzen, die in der MALDI-Massen-spektroskopie stören, zu reinigen.
Die Ergebnisse sind exemplarisch in Abbildung 11 dargestellt. Es wurden verschiedene Kombinationen aus Primer und Aminosäuresubstrat eingesetzt.

Abbildung 11: Exemplarische Darstellung der Analysen mittels P2-Säule und MALDI-MS

Die Basislinien wurden der Klarheit halber gegeneinander versetzt.

Abbildung 11A zeigt die Gelfiltrationsanalyse von Ansätzen vor und nach einer Reaktion von [³H]-Asp mit Primer (DR)3. Das Produkt (DR)3-[³H]-Asp fand sich in den Fraktionen 35 bis 45, mit der höchsten Konzentration in Fraktion 40. Das Elutionsvolumen des Produktes entspricht einer Masse von ca. 1000 Da. Abbildung 11B zeigt die Masse des Primers (DR)3 (berechnete mittlere Molmasse M+H+= 832,8 Da) vor einer Reaktion, sowie des Produktes (DR)3-D (berechnete mittlere Molmasse M+H+=947,9 Da) nach Reaktion mit Aspartat. In Abschnitt 3.6. sind die Ergebnisse dieser Untersuchungen zusammengefasst (Tab. 8). Eine Berechnung der Molmassen verschiedener Peptide findet sich im Anhang (Abschnitt 6.1.).


[Seite 55↓]

3.6.  Substratspezifität der Cyanophycin-Synthetase

Die von Simon & Weathers(1976), Simon et al. (1980) und Hejazi (2002) vorgeschlagene Grundstruktur von Cyanophycin ist unstrittig. Über die Anteile und Art der konstituierenden Aminosäuren hingegen finden sich aber verschiedene Angaben (Abschnitt 1.2.).
Untersuchungen mittels der hier verwendeten massenspektrometrischen Methode sowie Auftrennung von radioaktiven Produkten ergaben die in Tabelle 8 und 9 aufgeführten Ergebnisse. Die Dokumentation der MALDI-Massenspektren findet sich im Anhang in Abschnitt 6.2.. Eine Erläuterung und Diskussion wird in Abschnitt 6.2.3. gegeben.

Tabelle 8: Zusammenfassung der Ergebnisse zur Aufklärung der Elongations-richtung: Reaktionsansätze mit verschiedenen Primern

Nr.:

Primer

Substrat

Produkt

Referenz

C-terminal blockierter Primer:

 

1

(β-Asp-Arg)3-(ε-Ahx)2

Asp + Arg

kein Polymer

Abb. 7, Spuren 4,5

2

(β-Asp-Arg)3-(ε-Ahx)2

Asp

kein Produkt

Spekt. 4, Anh. 6.2.1.

N-terminal blockierter Primer:

 

3

(ε-Ahx)2-(β-Asp-Arg)3

Asp + Arg

Cyanophycin

Abb. 7, Spur 3

Spekt. 15, Anh. 6.2.1.

4

(ε-Ahx)2-(β-Asp-Arg)3

Asp

(ε-Ahx)2-(β-Asp-Arg)3-Asp

Spekt. 2, Anh. 6.2.1.

Unblockierte Primer:

 

5

(β-Asp-Arg)3

Asp + Arg

Cyanophycin

Abb. 6, Spur 1

Abb. 7, Spur 2

6

(β-Asp-Arg)3

Asp

(β-Asp-Arg)3-Asp

Spekt. 6, Anh. 6.2.1.

7

(β-Asp-Arg)3

Arg

kein Polymer

Abb. 6, Spur 2

8

(β-Asp-Arg)3

β-Asp-Arg

kein Polymer

Abb. 9, Spur 3

9

(β-Asp-Arg)3-Asp

Asp + Arg

Cyanophycin

Abb. 8, Spur 6

10

(β-Asp-Arg)3-Asp

Asp

kein Produkt

Spekt. 7, Anh. 6.2.1.

11

(β-Asp-Arg)3-Asp

Arg

(β-Asp-Arg)4

Spekt. 8, Anh. 6.2.1.

Tabelle 9: Zusammenfassung der Ergebnisse zur Substratspezifität

Nr.:

Primer

Substrat

Produkt

Referenz

1

(DR) 3 -D

Orn

(DR) 3 -(D-Orn)

Spekt. 12, Anh. 6.2.1.

2

(DR) 3 -D

Cit

(DR) 3 -(D-Cit)

Spekt. 13, Anh. 6.2.1.

3

(DR) 3 -D

Lys

(DR) 3 -(DK)

abgeleitet aus Spekt. 11,

Anh. 6.2.1.

