El Fari, Mustafa: Untersuchungen zur Taxonomie und Phylogenie der Familie Arthrodermataceae (Dermatophyten) und Entwicklung einer spezifischen Sonde für Trichophyton rubrum.

Anhang A.

                                            SR6R                       SSU              harr           ITS 1
01- Trichophyton tonsurans           AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
02- Trichophyton t. var. epilans     AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTCCGGAAGGATCATTAACGCGCAGGCGGAGGCTGG-CCCCCAGG 
03- Trichophyton t. var. cratriforme AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCATGCGGAGGCTGGCCCCCCAGG 
04- Trichophyton t. var. sulfureum   AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
05- J1                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
06- A2                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
07- A4                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
08- A5                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
09- J3                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
10- J4                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
11- J5                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
12- J7                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
13- J8                               AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCGGAGGCTGGCCCCCCAGG 
                                                                                                                       ITS 1
01-  ATAGGGCCAAACGTCCGTCA-GGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
02-  ATAGGGCCAAACGTCCGTCA-GGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
03-  ATAGG-CCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
04-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
05-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
06-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
07-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
08-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
09-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
10-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
11-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
12-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
13-  ATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGT 
ITS 1 
01-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
02-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
03-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
04-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
05-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
06-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
07-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
08-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
09-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
10-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
11-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
12-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCNNGCAAAA 
13-  TCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAA 
      ITS 1   harr          5.8S                     5.8S/5.8SR
01-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
02-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
03-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
04-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
05-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
06-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
07-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
08-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
09-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
10-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
11-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
12-  ATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
13-  ATCANNTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTG 
                                      5.8S                 harr                        ITS 2
01-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
02-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
03-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
04-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
05-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
06-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
07-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
08-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
09-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
10-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
11-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
12-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
13-  AACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGG
                                                                                                    ITS 2
01-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
02-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
03-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAAATCTG
04-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
05-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
06-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
07-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
08-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
09-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
10-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
11-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
12-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
13-  GGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTC-AAAATCTG
        ITS 2        harr                   LSU                                     LR1        
01-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
02   TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
03-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
04-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
05-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
06-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
07-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
08-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
09-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
10-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
11-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
12-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC
13-  TTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACC

Alignment 1: Sequenzvergleich zwischen einigen der klinischen Trichophyton tonsurans-Isolate mit CBS-Stämmen von Trichophyton tonsurans und seinen Varianten.

Speziesname / Labornummer           1      SR6R                     SSU                 50
T. m. var. goetzii 17                AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. m. var. interdigitale 22          AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. vanbreuseghemii 72                AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. m. var. nodulare 18               AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. tonsurans var. epilans 40         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. tonsurans 39                      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. tonsurans 4                       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. tonsurans var. crateriforme 41    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. tonsurans var. sulfureum 62       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. simii   48                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG .TGAAC.TGC .GGAAGGATC 
A. simii   43                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG .TGAAC.TGC .GGAAGGATC 
A. simii   47                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG .TGAAC.TGC .GGAAGGATC 
T. m. var. mentagrophytes 20         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. m. var. quinckeanum 19            AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T.schoenleinii 2                     AAGTAAAA.G TCGTA.CAAG GTTTCCGTAG GTGAACCTGC .GGA.GGATC 
T.schoenleinii 38                    AAGTAAAA.G TCGTA.CAAG GTTTCCGTAG GTGAACCTGC .GGA.GGATC 
A. benhamiae 71                      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. benhamiae 86                      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. concentricum 66                   AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. concentricum 73                   AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. verruco. var. verrucosum 61       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. verruco. var. verrucosum 6        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. verruco. var. verrucosum 64       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. m. var. erinacae 15               AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. m. var. erinacei 68               AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. m. var. granulosum 16             AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. rubrum 37                         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. rubrum var. granulare 78          AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. megninii 10                       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. fischeri 76                       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. kanei  65                         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
M. gypseum var. gypseum 12           AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. incurvatum 29                     AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.T.C .CGAAGGATC 
A. fulvum 30                         AAGTAAAA.G TCGTAATAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. fulvum 57                         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
M. persicolor 54                     AAGTAAAA.G TCGTAACAAG .TTT.CCTAG GTGAAC.T.C .GGAAGGATC 
A. persicolor 53                     AAGTAAAA.G TCGTAACAAG .TTT.CCTAG GTGAAC.T.C .GGAAGGATC 
E. floccosum  74                     AAGTAAAA.G TCGTA.CAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
E. floccosum  75                     AAGTAAAA.G TCGTA.CAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
E. floccosum  14                     AAGTAAAA.G TCGTA.CAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
T. ajelloi var. nanum 82             AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. ajelloi 49                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. uncinatum 50                      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. vanbreuseghemii 26                AAGTAAA..G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. insingulare 27                    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. equinum var. equinum 44           AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .G.AAGGATC 
T. equinum var. autotrophicum 85     AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. equinum var. autotrophicum 67     AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC
E. stockdaleae 31                    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. terrestre 8                       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. quafrifidum 24                    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
T. gloriae 89                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
A. cuniculi 25                       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACTCGG ....AAGATC 
Chrysosporum keratinophilum 83       AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
Arachniotus ruber 84                 AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. gallinae 32                       AAGTAAAAAG TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. grubyi 56                         AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. vanbreuseghemii 55                AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. cajetani (M. cookei)87            AAGTAAAA.. GCGTAACAAG GTTTCCGTAG TGAACC.TGC .GGAAGGATC 
M. audouinii 34                      AAGTAAAA.G TCGTAACAAG .TTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. audouinii 13                      AAGTAAAA.G TCGTAACAAG .TTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. audouinii var. langeronii 59      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. audouinii var. rivalierii 58      AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. ferrugineum 79                    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. ferrugineum 77                    AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAACCTGC .GGAAGGATC 
M. canis 33                          AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. canis 69                          AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
A. otae 51                           AAGTAAAA.G TCGTAACAAG .TTTCCGTA. GTGAAC.TGC .G..AAGATC 
A. otae 52                           AAGTAAAA.G TCGTAACAAG .TTTCCGTA. GTGAAC.TGC .G..AAGATC 
M. canis var. distortum 70           AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 
M. equinum 60                        AAGTAAAA.G TCGTAACAAG GTTTCCGTAG GTGAAC.TGC .GGAAGGATC 



Speziesname / Labornummer            51 harr                    ITS 1                     100
T. m. var. goetzii 17                ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T. m. var. interdigitale 22          ATTAGCGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
A. vanbreuseghemii 72                ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T. m. var. nodulare 18               ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T. tonsurans var. epilans 40         ATTAACGCGC AGCC...GGA GG....CCGG CCCCC.A... GGATAGGGCC 
T. tonsurans 39                      ATTAACGCGC AGGC...GGA GG....CTGG CCCCCCA... GGATAGGGCC 
T. tonsurans 4                       ATTAACGCGC AGGC...GGA GG....CTGG CCCCCCA... GGATAGGGCC 
T. tonsurans var. crateriforme 41    ATTAACGCGC ATGC...GGA GG....CCGG CCCCCCA... GGATAGG.CC 
T. tonsurans var. sulfureum 62       ATTAACGCGC AGCC...GGA GG....CCGG CCCCCCA... GGATAGGGCC 
T. simii   48                        ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
A. simii   43                        ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
A. simii   47                        ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T. m. var. mentagrophytes 20         ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T. m. var. quinckeanum 19            ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGCC 
T.schoenleinii 2                     ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGG.CC 
T.schoenleinii 38                    ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGG.CC 
A. benhamiae 71                      ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGAAT 
A. benhamiae 86                      ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGAAT 
T. concentricum 66                   ATTAACGCGC AGGCC..GGA GG....CTGC CCCCCCA... CGATAGGAAT 
T. concentricum 73                   ATTAACGCGC AGGCC..GGA GG....CTGC CCCCCCA... CGATAGGAAT 
T. verruco. var. verrucosum 61       ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAT 
T. verruco. var. verrucosum 6        ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAT 
T. verruco. var. verrucosum 64       ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAT 
T. m. var. erinacae 15               ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAT 
T. m. var. erinacae 68               ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAT 
T. m. var. granulosum 16             ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
T. rubrum 37                         ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
T. rubrum var. granulare 78          ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
T. megninii 10                       ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
T. fischeri 76                       ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
T. kanei  65                         ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... CGATAGGGAC 
M. gypseum var. gypseum 12           ATTAACGCGC AGGCC..GTT GAAGGCGCGC CGCGG.A... ..CCCCAGGT 
A. incurvatum 29                     ATTAACGCGC AGGCC..GTT GAAGGCGCGC CCGGA.C... ..CCCCAGGT 
A. fulvum 30                         ATTAACGCGC AGGC...GCA GACGGCGCGC CC........ ..CCGGATGC 
M. fulvum 57                         ATTAACGCGC AGCC...GCA GACGGCCCGC CC........ ..CCGGATGC 
M. persicolor 54                     ATTAACGCGC GACCGC.AGT ATCGACCCTC CC....C... ..CGGGCTCT 
A. persicolor 53                     ATTAACGCGC GACCGC.AGT ATCGACCCTC CC....C... ..CGGGCTCT 
E. floccosum  74                     ATTAACCCGC AGGCC..GCA GTCGGCCCGT CCCCCTT... ..CTCTCTGA 
E. floccosum  75                     ATTAACCCGC AGGCC..GCA GTCGGCCCGT CCCCCTT... ..CTCTCTGA 
E. floccosum  14                     ATTAACCCGC AGGCC..GCA GTCGGCCCGT CCCCCTT... ..CTCTCTGA 
T. ajelloi var. nanum 82             ATTAAAGCGC CGCCGACGTC GA..CCCCGG CCGCCCG... G.CTTGAGAT 
T. ajelloi 49                        ATTAAAGCGC CGCCGACGTC GA..CCCCGG CCGCCCG... G.CTTGAGAT 
A. uncinatum 50                      ATTAAAGCGC CGCCGACGTC GA..CCCCGG CCGCCCG... G.CTTGAGAT 
T. vanbreuseghemii 26                ATTAAAGCGC CGCCGACGTC GA..CCCCAA CCACCTG... G.CTTGA.AT 
A. insingulare 27                    ATTAAA.CTT CGCCGTCGCA GATACACCGC CCGTCCG... GGCTTGAGAC 
T. equinum var. equinum 44           ATTAAAGCGA CGCCGACGTC GA..CCCCGG CCGCCCG... G.CTTGAGAT 
T. equinum var. autotrophicum 85     ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... GGATAGGGCC 
T. equinum var. autotrophicum 67     ATTAACGCGC AGGCC..GGA GG....CTGG CCCCCCA... GGATAGGGCC
E. stockdaleae 31                    ATTAAAGCGC CGCCGACGTC GA..CCCCGG CCGCCCG... G.CTTGAGAT 
T. terrestre 8                       ATTAAAGCGT TGCCGACGTC GG..CCCCGG CCGTTCG... G.CTTGAAAT 
A. quafrifidum 24                    ATTAAAGCGT TGCCGACGTC GG..CCCCGG CCGTTCG... G.CTTGAAAT 
T. gloriae 89                        ATTAAAGCGC CGCCGACGCC GG..CCCCGG CCGCCCGTGG GACTTGAGAC 
A. cuniculi 25                       ATTAAAGCGT TGCCGACGTC GG..CCCCCG CCGCCCG... GGCTTGAAAC 
Chrysosporum keratinophilum 83       ATTAAAGTGT TTCGGAGCCT GG...TATGG GCATCTC... GACTCGA... 
Arachniotus ruber 84                 ATTACAGTGT CT........ GG....CTGG GCGTCCC... ......C... 
M. gallinae 32                       ATTAACGCGC A..GG.CCGA CGTTGGCCC. .......... .......... 
A. grubyi 56                         ATTAACGCGC A..GG.CCGA CGTTGGCCC. .......... .......... 
M. vanbreuseghemii 55                ATTAACGCGC A..GG.CCGA CGTTGGCCC. .......... .......... 
A. cajetani (M. cookei)87            ATTAACGCGT A..GG.CCGC TGCCTGGCTA C......C.. .CATGCCTCC 
M. audouinii 34                      ATTAACGCGC AAGAG.TCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. audouinii 13                      ATTAACGCGC AAGAG.TCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. audouinii var. langeronii 59      ATTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. audouinii var. rivalierii 58      .TTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. ferrugineum 79                    AT.AACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. ferrugineum 77                    ATTAACGCGC AAGAGTTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. canis 33                          ATTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. canis 69                          ATTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
A. otae 51                           ATTAACGCGC A.GAG.TCGA AGGTGGCCCC CGAAGCTCTT CCGTCTCCCC 
A. otae 52                           ATTAACGCGC A.GAG.TCGA AGGTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. canis var. distortum 70           ATTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
M. equinum 60                        ATTAACGCGC AAGAGGTCGA AGTTGGCCCC CGAAGCTCTT CCGTCTCCCC 
                                                     ********* ******* Indel 1****** **********



Speziesname / Labornummer            101                      ITS 1                     150
T. m. var. goetzii 17                AAACGT.CCG TCAGGG.... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. m. var. interdigitale 22          AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
A. vanbreuseghemii 72                AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. m. var. nodulare 18               AAACGT.CCG TCAGGG.... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. tonsurans var. epilans 40         AAACGT.CCG TCAGGG.... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. tonsurans 39                      AAACGT.CCG TCAGGG.... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. tonsurans 4                       AAACGT.CCG TCAGGG.... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. tonsurans var. crateriforme 41    AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. tonsurans var. sulfureum 62       AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. simii   48                        AAACGT.CCA TCGGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
A. simii   43                        AAACGT.CCA TCGGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
A. simii   47                        AAACGT.CCA TCGGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. m. var. mentagrophytes 20         AAACGT.CCA TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T. m. var. quinckeanum 19            AAACGT.CCA TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T.schoenleinii 2                     AAACGT.CCA TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
T.schoenleinii 38                    AAACGT.CCA TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG 
A. benhamiae 71                      CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
A. benhamiae 86                      CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. concentricum 66                   CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGTCTTACG. 
T. concentricum 73                   CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGTCTTACG. 
T. verruco. var. verrucosum 61       CAGCGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. verruco. var. verrucosum 6        CAGCGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. verruco. var. verrucosum 64       CAGCGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. m. var. erinacae 15               CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. m. var. erinacae 68               CAACGTTCCA TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. m. var. granulosum 16             CAACGTTCCG TCAGGGG... ....TGTGCA GATGTGCGCC GGCCTTACG. 
T. rubrum 37                         CGACGTTCCA TCAGGGG... ....TGAGCA GACGTGCGCC GGCCGTACG. 
T. rubrum var. granulare 78          CGACGTTCCA TCAGGGG... ....TGAGCA GACGTGCGCC GGCCGTACG. 
T. megninii 10                       CGACGTTCCA TCAGGGG... ....TGAGCA GACGTGCGCC GGCCGTACGG 
T. fischeri 76                       CGACGTTCCA TCAGGGG... ....TGAGCA GACGTGCGCC GGCCGTACG. 
T. kanei  65                         CGACGTTCCA TCAGGGG... ....TGAGCA GACGTGCGCC GGCCGTACG. 
M. gypseum var. gypseum 12           CC........ .......... .......GCC GTGCAGTGCC GCCGGCCACA 
A. incurvatum 29                     CC........ .......... .......GCC GTGCAGTGCC GCCGGCCACA 
A. fulvum 30                         GT........ .......... .......CCG AGGCGGTGCC GCCGGCCACA 
M. fulvum 57                         GT........ .......... .......CCG AGGCGGTGCC GCCGGCCACA 
M. persicolor 54                     TC........ .......... .......CGG GGGAGGTGGC GCCGGCCACA 
A. persicolor 53                     TC........ .......... .......CGG GGGAGGTGGC GCCGGCCACA 
E. floccosum  74                     AT........ .......... .......GCT GGACGTTGTC GCCGGCCACA 
E. floccosum  75                     AT........ .......... .......GCT GGACGTTGTC GCCGGCCACA 
E. floccosum  14                     AT........ .......... .......GCT GGACGTTGTC GCCGGCCACA 
T. ajelloi var. nanum 82             ATA.G..... CCCGGG.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
T. ajelloi 49                        ATA.G..... CCCGGG.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
A. uncinatum 50                      ATA.G..... CCCGGG.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
T. vanbreuseghemii 26                ATA.G..... TCTAGG.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
A. insingulare 27                    ACA.G..... CCCGGG.... .....CGGTA CGGATGCGTC GCCGGCGTTC 
T. equinum var. equinum 44           ATA.G..... CCCGGG.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
T. equinum var. autotrophicum 85     AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GCCCGTACCG 
T. equinum var. autotrophicum 67     AAACGT.CCG TCAGGGG... ....TGAGCA GATGTGCGCC GGCCGTACCG
E. stockdaleae 31                    ATA.G..... CCCGGA.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
T. terrestre 8                       ATA.G..... CCTGGA.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
A. quafrifidum 24                    ATA.G..... CCTGGA.... .....CGGTG CTGGAG.GTC GCCGGCAGTT 
T. gloriae 89                        ATA.GT.TCC CCCGGAC... ....GGCGTC CAGGAG.GCC GCCGGCAGTA 
A. cuniculi 25                       ACA.G..... CCCGGAG... ....CTGGCG CTGGAG.GCC GCCGGCAGTT 
Chrysosporum keratinophilum 83       .......... .......... ......GGTG TCGGTG.... .CCAGCGCC. 
Arachniotus ruber 84                 .......... .......... ........TA GGGGT....C GCCCGCTACT 
M. gallinae 32                       ......TCTC CCCGAG.... ......AAGG GGGGGGA.AC TCCGGCCACA 
A. grubyi 56                         ......TCTC CCCGAG.... ......AAGG GGGGGGGGAC TCCGGCCACA 
M. vanbreuseghemii 55                ......TCTC CCCGAG.... ......AAGG GGGGGGGGAC TCCGGCCACA 
A. cajetani (M. cookei)87            TC.CGGTCTC CCGGGGG..T C....GAAGC GGGGTACGCC GCCGGCCACA 
M. audouinii 34                      CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
M. audouinii 13                      CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
M. audouinii var. langeronii 59      CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
M. audouinii var. rivalierii 58      CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
M. ferrugineum 79                    CCCGGGC.TC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCT CCGG.CCGCA 
M. ferrugineum 77                    CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCT CCGG.CCGCA 
M. canis 33                          CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGT.CC TCCGGCCGCA 
M. canis 69                          CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGT.CC TCCGGCCGCA 
A. otae 51                           CC.GGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
A. otae 52                           CC.GGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCC TCCGGCCGCA 
M. canis var. distortum 70           CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGGTCC TCCGGCCGCA 
M. equinum 60                        CCCGGGCCTC CCGGGGAGGT TGCGGGCGGC GAGGGGTGCT CCGGGCCGCA 
                                     ******** Indel 1 **** *******hArr* ******** Indel 2 ****