4

(DR) 3 -(DK)

Asp

(DR) 3 -(DK)-Asp

Spekt. 11, Anh. 6.2.1.

5

(DR) 3

Glu

kein Produkt

Spekt. 10, Anh. 6.2.1.

MALDI-MS-Spektren sind im Anhang dokumentiert (Abschnitt 6.2.).

Die Ergebnisse der MS-Messungen sind rein qualitativ. Abbildung 12 zeigt, dass unter den gewählten Reaktionsbedingungen nur bei Anwesenheit der beiden typischen Substrate Aspartat und Arginin für die Färbung ausreichende Mengen eines Polymers entstanden, obwohl verschiedene basische Aminosäuren mit dem Primer (DR)3-D verknüpft werden können (Tab. 9).Mögliche Erklärung dafür ist entweder eine geringe Substrataffinität oder eine Hemmung der Synthese im Verlauf einer Elongation mit den untersuchten Substraten. Wie Tabelle 9 (Zeile 4) zeigt, erfolgt aber zumindest im Falle des eingesetzten Lysins kein absoluter und sofortiger Abbruch der Synthese.

Abbildung 12: In vitro-Elongationsansätze mit den anstelle von Arginin eingesetzten Aminosäuren Lysin, Ornithin, und Citrullin, SDS-PAGE (15% Acrylamid)

Spur 1: Lys
Spur 2: Orn
Spur 3: Cit
Spur 4: Arg
Es wurden 2 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa). Alle Ansätze enthielten ca. 10 µM (DR)3-D als Primer und jeweils 1,6 mM Aspartat und 1,6 mM der basischen Aminosäure.

Merritt et al. (1994) und Wingard et al. (2002) fanden Glutamat als Bestandteil von Cyanophycin aus Synechocystis PCC 6308 bzw. Synechococcus sp. strain G2.1. Im Rahmen dieser Arbeit konnte ein Einbau von Glutamat anstelle von Aspartat durch die Anabaena-Synthetase nicht gezeigt werden.


[Seite 57↓]

3.7.  Struktur der Cyanophycin-Synthetase

Sequenzvergleiche mit dem Programm BLAST (Altschul et al. 1990, http://www.ncbi.nlm.nih.gov) zwischen der Cyanophycin-Synthetase CphA und Proteinsequenzen der Datenbanken zeigten eine Ähnlichkeit des C-terminalen Bereiches zu einer Superfamilie von Ligasen, der Mur-Ligasen und Folyl-Poly-γ-Glutamat-Ligase angehören. Der N-terminale Bereich dagegen wies Ähnlichkeit zu Ligasen der ATP-grasp-Superfamilie auf (Berg et al. 2000).

Abbildung 13: Stark schematisierter Sequenzvergleich zwischen Cyanophycin-Synthetase (A. variabilis) mit anderen Proteinsequenzen

CphA: Cyanophycin-Synthetase aus Anabaena variabilis ATCC 29413
DdlB: D-Alanin:D-Alanin-Ligase aus E. coliMurD: UDP-N-Acetylmuramoyl-L-Alanin:D-Glutamat-Ligase aus E. coliZahlenwerte bezeichnen Aminosäurereste nach Nummerierung bei CphA (A. variabilis), Sequenz-vergleich durchgeführt mit BLAST, http://www.ncbi.nlm.nih.gov.

Die Sequenzvergleiche lassen auf eine aus zwei Bereichen bestehende Struktur schließen (Ziegler et al. 1998, Berg et al. 2000, Aboulmagd et al. 2000). Es existieren in einigen bakteriellen Genomen DNA-Sequenzen, die dem Cyanophycin-Synthetase-Gen cphA ähnlich sind (Krehenbrink et al. 2002, Ziegler et al. 2002). Das putative Expressions-Produkt dieser cphA´ genannten Gene ist aber teilweise verkürzt (C-terminale Verkürzung bei cphA´ aus Nitrosomonas europaea sp. ATCC 25978 und Anabaena sp. PCC 7120) oder es fehlen charakteristische Motive wie „J‑loop" (Bordetella pertussis sp. Tohama I und N. europaea) oder „P-loop" (Anabaena PCC7120). Über die Funktion von CphA´ ist noch nichts bekannt.