Speziesname / Labornummer            151                      ITS 1                     200
var. goetzii 17                      .....CCCCA TTCTTGTCTA CAT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. interdigitale 22                .....CCCCA TTCTTGTCTA CAT.TACTCG GTTGCCTCGG CGGGCCGCG. 
vanbreuseghemii 72                   .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. nodulare 18                     .....CCCCA TTCTTGTCTA CAT.TACTCG GTTGCCTCGG CGGGCCGCG. 
tonsurans var. epilans 40            .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
tonsurans 39                         .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
tonsurans 4                          .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
tonsurans var. crateriforme 41       .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
tonsurans var. sulfureum 62          .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
simii   48                           .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
simii   43                           .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
simii   47                           .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. mentagrophytes 20               .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. quinckeanum 19                  .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
T.schoenleinii 2                     .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
T.schoenleinii 38                    .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
benhamiae 71                         .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
benhamiae 86                         .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
concentricum 66                      .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
concentricum 73                      .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
verruco. var. verrucosum 61          .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
verruco. var. verrucosum 6           .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
verruco. var. verrucosum 64          .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. erinacae 15                     .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. erinacae 68                     .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
var. granulosum 16                   .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
rubrum 37                            ....CCCCCA TTCTTGTCTA CCT.CACCCG GTTGCCTCGG CGGGCCGCG. 
rubrum var. granulare 78             ....CCCCCA TTCTTGTCTA CCT.CACCCG GTTGCCTCGG CGGGCCGCG. 
megninii 10                          ....CCCCCA TTCTTGTCTA CCT.CACCCG GTTGCCTCGG CGGGCCGCG. 
fischeri 76                          ....CCCCCA TTCTTGTCTA CCT.CACCCG GTTGCCTCGG CGGGCCGCG. 
kanei  65                            ....CCCCCA TTCTTGTCTA CCT.CACCCG GTTGCCTCGG CGGGCCGCG. 
gypseum var. gypseum 12              ....CGCCCA TTCTTGTCTA C.T.TACCCA GTTGCCTCGG CGGGCCTCGC 
incurvatum 29                        ....CGCCCA TTCTTGTCTA C.C.CACCCA GTTGCCTCG. CGGGCCGCGC 
fulvum 30                            ....CGCCCA TTCTTGTCTA T.C.TACCTG GTTGCCTCGG CGGGCCGCGC 
fulvum 57                            ....CGCCCA TTCTTGTCTA T.C.TACCTG GTTGCCTCGG CGGGCCGCGC 
persicolor 54                        ....CGCCCA TTCTTGTCTA T.C.TACCTG GTTGCCTCGG CGGACCGCGC 
persicolor 53                        ....CGCCCA TTCTTGTCTA T.C.TACCTG GTTGCCTCGG CGGACCGCGC 
floccosum  74                        ....CGCCCA TTCTTGTCTA CAC.TACCCG GTTGCCTCGG CGGGCCGCCC 
floccosum  75                        ....CGCCCA TTCTTGTCTA CAC.TACCCG GTTGCCTCGG CGGGCCGCCC 
floccosum  14                        ....CGCCCA TTCTTGTCTA CAC.TACCCG GTTGCCTCGG CGGGCCGCCC 
ajelloi var. nanum 82                .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
ajelloi 49                           .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
uncinatum 50                         .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
vanbreuseghemii 26                   .....GCCCA TTCTTGTCTA CTA..ACCCA GTTGCCTCGG TGTGCCG... 
insingulare 27                       .....GCCCA TTCTTGCCTA CTG..ACCCA GTTGCCTCGG CGTGCCG... 
equinum var. equinum 44              .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
equinum var. autotrophicum 85        .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG. 
equinum var. autotrophicum 67        .....CCCCA TTCTTGTCTA CCT.TACTCG GTTGCCTCGG CGGGCCGCG.
stockdaleae 31                       .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
terrestre 8                          .....GCCCA TTCTTGCCTA CTG..ACCCA GTTGCCTCGG CGAGCC.... 
quafrifidum 24                       .....GCCCA TTCTTGCCTA CTG..ACCCA GTTGCCTCGG CGAGCCG... 
gloriae 89                           .....GCCCA TTCTTGTCTA CCTCTACCAG GTTGCCTCGG CGGGCCG... 
cuniculi 25                          .....GCCCA TTCTTGTCTA CTG..ACCCA GTTGCCTCGG CGCGCCG... 
Chrysosporum keratinophilum 83       ......CCCA CACGTGTTTA CTC.AACTTG GTTGCCTTGG TGAGCC.... 
Arachniotus ruber 84                 .....GACCA CCCTTGCCTA CCTAACCACT GTTGCTTCGG CAGGCCCGC. 
gallinae 32                          ....CGCCCA TTCTTGTCTA CCG..ACCCA GTTGCCTCGG CGG....... 
grubyi 56                            ....CGCCCA TTCTTGTCTA CCG..ACCCA GTTGCCTCGG CGG....... 
vanbreuseghemii 55                   ....CGCCCA TTCTTGTCTA CCG..ACCCA GTTGCCTCGG CGG....... 
cajetani (M. cookei)87               AAATCGCCCA TTCTTGTCTA TCT..ACCCG GTTGCCTCGG CGGTGC.CGC 
audouinii 34                         ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
audouinii 13                         ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
audouinii var. langeronii 59         ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
audouinii var. rivalierii 58         ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
ferrugineum 79                       ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
ferrugineum 77                       ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
canis 33                             ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
canis 69                             ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
otae 51                              ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
otae 52                              ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
canis var. distortum 70              ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
equinum 60                           ....CGCCCA TTCTTGTCTA CTG..ACCCG GTTGCCTCGG CGGGCCGCGC 
                                     ***** Indel 2 ************ hArr*** ******** Indel 3 **** 