In Chlamydia muridarum, Chlamydophila pneumoniae CWL029 und Chlamydia trachomatis existieren Gene mit einer umgekehrten Organisation. Der N‑terminale Bereich hat Ähnlichkeit zu Mur-Ligasen, der C-terminale Bereich besitzt Ähnlichkeit zu der D-Ala:D-Ala-Ligase. Über die Funktion dieser möglicherweise bifunktionellen Proteine ist ebenfalls noch nichts bekannt.
In Übereinstimmung mit der Struktur von Cyanophycin (Abb. 2, Abschnitt 1.1.), die durch zwei chemisch verschiedene Peptidbindungen


[Seite 58↓]

charakterisiert ist, wurde im Rahmen dieser Arbeit versucht, die zwei vermuteten ATP-Bindungsstellen durch ortsgerichtete Mutagenese einzeln zu deaktivieren, um die Aktivitäten des jeweils intakten Bereichs separat studieren zu können. Ausschlaggebend für die Auswahl der Position der durch Mutationen veränderten Aminosäurereste war die durch Sequenzvergleich vorhergesagte Funktion für die ATP-Bindung (Zitate in der Tab. 10), sowie die völlig konservierte Lage innerhalb einer stark konservierten Region der verschiedenen Cyanophycin-Synthetasen (siehe Sequenzvergleich in Abschnitt 6.3.1.).
In Tabelle 10 sind die durchgeführten ortsgerichteten Mutagenesen (durchgeführt wie in Abschnitt 2.2.6.8.1. beschrieben), sowie Ergebnisse zu Funktion und intramolekularer Lage der jeweiligen vergleichbaren Aminosäurereste bei Proteinen der „ATP-grasp“-Superfamilie und der Superfamilie der Mur- und Folyl-Poly-γ-glutamat-Ligasen aufgeführt:

Tabelle 10: Punktmutationen und Lage der Aminosäurereste im aktiven Zentrum verwandter Enzyme, bei denen die räumliche Struktur aufgeklärt wurde

Mutation

Verwandte Enzyme

Vermutete Funktion

Literatur

K261G

„ATP-grasp“ Superfamilie

elektrostatische Wechselwirkungen mit den α- und β-Phosphaten, bzw. N-7 des Adenins von ADP, d.h. teilweise Neutralisierung der negativen Ladungen durch die positiv geladene Aminogruppe des γ-Lysinrestes, konserviert in mehreren Enzymen der „ATP-grasp“ Superfamilie, direkt vor dem B-loop gelegen

Fan et al. 1995&1997, Esser et al. 1998, Thoden et al. 1999, Berg et al. 2000, Sloane et al. 2001

E298A

„ATP-grasp“ Superfamilie

Wasserstoffbrückenbindung mit N6-Aminogruppe des Adenins

Fan et al. 1995, 1997, Esser et al. 1998

N392D

„ATP-grasp“ Superfamilie

über Mg2+ mit Phosphatgruppe des ATP koordiniert, teilweise konserviert in ATP-grasp-Enzymen, direkt vor dem J-loop gelegen

Fan et al. 1995, 1997, Thoden et al. 1999, Blanchard et al. 1999

K497A

Superfamilie der Mur- und Folyl-Poly-γ-glutamat-Ligasen

Teil des P-loop. Dieser Lysinrest wechselwirkt mit dem α- und β-Phosphat des ADP und könnte stabilisierend auf die Bildung eines möglichen intermediären Acylphosphats wirken. Außerdem wird aufgrund kinetischer Daten eine erhebliche Bedeutung für den katalytischen Prozess postuliert.

Toy et al. 1994, Eveland et al. 1997, Deyrup et al. 1998, Bertrand et al. 1997, 1999, Bouhss et al. 1999


[Seite 59↓]

Die mutierten Gene der Cyanophycin-Synthetase wurden auf die mit der Mutation eingeführten Endonuclease-Restriktionsschnittstellen untersucht und der mutierte Bereich sequenziert (Tab. 11).

Tabelle 11: verwendete Primer und Ergebnisse der Mutagenesen

Ortsgerichtete Mutagenese

Sequenz

K261G

Basensequenz im Wildtyp-Gen (nt 769 bis 795)

5´- CCGATTGTCATCAAGCCCCTAGATGGC -3´

verwendetes Oligonucleotid (WL 154)

5´- CCGATTGTCATCGGGCCCCTAGATGGC -3´

Ergebnis der Sequenzierung

5´- CCGATTGTCATCGGGCCCCTAGATGGC -3´

Aminosäuresequenz nativ (AS 257 bis 265)

P I V I K P L D G

Ergebnis der Sequenzierung

P I V I GP L D G

E298A

Basensequenz im Wildtyp-Gen (nt 879 bis 911)

5´- GTCAATCATTGTTGAGCGATATTACGTTGGGCG -3´

verwendetes Oligonucleotid (WL 161)

5´- GTCAATCATTGTTGCGCGCTATTACGTTGGGCG -3´

Ergebnis der Sequenzierung

5´- GTCAATCATTGTTGCGCGCTATTACGTTGGGCG -3´

Aminosäuresequenz nativ (AS 294 bis 304)

S I I V E R Y Y V G R

Ergebnis der Sequenzierung

S I I V AR Y Y V G R

N392D

Basensequenz im Wildtyp-Gen (nt 1156 bis 1188)

5´- TATTTAAGGGCAACCGCCAACCTGAGTACAGGT -3´

verwendetes Oligonucleotid (WL 162)

5´- TATTTAAGGGCAACTGCAGCCCTGAGTACAGGT -3´

Ergebnis der Sequenzierung

5´- TATTTAAGGGCAACTGCAGACCTGAGTACAGGT -3´

Aminosäuresequenz nativ (AS 386 bis 396)

Y L R A T A N L S T G

Ergebnis der Sequenzierung

Y L R A T A DL S T G

K497A

Basensequenz im Wildtyp-Gen (nt 1474 bis 1503)

5´- ACCGGCACTAACGGTAAAACCACCACTACC -3´

verwendetes Oligonucleotid (WL 153)

5´- ACCGGCACTAACGGCGCCACCACCACTACC -3´

Ergebnis der Sequenzierung

5´- ACCGGCACTAACGGCGCCACCACTACC -3´

Aminosäuresequenz nativ (AS 492 bis 501)

T G T N G K T T T T

Ergebnis der Sequenzierung

T G T N G A T T T

Sequenzänderungen sind jeweils unterstrichen

Die Mutation N392D war als N392A geplant, anscheinend hatte eine Transversion des Cytosins zu Adenin stattgefunden. Die Mutation K497A fand statt, führte jedoch


[Seite 60↓]

zu einer Verkürzung um ein Basentriplett. Möglicherweise hatte das repetitive Codon „ACC" während der Mutagenese durch falsche Bindung des Oligonucleotides an den nichtcodierenden Strang der denaturierten Plasmid-DNA-Matrize oder eine fehlerhafte Oligonucleotidsynthese diesen Fehler verursacht.
Keines der mutierten Enzyme bildete in vivo Cyanophycin. Aktivitäts-messungen unter Verwendung von radiomarkiertem Aspartat oder Arginin zeigten, dass durch die Mutationen im N-terminalen Bereich der Synthetase, d.h. bei K261G, E298A und N392D, ein Aspartateinbau nicht mehr stattfand. Die Mutation im C‑terminalen Bereich (K497A) bewirkte das Gegenteil, das Enzym K497A baut nur noch Aspartat ein (Tab. 12).

Tabelle 12: Aktivitätstest der punktmutierten Synthetasen

 

Wildtyp

K261G

E298A

N392D

K497A

 

Zählimpulse

in cpm

nin nmol

Zählimpulse

in cpm

nin nmol

Zählimpulse

in cpm

nin nmol

Zählimpulse

in cpm

nin nmol

Zählimpulse

in cpm

nin nmol

[3H]-Arg

41185

0,08

22085

0,04

21021

0,04

30233

0,06

636

0

[3H]-Asp

16107

0,04

389

0

839

0

697

0

21543

0,05

n: eingebaute Menge Aminosäure, 2 µg Synthetase pro Ansatz, jeweils Werte aus Kontrollexperi-menten (ohne ATP) abgezogen.

Die Mengen eingebauter Aminosäuren variierten zwischen den Enzymen. Ursache dafür können unterschiedliche Cyanophycinqualitäten und -mengen des bei pH 8,2 ungelöst und unhomogen suspendiert im Ansatz vorliegenden Polymers oder durch die Mutationen verursachte Wirkungen auf mehr als eine der Teilreaktionen sein (siehe Diskussion Abschnitt 4.1.). Die qualitativen Ergebnisse waren jedoch eindeutig und reproduzierbar.
In diesen Experimenten wurde nur eine der konstituierenden Aminosäuren angeboten. Mit Wildtyp-Synthetase wurde sowohl mit [³H]-Arginin allein als auch mit [³H]-Aspartat allein ein Einbau gemessen (Tab. 12). Dies bedeutet, dass offenbar bei dem aus E. coli isolierten Polymer beide Cyanophycinformen, d.h. eine mit der „stumpfen" und eine mit der „spitzen" Form, vorkommen (d.h. sowohl als Struktur analog (DR)3, d.h. als mit Arginin abgesättigtes Cyanophycin, wie auch analog der Struktur (DR)3-D, das heißt als mit Aspartat abgesättigtes Cyanophycin, dargestellt in Abb. 5). Ferner wurde zumindest für diese Cyanophycin-Synthetase (aus A. variabilis, heterolog in E. coli exprimiert) hiermit gezeigt, dass der Einbau einer Aminosäure mechanistisch nicht an die Anwesenheit der anderen konstituierenden


[Seite 61↓]

Aminosäure gekoppelt ist, was auch mittels massenspektroskopischer Messungen gezeigt werden konnte (Spektren 2 und 8, Anschnitt 6.2.).