Speziesname / Labornummer            201                      ITS 1                     250
T. m. var. goetzii 17                .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. m. var. interdigitale 22          .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
A. vanbreuseghemii 72                .CT....... .......... ...CTCTC.. ...AGGAGAG CCGTTCGGCG 
T. m. var. nodulare 18               .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. tonsurans var. epilans 40         .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. tonsurans 39                      .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. tonsurans 4                       .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. tonsurans var. crateriforme 41    .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. tonsurans var. sulfureum 62       .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. simii   48                        .CT....... .......... ...CTCTCCC ...AGGAGAG CCGTTCGGCG 
A. simii   43                        .CT....... .......... ...CTCTCCC ...AGGAGAG CCGTTCGGCG 
A. simii   47                        .CT....... .......... ...CTCTCCC ...AGGAGAG CCGTTCGGCG 
T. m. var. mentagrophytes 20         .CT....... .......... ...CTCTCTC ...AGGAGAG CCGTTCGGCG 
T. m. var. quinckeanum 19            .CT....... .......... ...CTCTCTC ...AGGAGAG CCGTTCGGCG 
T.schoenleinii 2                     .CT....... .......... ...CTCTCTC ...AGGAGAG CCGTTCGGCG 
T.schoenleinii 38                    .CT....... .......... ...CTCTCTC ...AGGAGAG CCGTTCGGCG 
A. benhamiae 71                      .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
A. benhamiae 86                      .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. concentricum 66                   .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. concentricum 73                   .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. verruco. var. verrucosum 61       .CT....... .......... ...CTCCC.. ...CGGAGAG TCGTCCGGCG 
T. verruco. var. verrucosum 6        .CT....... .......... ...CTCCC.. ...CGGAGAG TCGTCCGGCG 
T. verruco. var. verrucosum 64       .CT....... .......... ...CTCCC.. ...CGGAGAG TCGTCCGGCG 
T. m. var. erinacae 15               .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. m. var. erinacae 68               .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. m. var. granulosum 16             .CT....... .......... ...CTCCT.. ...GGGAGAG TCGTCCGGCG 
T. rubrum 37                         .CT....... .......... ...CCCCCTG CCAGGGAGAG CCGTCCGGCG 
T. rubrum var. granulare 78          .CT....... .......... ...CCCCCTG CCAGGGAGAG CCGTCCGGCG 
T. megninii 10                       .CT....... .......... ...CCCCCTG CCAGAGAGAG CCGTCCGGCG 
T. fischeri 76                       .CT....... .......... ...CCCCCTG CCAGGGAGAG CCGTCCGGCG 
T. kanei  65                         .CT....... .......... ...CCCCCTG CCAGGGAGAG CCGTCCGGCG 
M. gypseum var. gypseum 12           GCC....... .......... ...CGC.... .......... .......... 
A. incurvatum 29                     GCC....... .......... ...CGC.... .......... .......... 
A. fulvum 30                         ACT....... .......... ...CGTG... .......CCG CCCGGGGATG 
M. fulvum 57                         ACT....... .......... ...CGTG... .......CCG CCCGGGGATG 
M. persicolor 54                     CCCT...... ........CG TGCCGCGTCT CGAGGAGCCG TTCGGGGGGG 
A. persicolor 53                     CCCT...... ........CG TGCCGCGTCT CGAGGAGCCG TTCGGGGGGG 
E. floccosum  74                     CCTAGGCTGC AGTGTCGCTG CAGCGTCTCG GGGGGGCCGT TCGGGGGATG 
E. floccosum  75                     CCTAGGCTGC AGTGTCGCTG CAGCGTCTCG GGGGGGCCGT TCGGGGGATG 
E. floccosum  14                     CCTAGGCTGC AGTGTCGCTG CAGCGTCTCG GGGGGGCCGT TCGGGGGATG 
T. ajelloi var. nanum 82             .CT....... .......... ...CCC.TAG TGGACGGTCG GAGGCC..CT 
T. ajelloi 49                        .CT....... .......... ...CCC.TAG TGGACGGTCG GAGGCC..CT 
A. uncinatum 50                      .CT....... .......... ...CCC.TAG TGGACGGTCG GAGGCC..CT 
T. vanbreuseghemii 26                .TT....... .......... ...CC..TAG CGGACGGTCG GAAGCC..CT 
A. insingulare 27                    .TT....... .......... ...CCC.CAG TGGACGACCG GAAGCC..TT 
T. equinum var. equinum 44           .CT....... .......... ...CCC.TAG TGGACGGTCG GAGGCC..CT 
T. equinum var. autotrophicum 85     .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG 
T. equinum var. autotrophicum 67     .CT....... .......... ...CTCCC.. ...AGGAGAG CCGTTCGGCG
E. stockdaleae 31                    .CT....... .......... ...CCC.TAG TGGACGGTCG GAGGCC..CT 
T. terrestre 8                       .TG....... .......... ...CCACTCG TGGCAGGCTG GAAGCCGCTT 
A. quafrifidum 24                    .TG....... .......... ...CCACTCG TGGCAGACCG GAAGCCGTTT 
T. gloriae 89                        .CC....... .......... ...ATT.CTC TAGGGATCTC TTAACC...G 
A. cuniculi 25                       .TT....... .......... ...CCGCCTA GCGACGGCTG GAAGTCGTCT 
Chrysosporum keratinophilum 83       .TG....... .......... ...CCC.TTG TGGCTGCCGG GGATGC.... 
Arachniotus ruber 84                 .TC....... .......... ...CCGGCGC TCCCTAACCG GGGCCCGGGT 
M. gallinae 32                       .......... .......... .......... .......... .......... 
A. grubyi 56                         .......... .......... .......... .......... .......... 
M. vanbreuseghemii 55                .......... .......... .......... .......... .......... 
A. cajetani (M. cookei)87            GCG....... .......... ...CCCCCCT CT..TAGCTG AGGGGGAGCG 
M. audouinii 34                      CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. audouinii 13                      CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. audouinii var. langeronii 59      CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. audouinii var. rivalierii 58      CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. ferrugineum 79                    CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. ferrugineum 77                    CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. canis 33                          CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. canis 69                          CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
A. otae 51                           CTG....... .......... ...CTGTGCC ACAGCGGCCG TTCGGGGGGG 
A. otae 52                           CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. canis var. distortum 70           CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
M. equinum 60                        CTG....... .......... ...CTGTGCT ACAGCGGCCG TTCGGGGGGG 
                                        ********** ********** ** Indel 3 ********** **********