3.8. Komplementierungsversuche mit verschieden mutierten Synthetasen

In weiteren Ansätzen wurde untersucht, ob sich verschieden mutierte Synthetasen in ihrer Funktion komplementieren können.

Abbildung 14: In vitro-Cyanophycin-Synthese mit Kombinationen verschieden mutierter Synthetasen, SDS-PAGE (15% Acrylamid)

Spur 1: Wt ohne Primer
Spur 2: Wt mit Primer
Spur 3: K261G
Spur 4: E298A
Spur 5: N392D
Spur 6: K497A
Spur 7: K261G, K497A
Spur 8: E298A, K497A
Spur 9: N392D, K497A
Spur 10: K261G, E298A, N392D, K497A
Spur 11: K261G, E298A
Spur 12: K261G, N392D
Spur 13: E298A, N392D
SDS-PAGE mit Reaktionsansätzen einer in vitro-Elongationsreaktion, 2,5 µg Synthetase pro Ansatz (Proteinbande bei ca. 100 kDa), Inkubation über Nacht. Wt: Wildtyp-Synthetase.

Bei Inkubation verschiedener Kombinationen mutierter Enzyme für eine Nacht mit Primer und vollständigem Reaktionsansatz, wurde mit einer Ausnahme (Spur 12) Cyanophycin gebildet. Interessant ist hier, dass die Enzymkombinationen in Spur 11 und 13 eine Cyanophycinbildung zeigen, obwohl alle drei in diesen Ansätzen verwendeten Enzyme K261G, E298A und N392D nach dem Sequenzvergleich aus Abbildung 13 eine Mutation innerhalb des N-terminalen Bereichs aufweisen und Aspartat nicht einbauen konnten (Tab. 12). Beiden Experimenten war gemeinsam, dass das mutierte Enzym E298A eingesetzt wurde. Die Enzymkombination K261G und N392D


[Seite 62↓]

zeigte dagegen keine Polymerbildung. Mögliche Erklärungen werden in Abschnitt 4.2. diskutiert.

3.8.1. Deletionsmutanten und separat exprimierte Bereiche

Zusätzlich zu den ortsgerichtet mutierten Synthetasen wurden die C- und N-Bereiche der Synthetase, die möglicherweise eine von dem jeweils anderen Bereich unabhängige Reaktion katalysieren (Abschnitt 3.7.), einzeln exprimiert (siehe Methoden 2.2.6.8.3.). Vom N-Bereich wurden die Aminosäuren 1 bis 447, vom C‑Bereich die Aminosäuren 429-901 exprimiert. Weiterhin wurden Deletionsmutanten erzeugt (Abschnitte 2.2.6.8.4. und 2.2.6.8.5.). Im N-Bereich wurden die Aminosäuren 233 bis 307 entfernt (ΔN), im C-Bereich wurden die Aminosäuren 482 bis 758 deletiert (ΔC). Keines der Konstrukte bildete in vivo Cyanophycin oder zeigte mit einer der verwendeten Methoden irgendeine Produktbildung oder Aktivität (Ergebnisse nicht gezeigt). Bei Inkubation von verkürzten Synthetasen mit jeweils in dem anderen Bereich verkürzten Synthetasen fand keine Komplementation einer möglicherweise verbliebenen katalytischen Funktion statt (Abb. 15).

Abbildung 15: In vivo-Elongationsansätze unter Verwendung separat exprimierter Bereiche, SDS-PAGE (15% Acrylamid)

Spur 1:Wildtyp
Spur 2:C-Bereich, N-Bereich
Spur 3:C-Bereich, Mutante N392D
Spur 4:N-Bereich, Mutante K497A
Spur 5:N392D, K497A
SDS-PAGE: 4 µg Protein pro Ansatz eingesetzt; Wildtyp, N392D, K497A: Proteinbande bei ca. 100 kDa; C-Bereich: 57 kDa; N-Bereich: 50 kDa)

Offenbar haben alle vier genannten Konstrukte ihre katalytische Aktivität verloren. Ursache könnte eine denaturierte Tertiärstruktur aufgrund fehlerhafter Faltung sein oder eine Abhängigkeit beider Reaktionen von Aminosäureresten, die in beiden Bereichen der Synthetase lokalisiert sind.


[Seite 63↓]

3.9.  Mechanismus der Cyanophycin-Synthese

Die Cyanophycin-Synthese ist ATP-abhängig. Prinzipiell sind zwei Mechanismen der ATP-abhängigen nichtribosomalen Peptidsynthese bekannt (Abschnitt 1.6.). Sequenzvergleiche zwischen sowohl dem N-terminalen als auch dem C-terminalen Bereich der Cyanophycin-Synthetase und anderen Proteinen zeigen eine Ähnlichkeit zu Ligasen zweier Superfamilien (Abb. 13 und Tab. 10), die alle ein Substrat an der Carboxylgruppe der C-terminalen Aminosäure phosphorylieren. Keine Ähnlichkeit besteht zu Enzymen, die das Substrat intermediär adenylieren. Weiterhin ist bekannt, dass während der Cyanophycin-Synthese ATP zu Pi und ADP hydrolysiert wird und nicht, wie im Falle der Adenylierungsreaktion, AMP entsteht (Ziegler et al. 1998).
Mit Hilfe von Ansätzen, die γ-[³²P]-ATP enthielten, wurde versucht, Cyanophycin zu phosphorylieren und Hinweise auf die Art der Phosphatbindung zu erhalten.

Abbildung 16: Existenz und Stabilität des phosphorylierten Cyanophycins, SDS‑PAGE (15% Acrylamid)

Spur 1: Enzym gekocht (5 min.)
Spur 2: + Hydroxylamin
Spur 3: + NaOH
Spur 4: + HCl
Spur 5: + Puffer, pH 8,2
Abb. 16A: Autoradiographie, Abb. 16B: Ausschnitt aus dem SDS-Gel (Bereich 24-32 kDa) nach Färbung mit Coomassie.
Pro Ansatz wurden 0,5 µg Synthetase eingesetzt. Versuche wurden wie in 2.2.5.4.2. beschrieben durchgeführt.

Die chemische Stabilität von Acylphosphaten ist nur bei relativ neutralen und schwach sauren pH-Werten gegeben (Duclos et al. 1991, siehe Tab. 13).

Tabelle 13: (nach Duclos et al. 1991): Chemische Stabilität verschiedener phosphorylierter Aminosäuren

Art der Phospho-aminosäure

Stabilität in:

Säure

Base

Hydroxylamin

Pyridin

O-Phosphat

Phosphoserin

+

-

+

+

Phosphothreonin

+

±

+

+

Phosphotyrosin

+

+

+

+

N-Phosphat

Phosphoarginin

-

-

-

-

Phosphohistidin

-

+

-

-

Phospholysin

-

+

-

-

Acylphosphat

Phosphoaspartat

-

-

-

-

Phosphoglutamat

-

-

-

-

S-Phosphat

Phosphocystein

+

+

+

+

Die festgestellte Instabilität des Phosphates gegenüber Säuren und Basen (Abb. 16A, Spuren 3 und 4) lässt nach dem Schema aus Tabelle 13 die Existenz eines Phosphoarginins oder eines Acylphosphates vermuten. Da eine Reaktion der Guanidinogruppe des Argininrestes ausgeschlossen werden kann (siehe Struktur von Cyanophycin, Abb. 2, Abschnitt 1.1.) bleibt als einzige plausible Deutung des Befundes aus Abb. 16A, Spur 5, dass die Radioaktivität des phosphorylierten Cyanophycins auf ein α-[³²P]- und/oder β-[³²P]-Acylphosphat des Aspartatrestes zurückzuführen ist. Da sich die Kettenverlängerung vom C-Terminus aus vollzieht, sind die α- und β-Carboxylgruppen des C-terminalen Aspartatrestes neben der α-Aminogruppe der eintretenden Aminosäure die einzigen für die Elongation des Cyanophycinmolekül mit der Struktur aus Abbildung 2 in Frage kommenden funktionalen Gruppen. Die Erfüllung der genannten Stabilitätskriterien des Acylphosphats bestätigen somit auch die mechanistische Verwandtschaft zu Enzymen der Mur-Superfamilie und der ATP-grasp-Superfamilie, bei denen eine Phosphorylierung des Substrates als Acylphosphat bekannt war.