Speziesname / Labornummer            251                      ITS 1                     300
T. m. var. goetzii 17                AGCCTCT... .....CTTTA ..GTG..... .GCTAAACGC TGGACCGCGC 
T. m. var. interdigitale 22          AGCCTCT... .....CTTTA ..GTG..... .GCTAAACGC TGGACCGCGC 
A. vanbreuseghemii 72                AGCCTCT... .....CTTTA ..GTG..... .GCTCAACGC TGGACCGCGC 
T. m. var. nodulare 18               AGCCTCT... .....CTTTA ..GTG..... .GCTAAACGC TGGACCGCGC 
T. tonsurans var. epilans 40         AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. tonsurans 39                      AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. tonsurans 4                       AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. tonsurans var. crateriforme 41    AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. tonsurans var. sulfureum 62       AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. simii   48                        AGCCTCC... .....CTTCA ..GGG..... .GCTCAACGC TGGACCGCGC 
A. simii   43                        AGCCTCC... .....CTTCA ..GGG..... .GCTCAACGC TGGACCGCGC 
A. simii   47                        AGCCTCC... .....CTTCA ..GGG..... .GCTCAACGC TGGACCGCGC 
T. m. var. mentagrophytes 20         AGCCTCT... .....CTTTA ..GTG..... .GCTCAACGC TGGACCGCGC 
T. m. var. quinckeanum 19            AGCCTCT... .....CTTTA ..GTG..... .GCTCAACGC TGGACCGCGC 
T.schoenleinii 2                     AGCCTCT... .....CTTTA ..GTG..... .GCTCAACGC TGGACCGCGC 
T.schoenleinii 38                    AGCCTCT... .....CTTTA ..GTG..... .GCTCAACGC TGGACCGCGC 
A. benhamiae 71                      AGCCTCT... .....TTGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
A. benhamiae 86                      AGCCTCT... .....TTGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. concentricum 66                   AGCCTCT... .....TTGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. concentricum 73                   AGCCTCT... .....TTGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. verruco. var. verrucosum 61       AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. verruco. var. verrucosum 6        AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. verruco. var. verrucosum 64       AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. m. var. erinacae 15               AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. m. var. erinacae 68               AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. m. var. granulosum 16             AGCCTCT... .....TCGGG ..GG...... ..CTTTA.GC TGGATCGCGC 
T. rubrum 37                         GGCCCCT... .....TCTGG ..GAG..... .CCTCGA.GC CGGACCGCGC 
T. rubrum var. granulare 78          GGCCCCT... .....TCTGG ..GAG..... .CCTCGA.GC CGGACCGCGC 
T. megninii 10                       GGCCTCT... .....TCCGG ..GGG..... .CCTCGA.GC CGGACCGCGC 
T. fischeri 76                       GGCCCCT... .....TCTGG ..GAG..... .CCTCGA.GC CGGACCGCGC 
T. kanei  65                         GGCCCCT... .....TCTGG ..GAG..... .CCTCGA.GC CGGACCGCGC 
M. gypseum var. gypseum 12           .......... .......... .......... .......... .......... 
A. incurvatum 29                     .......... .......... .......... .......... .......... 
A. fulvum 30                         TTTATC.... .......... .......... ......TCCC TGGACCGCGC 
M. fulvum 57                         TTTATC.... .......... .......... ......TCCC TGGACCGCGC 
M. persicolor 54                     AGGAAC.... .......... .......... ......CCCC TGGACCGCGT 
A. persicolor 53                     AGGAAC.... .......... .......... ......CCCC TGGACCGCGT 
E. floccosum  74                     GAGAAGGATG CCCCGGCGGG GTTGATCGCT CCCCCACCCC TGGACAGCGC 
E. floccosum  75                     GAGAAGGATG CCCCGGCGGG GTTGATCGCT CCCCCACCCC TGGACAGCGC 
E. floccosum  14                     GAGAAGGATG CCCCGGCGGG GTTGATCGCT CCCCCACCCC TGGACAGCGC 
T. ajelloi var. nanum 82             TGGACCC... .......AGC .GTCC..... .ATGTGGCCC TGGCCAGTGC 
T. ajelloi 49                        TGGACCC... .......AGC .GTCC..... .ATGTGGCCC TGGCCAGTGC 
A. uncinatum 50                      TGGACCC... .......AGC .GTCC..... .ATGTGGCCC TGGCCAGTGC 
T. vanbreuseghemii 26                AGGACCA... .......GGT TGTCC..... .CAGTGGCCC TGACCAGCGC 
A. insingulare 27                    AGGGACC... .......TAG TGTCC..... .CCGGGGCTC TGGCCAGCGC 
T. equinum var. equinum 44           TGGACCC... .......AGC .GTCC..... .ATGTGGCCC TGGCCAGTGC 
T. equinum var. autotrophicum 85     AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC 
T. equinum var. autotrophicum 67     AGCCTCT... .....CTTTA TAGCG..... .GCTCAACGC TGGACCGCGC
E. stockdaleae 31                    TGGACCC... .......AGC .GTCC..... .ATGTGGCCC TGGCCAGTGC 
T. terrestre 8                       AAACCCC... .......TGG GGCTT..... .AGGCGGCCC TGGCCAGTGC 
A. quafrifidum 24                    GAACCCC... .......TAG GGCTC..... .AGGCGGCCC TGGCCAGTGC 
T. gloriae 89                        AAGTTCT... ....TAGGGG GGGCG..... .GCAACCCCG TTGTCCGCGC 
A. cuniculi 25                       GGAGCCCCT. ....TAGGGG GTGCC..... .CGGCGGCCC TGGCCTGCGC 
Chrysosporum keratinophilum 83       .CT....... .......... ...CA..... .CGGTGTCCC GGGCTCGTGC 
Arachniotus ruber 84                 GCGGCCTGGG ....GTCTGG CTTAA..... .CCGCCGCCC GGGTGAGCGC 
M. gallinae 32                       .......... .......... .......... .......... ..GTTCGCGC 
A. grubyi 56                         .......... .......... .......... .......... ..GTTCGCGC 
M. vanbreuseghemii 55                .......... .......... .......... .......... ..GTTCGCGC 
A. cajetani (M. cookei)87            CCGGCCAGGC GGGAGATCCG TCTCC..... ....CTCCC. .GGTCCGCGC 
M. audouinii 34                      ACGCCTGAGG GGGACTTTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. audouinii 13                      ACGCCTGAGG GGGACTTTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. audouinii var. langeronii 59      ACGCCTGAGG GGGACTTTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. audouinii var. rivalierii 58      ACGCCTGAGG GGGACTTTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. ferrugineum 79                    ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. ferrugineum 77                    ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. canis 33                          ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCCC GGGGCAGCGC 
M. canis 69                          ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCCC GGGGCAGCGC 
A. otae 51                           ACGCCTGAGG GGGACTTTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
A. otae 52                           ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. canis var. distortum 70           ACGCCTGAGG GG.ACTCTTG TTTCCTAGG. .CCACGCCCC .GGGCAGCGC 
M. equinum 60                        ACGCCTGAGG GGGACTCTTG TTTCCTAGG. .CCACGCCC. .GGGCAGCGC 
                                     ********** ********** ** Indel 3 ********** **********