[Seite 65↓]

Auch für die Enzyme K261G, E298A und N392D konnte die Existenz von Phospho-Cyanophycin gezeigt werden (Abb. 17). In Anwesenheit der Aminosäuresubstrate war kein Phospho-Cyanophycin mehr zu detektieren (Abb. 17, jeweils Spuren „+AS"). Interessant ist, dass bei Inkubation mit der Mutante K497A auch ohne Aminosäuresubstrate im Ansatz keine Bildung von Phospho-Cyanophycin gefunden wurde (Abb. 17, Spur „ohne Aminosäuresubstrate"), obwohl diese die Fähigkeit besitzt, Aspartat an das Cyanophycinmolekül zu knüpfen (Tab. 12).

Abbildung 17: Phosphorylierungsexperimente, SDS-PAGE (15% Acrylamid)
A: Autoradiographie; B: Acrylamidgel, mit Coomassie gefärbt

Phosphorylierung und Dephosphorylierung von Cyanophycin unter Verwendung von Wildtyp-Synthetase und den mutierten Synthetasen. A zeigt eine Autoradiographie, B zeigt das mit Coomassie gefärbte Gel. Jeweils 0,5 µg Synthetase eingesetzt (Proteinbande bei ca. 100 kDa).
- AS: Inkubation ohne Aminosäuresubstrate
+ AS: Inkubation mit Aminosäuresubstraten
deakt.: Enzym deaktiviert (100°C, 5 min)

Im Folgenden werden denkbare Gründe für das unterschiedliche Verhalten der Mutante K497A, bzw. die in diesem Falle fehlende Phosphorylierung des „stumpfen“, d.h. mit Arginin abgesättigten Cyanophycins unter Synthese- und Elektrophoresebedingungen andiskutiert und anschließend daraus abgeleitete Untersuchungen dokumentiert.


[Seite 66↓]

3.9.1.  Hypothese 1: Die α-Carboxylgruppe der Cyanophycin-Präparation liegt immer phosphoryliert vor

Um eine denkbare bereits in der Cyanophycinpräparation vorliegende Phosphorylierung auszuschließen, wurde das Cyanophycin zusätzlich zu der regulären Extraktion mit 0,1 M HCl jeweils alkalisch behandelt (40°C, 2,5 h, pH 10). Ausgehend von der Information über die Instabilität von Acylphosphaten (Duclos et al. 1991) bei hohen wie niedrigen pH-Werten (Tab. 13) wurde angenommen, dass so dieses mögliche Problem beseitigt werden könnte.
Es konnte mit keinem der Proteine eine stärkere Phosphorylierung erreicht werden (Ergebnisse nicht gezeigt), die Aktivität als Substrat für den Einbau der Aminosäuren Aspartat bzw. Arginin blieb aber erhalten (Abb. 18).

3.9.2. Hypothese 2: Der Anteil des „stumpfen" Cyanophycins, d.h. des Cyanophycins ohne überhängenden Aspartatrest, ist relativ gering

Um die Frage des Anteils „spitzer“ oder „stumpfer“ Cyanophycinqualitäten zu untersuchen, wurde mit nur einer der konstituierenden Aminosäuren bzw. in einem Kontrollexperiment ohne Aminosäuren vorinkubiert. (Reaktion über Nacht bei Raumtemperatur und Synthesebedingungen, siehe 2.2.5.2., im Thermomixer geschüttelt).
Das mit Aspartat vorbehandelte „spitze" Cyanophycin zeigt mit beiden separat angebotenen [³H]-markierten Aminosäuren erhöhte Einbauraten. Die Eigenschaften dieses Materials haben sich offenbar während der Inkubation mit Aspartat oder der anschließenden Prozedur (mehrfache Säurextraktion und alkalische Behandlung, siehe 2.2.5.4.1.) verändert. Eine Vorinkubation mit Arginin bewirkte hauptsächlich eine relativ höhere Einbaurate für [³H]-Aspartat (Abb. 18).


[Seite 67↓]

Abbildung 18: Relative Menge eingebauter Aminosäuren nach Vorbehandlung des Cyanophycins unter verschiedenen Bedingungen

„nativ“: Cyanophycin wurde ohne Aminosäuren vorinkubiert
„spitz“: Cyanophycin wurde mit Aspartat vorinkubiert
„stumpf“: Cyanophycin wurde mit Arginin vorinkubiertDie Konzentrationen des Cyanophycins in den jeweiligen Ansätzen waren nach Vorinkubation möglicherweise geringer als 0,87 mg/ml (vgl. Abschnitt 2.2.5.1.). Zwar wurden definierte Mengen Cyanophycin eingesetzt, doch es ist unklar, wieviel davon nach der Vorbehandlung extrahiert werden konnte. Vereinfachend wurde eine vollständige Ausbeute eingesetzten Cyanophycins angenommen.

Das vorbehandelte und dadurch offenbar veränderte Cyanophycin wurde für weitere Phosphorylierungsexperimente verwendet. Sowohl „natives" als auch „spitzes" Cyanophycin kann phosphoryliert werden (Abb. 19, Spur 2, Spur 12). Die Anwesenheit von 0,2 mM Arginin im Ansatz bewirkte, dass kein Phospho-Cyanophycin mehr detektiert wurde (Abb. 19, Spur 4, Spur 14). Eine Phosphorylierung des „stumpfen" Cyanophycins war nicht nachweisbar.
Die Phosphorylierung von „nativem" Cyanophycin ist bei Anwesenheit von 4 mM Aspartat weit geringer (Spur 3). Auf „spitzes“ Cyanophycin hat Aspartat keine starke die Phosphorylierung beeinflussende Wirkung (Spur 13).


[Seite 68↓]

Abbildung 19: Phosphorylierung vorbehandelten Cyanophycins. SDS-PAGE (15% Acrylamid)

Spur 1, 6, 11: ohne Enzym
Spur 2, 7, 12: ohne Aminosäuren
Spur 3, 8, 13: + Asp
Spur 4, 9, 14: + Arg
Spur 5, 10, 15: + Asp, + Arg
Phosphorylierungsversuche unter Verwendung von mit Aminosäuresubstraten vorbehandelten Cyanophycins. Obere Abbildungen zeigen Autoradiographien nach SDS-PAGE, untere zeigen die gleichen Gele nach Färbung mit Coomassie, [ATP] = 1µM. Es wurde jeweils 0,5 µg Synthetase pro Ansatz eingesetzt.

Der Befund, dass bei Inkubation mit Wildtyp-Cyanophycin-Synthetase kein „stumpfes" Phospho-Cyanophycin nachgewiesen werden konnte, sowie das Ergebnis, dass das Enzym K497A, das „stumpfes" Cyanophycin als Substrat benötigt, keine Bildung von Phospho-Cyanophycin zeigte, lässt mich vermuten, dass sämtliche Schwärzungen der gezeigten Autoradiographien ausschließlich auf eine radioaktive Phosphorylierung der β-Carboxylgruppe zurückzuführen sind.

3.9.3. Hypothese 3: Cyanophycin-Synthetase katalysiert eine schnelle Dephosphorylierung des α-Acylphosphates

Um das Problem einer denkbaren schnellen Rückreaktion zu reduzieren, wurde der Versuch der Phosphorylierung durch das mutierte Protein K497A in Anwesenheit von


[Seite 69↓]

Creatinphosphokinase (10 units, ein unit steht für eine Menge Phosphocreatinkinase, die 1,0 µmol Phosphat von Phosphocreatin auf ADP überträgt, eine Minute Reaktionszeit; pH 7,4; 30°C) und einem Überschuss an Phosphocreatin (c=100 mM) wiederholt. Auf diesem Wege sollte entstehendes ADP schnell aus dem Ansatz entfernt werden.

Abbildung 20: Zusätzlich eingeführte Reaktion zur Beseitigung von entstehendem ADP

Die Zugabe einer großen Menge Phosphocreatin und Kinase hatte keinen Einfluß auf die Aktivität der Cyanophycin-Synthetase ([³H]-Arg bzw. [³H]-Arg+Asp Messungen, Ergebnisse nicht gezeigt). Eine Veränderung der Phosphorylierungseigenschaften alkalibehandelten Cyanophycins wurde aber nicht festgestellt (Ergebnisse nicht gezeigt). Eine Falsifizierung dieser Hypothese kann aber mit Hilfe dieses Versuches nicht erreicht werden, weil es möglich ist, dass ADP auch nach der Bildung des α-Acylphosphates vom Enzym gebunden bleibt und somit nicht für die Kinase zugänglich ist.

3.9.4. Hypothese 4: Die Phosphorylierung der α-Carboxylgruppe ist mechanistisch an die Bindung eines Aspartatrestes gekoppelt.

Diese meiner Meinung nach einzige plausible Interpretation der Ergebnisse wird in Abschnitt 4.1.2.2. diskutiert. Kinetische Untersuchungen, die diese These stützen oder falsifizieren könnten, wurden nicht durchgeführt. Vergleichende Röntgen-Kristallstrukturuntersuchungen von Kristallen der Cyanophycin-Synthtase ohne und


[Seite 70↓]

mit gebundenen Substraten sind nicht möglich - es gibt bis heute keine geeigneten Kristalle einer Cyanophycin-Synthetase.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
03.11.2003