Speziesname / Labornummer            301                      ITS 1                     350
T. m. var. goetzii 17                CCGCCGGAGG ACAGACGC.. ..AAAAAAA. .TTCTTTCAG AAGAGC.TGT 
T. m. var. interdigitale 22          CCGCCGGAGG ACAGACGC.. ..AAAAAAA. .TTCTTTCAG AAGAGC.TGT 
A. vanbreuseghemii 72                CCGCCGGAGG ACAGACGC.. ..AAAAAAA. .TTCTTTCAG AAGAGC.TGT 
T. m. var. nodulare 18               CCGCCGGAGG ACAGACGC.. ..AAAAAAA. .TTCTTTCAG AAGAGC.TGT 
T. tonsurans var. epilans 40         CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. tonsurans 39                      CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. tonsurans 4                       CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. tonsurans var. crateriforme 41    CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. tonsurans var. sulfureum 62       CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. simii   48                        CCGCCGGAGG ACAGACGC.. ..AAAAAAAA .TTCTTTCAG AAGAGC.TGT 
A. simii   43                        CCGCCGGAGG ACAGACGC.. ..AAAAAAAA .TTCTTTCAG AAGAGC.TGT 
A. simii   47                        CCGCCGGAGG ACAGACGC.. ..AAAAAAAA .TTCTTTCAG AAGAGC.TGT 
T. m. var. mentagrophytes 20         CCGCCGGAGG ACAGACGC.. ..AAAAAA.. .TTCTTTCAG AAGAGC.TGT 
T. m. var. quinckeanum 19            CCGCCGGAGG ACAGACGC.. ..AAAAAA.. .TTCTTTCAG AAGAGC.TGT 
T.schoenleinii 2                     CCGCCGGAGN ACAGACGC.. ..AAAAAA.. .TTCTTTCAG AAGAGC.TGT 
T.schoenleinii 38                    CCGCCGGAGN ACAGACGC.. ..AAAAAA.. .TTCTTTCAG AAGAGC.TGT 
A. benhamiae 71                      CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG GAAAGC.TGT 
A. benhamiae 86                      CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG GAAAGC.TGT 
T. concentricum 66                   CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG GAAAGC.TGT 
T. concentricum 73                   CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG GAAAGC.TGT 
T. verruco. var. verrucosum 61       CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG AAGAGC.TGT 
T. verruco. var. verrucosum 6        CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG AAGAGC.TGT 
T. verruco. var. verrucosum 64       CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG AAGAGC.TGT 
T. m. var. erinacae 15               CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG AAAAGC.TGT 
T. m. var. erinacae 68               CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG AAAAGC.TGT 
T. m. var. granulosum 16             CCGCCGGAGG ACAGACAT.. ..CAAAAAA. .....TCTTG GAAAGC.TGT 
T. rubrum 37                         CCGCCGGAGG ACAGACAC.. ..CAAGAAAA .AATTCTCTG AAGAGC.TGT 
T. rubrum var. granulare 78          CCGCCGGAGG ACAGACAC.. ..CAAGAAAA .AATTCTCTG AAGAGC.TGT 
T. megninii 10                       CCGCCGGAGG ACAGACAC.. ..CAAGAAAA .AATTCTCTG AAGAGC.TGT 
T. fischeri 76                       CCGCCGGAGG ACAGACAC.. ..CAAGAAAA .AATTCTCTG AAGAGC.TGT 
T. kanei  65                         CCGCCGGAGG ACAGACAC.. ..CAAGAAAA .AATTCTCTG AAGAGC.TGT 
M. gypseum var. gypseum 12           ...CA.GAGG AGTGATT... ..AAAATCCA TGAATACT.. .......GTT 
A. incurvatum 29                     ...CAAGAGG AGTGATT... ..AAAACCTA TGAATACT.. .......GTT 
A. fulvum 30                         CCGCCGGAGG AGCGATT... ..AAAACCCA TGAATACT.. .......GTT 
M. fulvum 57                         CCGCCGGAGG AGCGATT... ..AAAATCCA TGAATACT.. .......GTT 
M. persicolor 54                     CCGCCGGAGG AGCGATT... ..AAAACCCA TGAATACG.. .......GTT 
A. persicolor 53                     CCGCCGGAGG AGCGATT... ..AAAACCCA TGAATACG.. .......GTT 
E. floccosum  74                     TCGCCGAAGG AGTGATTCTC AGAAATTCTA CGAAATCTCC ATAGGTGGTT 
E. floccosum  75                     TCGCCGAAGG AGTGATTCTC AGAAATTCTA CGAAATCTCC ATAGGTGGTT 
E. floccosum  14                     TCGCCGAAGG AGTGATTCTC AGAAATTCTA CGAAATCTCC ATAGGTGGTT 
T. ajelloi var. nanum 82             GCGCCGGCGG ACA.GTCT.. ..AAAA.... ..TCTTT... ATATAT.TGG 
T. ajelloi 49                        GCGCCGGCGG ACA.GTCT.. ..AAAA.... ..TCTTT... ATATAT.TGG 
A. uncinatum 50                      GCGCCGGCGG ACA.GTCT.. ..AAAA.... ..TCTTT... ATATAT.TGG 
T. vanbreuseghemii 26                ACGCCGACGG ACA.GTCT.. ..AAAA.... ..TCTTT... ATATAT.TGG 
A. insingulare 27                    ACGCCGG.AG ACA.GTCT.. ..AAAAC... ..TCTTT... ACGTAA.CGG 
T. equinum var. equinum 44           GCGCCGGCGG ACA.GTCT.. ..AAAA.... ..TCTTT... ATATAT.TGG 
T. equinum var. autotrophicum 85     CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT 
T. equinum var. autotrophicum 67     CCGCCGGAGG ACAGACGC.. ..AAAAAAAA ATTCTTTCAG AAGAGC.TGT
E. stockdaleae 31                    GCGCCGGCGG ACA.GTCC.. ..AAAA.... ..TCTTT... ATATAT.TGG 
T. terrestre 8                       CCGCCGACGG ACA.GACC.. ..TAAAA... ..TCTTT... ATATAT.TGG 
A. quafrifidum 24                    CCGCCGACGG ACA.GACT.. ..TAAAA... ..TCTTT... ATATAT.TGG 
T. gloriae 89                        CCGCCGGTGG ACACATTT.. ..CAAAAATC TATCTTA... GTTAAA.AGG 
A. cuniculi 25                       ACGCCGGAGG ACA.GCCT.. ..AAAAA... ..TCTTT... ATATAC.TGG 
Chrysosporum keratinophilum 83       TCACCAGTGG AAC.ATTT.. ..GAAC.... ..TCTTACCT GAAAAT.AGT 
Arachniotus ruber 84                 CTGCCGGGGG ATTAGTTG.. ..AAACA... ...CTTGTTG ATCAGT.GAG 
M. gallinae 32                       CCGCCGGAGG ACCGTC.... ...AAACAAA AATTCTTCA. .CAGT...TA 
A. grubyi 56                         CCGCCGGAGG ACCGTC.... ...AAACAAA AATTCTTCA. .CAGTG.TTA 
M. vanbreuseghemii 55                CCGCCGGAGG ACCGTC.... ...AAACAAA AATTCTTCA. .CAGTG.TTA 
A. cajetani (M. cookei)87            CCGCCGGAGG ACCATC.... ...TGAAAAA CCCTTTTAAA TCATCG.TCT 
M. audouinii 34                      TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. audouinii 13                      TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. audouinii var. langeronii 59      TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. audouinii var. rivalierii 58      TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. ferrugineum 79                    TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. ferrugineum 77                    TCGCCGGAGG ATTACTCC.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. canis 33                          TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. canis 69                          TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
A. otae 51                           TCGCCGGAGG ATCACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
A. otae 52                           TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. canis var. distortum 70           TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
M. equinum 60                        TCGCCGGAGG ATTACTCT.. ..GGAAAACA CACTCTTGAA AGAACA..TA 
                                        **           ******** ******** Indel 4***** ******* **          



Speziesname / Labornummer            351                          ITS 1    harr    5.8S   400
T. m. var. goetzii 17                CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. m. var. interdigitale 22          CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
A. vanbreuseghemii 72                CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. m. var. nodulare 18               CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. tonsurans var. epilans 40         CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. tonsurans 39                      CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. tonsurans 4                       CAGTCTGAGC GTT.AGCAAG CAAAAAGTCA GTTAAAACTT TCAACAACGG 
T. tonsurans var. crateriforme 41    CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. tonsurans var. sulfureum 62       CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. simii   48                        CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
A. simii   43                        CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
A. simii   47                        CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. m. var. mentagrophytes 20         CAGTCTGAGC GTT.AG.AAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. m. var. quinckeanum 19            CAGTCTGAGC GTT.AG.AAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T.schoenleinii 2                     CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T.schoenleinii 38                    CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
A. benhamiae 71                      CAGTCTGAGC GTT.AGCAAG TAAAA..TTA GTTAAAACTT TCAACAACGG 
A. benhamiae 86                      CAGTCTGAGC GTT.AGCAAG TAAAA..TTA GTTAAAACTT TCAACAACGG 
T. concentricum 66                   CAGTCTGAGC GTT.AGCAAG TAAAA..TTA GTTAAAACTT TCAACAACGG 
T. concentricum 73                   CAGTCTGAGC GTT.AGCAAG TAAAA..TTA GTTAAAACTT TCAACAACGG 
T. verruco. var. verrucosum 61       CAGTCTGAGC GTT.AGCAAG CAAAA..TCA GTTAAAACTT TCAACAACGG 
T. verruco. var. verrucosum 6        CAGTCTGAGC GTT.AGCAAG CAAAA..TCA GTTAAAACTT TCAACAACGG 
T. verruco. var. verrucosum 64       CAGTCTGAGC GTT.AGCAAG CAAAA..TCA GTTAAAACTT TCAACAACGG 
T. m. var. erinacae 15               TAGTCTGAGC GTT.AGCAAG CAAAA..TCA GTTAAAACTT TCAACAACGG 
T. m. var. erinacae 68               TAGTCTGAGC GTT.AGCAAG CAAAA..TCA GTTAAAACTT TCAACAACGG 
T. m. var. granulosum 16             CAGTCTGAGC GTT.AGCAAG TAAAA..TCA GTTAAAACTT TCAACAACGG 
T. rubrum 37                         CAGTCTGAGC GTTTAGCAAG CACAA..TCA GTTAAAACTT TCAACAACGG 
T. rubrum var. granulare 78          CAGTCTGAGC GTTTAGCAAG CACAA..TCA GTTAAAACTT TCAACAACGG 
T. megninii 10                       CAGTCTGAGC GTTTCGCAAG CACAA..TCA GTTAAAACTT TCAACAACGG 
T. fischeri 76                       CAGTCTGAGC GTTTAGCAAG CACAA..TCA GTTAAAACTT TCAACAACGG 
T. kanei  65                         CAGTCTGAGC GTTTAGCAAG CACAA..TCA GTTAAAACTT TCAACAACGG 
M. gypseum var. gypseum 12           CCGTCTGAGC GTT.AGCAAG TAAAA..TCA GTTAAAACTT TCAACAACGG 
A. incurvatum 29                     CCGTCTGAGC GTT.AGCAAG TGAAA..TCA GTTAAAACTT TCAACAACGG 
A. fulvum 30                         CAGTCTGAGC GTA.AGCAAG TGAAA..TCA GTTAAAACTT TCAACAACGG 
M. fulvum 57                         CAGTCTGAGC GTA.AGCAAG TGAAA..TCA GTTAAAACTT TCAACAACGG 
M. persicolor 54                     CAGTCTGAGC GTT.AGCAAG TAAAA..TCA GTTAAAACTT TCAACAACGG 
A. persicolor 53                     CAGTCTGAGC GTT.AGCAAG TAAAA..TCA GTTAAAACTT TCAACAACGG 
E. floccosum  74                     CAGTCTGAGC GTT.GGCAAG CAAAAA.CCA GTCAAAACTT TCAACAACGG 
E. floccosum  75                     CAGTCTGAGC GTT.GGCAAG CAAAAA.CCA GTCAAAACTT TCAACAACGG 
E. floccosum  14                     CAGTCTGAGC GTT.GGCAAG CAAAAA.CCA GTCAAAACTT TCAACAACGG 
T. ajelloi var. nanum 82             CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
T. ajelloi 49                        CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
A. uncinatum 50                      CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
T. vanbreuseghemii 26                CCCTCTGAGC GT..ATAA.G CAAA...TCA ATTAAAACTT TCAACAACGG 
A. insingulare 27                    CCGTCTGAGC AT..ATAAAG CAAAA..TCA ATTAAAACTT TCAACAACGG 
T. equinum var. equinum 44           CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
T. equinum var. autotrophicum 85     CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG 
T. equinum var. autotrophicum 67     CAGTCTGAGC GTT.AGCAAG CAAAAA.TCA GTTAAAACTT TCAACAACGG
E. stockdaleae 31                    CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
T. terrestre 8                       CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
A. quafrifidum 24                    CCGTCTGAGC GT..ATAAAG CAAA...TCA ATTAAAACTT TCAACAACGG 
T. gloriae 89                        TCGTCTGAGA GC..GTAAAG CGAA...TCA GTTAAAACTT TCAACAACGG 
A. cuniculi 25                       CCGTCTGAGC GT..ATAAAG CAAAA..TCA ATTAAAACTT TCAACAACGG 
Chrysosporum keratinophilum 83       CAGTCTGAGC AT....TATG CAAA...TTA AATAAAACTT TCAACAACGG 
Arachniotus ruber 84                 AACTCTGAGT TG....ATTG CAAA...ATC GTTAAAACTT TCAACAACGG 
M. gallinae 32                       CCGTCTGAGC GTATAAAGCG TAAA...TCA GTTAAAACTT TCAACAACGG 
A. grubyi 56                         CCGTCTGAGC GTATAAAGCG TAAA...TCA GTTAAAACTT TCAACAACGG 
M. vanbreuseghemii 55                CCGTCTGAGC GTATAAAGCG TAAA...TCA GTTAAAACTT TCAACAACGG 
A. cajetani (M. cookei)87            CCGTCTGAGC ATAACAAGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. audouinii 34                      CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. audouinii 13                      CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. audouinii var. langeronii 59      CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. audouinii var. rivalierii 58      CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. ferrugineum 79                    CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. ferrugineum 77                    CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. canis 33                          CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. canis 69                          CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
A. otae 51                           TCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
A. otae 52                           CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. canis var. distortum 70           CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
M. equinum 60                        CCGTCTGAGC GAGCAACGC. .AAA...TCA GTTAAAACTT TCAACAACGG 
                                     ***    *** nicht rekodiert *****                             



Speziesname / Labornummer           401                      5.8S/5.8SR                 450
T. m. var. goetzii 17                ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. interdigitale 22          ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. vanbreuseghemii 72                ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. nodulare 18               ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. tonsurans var. epilans 40         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. tonsurans 39                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. tonsurans 4                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. tonsurans var. crateriforme 41    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. tonsurans var. sulfureum 62       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. simii   48                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. simii   43                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. simii   47                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. mentagrophytes 20         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. quinckeanum 19            ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T.schoenleinii 2                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T.schoenleinii 38                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. benhamiae 71                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. benhamiae 86                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. concentricum 66                   ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. concentricum 73                   ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. verruco. var. verrucosum 61       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. verruco. var. verrucosum 6        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. verruco. var. verrucosum 64       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. erinacae 15               ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. erinacae 68               ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. m. var. granulosum 16             ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. rubrum 37                         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. rubrum var. granulare 78          ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. megninii 10                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. fischeri 76                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. kanei  65                         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. gypseum var. gypseum 12           ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. incurvatum 29                     ATCTCTTGGT TCCGGCATCG AATGAAAACG CAGCGAAATG CGATAAGTAA 
A. fulvum 30                         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. fulvum 57                         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. persicolor 54                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. persicolor 53                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
E. floccosum  74                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
E. floccosum  75                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
E. floccosum  14                     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. ajelloi var. nanum 82             ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. ajelloi 49                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. uncinatum 50                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. vanbreuseghemii 26                ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. insingulare 27                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. equinum var. equinum 44           ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. equinum var. autotrophicum 85     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. equinum var. autotrophicum 67     ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA
E. stockdaleae 31                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. terrestre 8                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. quafrifidum 24                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
T. gloriae 89                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. cuniculi 25                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
Chrysosporum keratinophilum 83       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
Arachniotus ruber 84                 ATCTCTTGGT TCCAGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. gallinae 32                       ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. grubyi 56                         ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. vanbreuseghemii 55                ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. cajetani (M. cookei)87            ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. audouinii 34                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. audouinii 13                      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. audouinii var. langeronii 59      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. audouinii var. rivalierii 58      ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. ferrugineum 79                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. ferrugineum 77                    ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. canis 33                          ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. canis 69                          ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. otae 51                           ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
A. otae 52                           ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. canis var. distortum 70           ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 
M. equinum 60                        ATCTCTTGGT TCCGGCATCG ATGAAGAACG CAGCGAAATG CGATAAGTAA 



Speziesname / Labornummer            451                      5.8S                      500
T. m. var. goetzii 17                TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. interdigitale 22          TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. vanbreuseghemii 72                TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. nodulare 18               TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. tonsurans var. epilans 40         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. tonsurans 39                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. tonsurans 4                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. tonsurans var. crateriforme 41    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. tonsurans var. sulfureum 62       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. simii   48                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. simii   43                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. simii   47                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. mentagrophytes 20         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. quinckeanum 19            TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T.schoenleinii 2                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T.schoenleinii 38                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. benhamiae 71                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. benhamiae 86                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. concentricum 66                   TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. concentricum 73                   TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. verruco. var. verrucosum 61       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. verruco. var. verrucosum 6        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. verruco. var. verrucosum 64       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. erinacae 15               TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. erinacae 68               TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. m. var. granulosum 16             TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. rubrum 37                         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. rubrum var. granulare 78          TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. megninii 10                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. fischeri 76                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. kanei  65                         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. gypseum var. gypseum 12           TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. incurvatum 29                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. fulvum 30                         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. fulvum 57                         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. persicolor 54                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. persicolor 53                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
E. floccosum  74                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
E. floccosum  75                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
E. floccosum  14                     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. ajelloi var. nanum 82             TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. ajelloi 49                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. uncinatum 50                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. vanbreuseghemii 26                TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. insingulare 27                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. equinum var. equinum 44           TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. equinum var. autotrophicum 85     TGTNAATTGC ANAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. equinum var. autotrophicum 67     TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG
E. stockdaleae 31                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCAAATTGCG 
T. terrestre 8                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. quafrifidum 24                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
T. gloriae 89                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. cuniculi 25                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
Chrysosporum keratinophilum 83       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
Arachniotus ruber 84                 TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. gallinae 32                       TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. grubyi 56                         TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. vanbreuseghemii 55                TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. cajetani (M. cookei)87            TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. audouinii 34                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. audouinii 13                      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. audouinii var. langeronii 59      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. audouinii var. rivalierii 58      TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. ferrugineum 79                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. ferrugineum 77                    TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. canis 33                          TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. canis 69                          TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. otae 51                           TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
A. otae 52                           TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. canis var. distortum 70           TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 
M. equinum 60                        TGTGAATTGC AGAATTCCGT GAATCATCGA ATCTTTGAAC GCACATTGCG 



Speziesname / Labornummer             501                                      5.8S harr ITS 2 
T. m. var. goetzii 17                .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. m. var. interdigitale 22          .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
A. vanbreuseghemii 72                .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. m. var. nodulare 18               .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. tonsurans var. epilans 40         .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. tonsurans 39                      .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. tonsurans 4                       .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. tonsurans var. crateriforme 41    .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. tonsurans var. sulfureum 62       .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. simii   48                        .CCCCTTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
A. simii   43                        .CCCCTTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
A. simii   47                        .CCCCTTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. m. var. mentagrophytes 20         .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. m. var. quinckeanum 19            .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T.schoenleinii 2                     .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T.schoenleinii 38                    .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
A. benhamiae 71                      .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. benhamiae 86                      .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. concentricum 66                   .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. concentricum 73                   .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. verruco. var. verrucosum 61       .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. verruco. var. verrucosum 6        .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. verruco. var. verrucosum 64       .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. m. var. erinacae 15               .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TCCGAGCGTC ATTTCAACCC 
T. m. var. erinacae 68               .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TCCGAGCGTC ATTTCAACCC 
T. m. var. granulosum 16             .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. rubrum 37                         .CCCTCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. rubrum var. granulare 78          .CCCTCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. megninii 10                       .CCCTCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. fischeri 76                       .CCCTCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. kanei  65                         .CCCTCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. gypseum var. gypseum 12           .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. incurvatum 29                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TNCGAGCGTC ATTTCAACCC 
A. fulvum 30                         .CCCTCTGGT A.TTCCGGGG G.CATGCCTG TTCGAGCGTC ATTTCAACCC 
M. fulvum 57                         .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. persicolor 54                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. persicolor 53                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
E. floccosum  74                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
E. floccosum  75                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
E. floccosum  14                     .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. ajelloi var. nanum 82             .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. ajelloi 49                        .CCCCTTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. uncinatum 50                      .CCCCTTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. vanbreuseghemii 26                .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. insingulare 27                    .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
T. equinum var. equinum 44           .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. equinum var. autotrophicum 85     .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC 
T. equinum var. autotrophicum 67     .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAGCCC
E. stockdaleae 31                    .CCCCCTGGT AATTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
T. terrestre 8                       .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
A. quafrifidum 24                    .CCCCCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
T. gloriae 89                        .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
A. cuniculi 25                       .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
Chrysosporum keratinophilum 83       .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
Arachniotus ruber 84                 .CCCTCTGGT A.TTCCGGGG GGCATGCCTG TCCGAGCGTC ATTACACCAA 
M. gallinae 32                       .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
A. grubyi 56                         .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
M. vanbreuseghemii 55                .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTGCAACCC 
A. cajetani (M. cookei)87            .CCCCCTGGT A.TTCCGGGG GGCATTCCTG TTCGAGCGTC ATTTCAACCC 
M. audouinii 34                      .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. audouinii 13                      .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. audouinii var. langeronii 59      .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. audouinii var. rivalierii 58      .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. ferrugineum 79                    .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. ferrugineum 77                    .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. canis 33                          .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. canis 69                          .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. otae 51                           .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
A. otae 52                           .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. canis var. distortum 70           .CCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 
M. equinum 60                        GCCCCCTGGC A.TTCCGGGG GGCATGCCTG TTCGAGCGTC ATTTCAACCC 



Speziesname / Labornummer            551                      ITS 2                     600
T. m. var. goetzii 17                CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. m. var. interdigitale 22          CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
A. vanbreuseghemii 72                CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. m. var. nodulare 18               CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. tonsurans var. epilans 40         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. tonsurans 39                      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. tonsurans 4                       CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. tonsurans var. crateriforme 41    CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. tonsurans var. sulfureum 62       CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. simii   48                        CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCT 
A. simii   43                        CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCT 
A. simii   47                        CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCT 
T. m. var. mentagrophytes 20         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCACC. ......CCCT 
T. m. var. quinckeanum 19            CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCACC. ......CCCT 
T.schoenleinii 2                     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCACC. ......CCCT 
T.schoenleinii 38                    CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCACC. ......CCCT 
A. benhamiae 71                      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGACCTC. ......CTCT 
A. benhamiae 86                      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGACCTC. ......CTCT 
T. concentricum 66                   CTCAAGCCCG GCTTGTGTGA TGGACGACCG TACGACCTC. ......CTCT 
T. concentricum 73                   CTCAAGCCCG GCTTGTGTGA TGGACGACCG TACGACCTC. ......CTCT 
T. verruco. var. verrucosum 61       CTCAAGCTCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. verruco. var. verrucosum 6        CTCAAGCTCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. verruco. var. verrucosum 64       CTCAAGCTCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. m. var. erinacae 15               CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. m. var. erinacae 68               CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. m. var. granulosum 16             CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......CTCT 
T. rubrum 37                         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......TCCC 
T. rubrum var. granulare 78          CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......TCCC 
T. megninii 10                       CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......TCCC 
T. fischeri 76                       CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......TCCC 
T. kanei  65                         CTCAAGCCCC GCTTGTGTGA TGGACGACCG TCCGGCCCC. ......TCCC 
M. gypseum var. gypseum 12           CTCAAGCGCG GCTTGTGTGA TGGACGACCG TCCCC..... ...GCCCTCC 
A. incurvatum 29                     CTCAAGCGCG GCTTGTGTGA TGGACGACCG TCCCC..... ...GCCCTCC 
A. fulvum 30                         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCC...... ...GCCCTCC 
M. fulvum 57                         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCC...... ...GCCCTCC 
M. persicolor 54                     CTCAAGCCCG GCTTGCGTGA TGGACGACCG TCCCG..... ...ACCCTCC 
A. persicolor 53                     CTCAAGCCCG GCTTGCGTGA TGGACGACCG TCCCG..... ...ACCCTCC 
E. floccosum  74                     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGACCGCC TTTGCATCCC 
E. floccosum  75                     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGACCGCC TTTGCATCCC 
E. floccosum  14                     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGACCGCC TTTGCATCCC 
T. ajelloi var. nanum 82             .TCAAGCCCG GCTTGTGTGA TGGACGAACG TCCTGCCT.. .......... 
T. ajelloi 49                        .TCAAGCTCG GCTTGTGTGA TGGACGAACG TCCTGCCT.. .......... 
A. uncinatum 50                      .TCAAGCTCG GCTTGTGTGA TGGACGAACG TCCTGCCT.. .......... 
T. vanbreuseghemii 26                .TCAAGCTCG GCTTGTGTGA TGGGCGAACG TCTGACCC.. .......... 
A. insingulare 27                    .TCAAGCTCG GCTTGTGTGA TGGGCGAACG TCCCACCCC. .......... 
T. equinum var. equinum 44           .TCAAGCCCG GCTTGTGTGA TGGACGAACG TCCTGCCT.. .......... 
T. equinum var. autotrophicum 85     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG 
T. equinum var. autotrophicum 67     CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCGGCGCC. ......CCCG
E. stockdaleae 31                    .TCAAGCCCG GCTTGTGTGA TGGACGAACG TCCTGCCT.. .......... 
T. terrestre 8                       .TCAAGCTCG GCTTGTGTGA TGGGCGACCG TCCTTCCC.. .......... 
A. quafrifidum 24                    .TCAAGCTCG GCTTGTGTGA TGGGCGACCG TCCTTCCC.. .......... 
T. gloriae 89                        CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCTAA.. .......... 
A. cuniculi 25                       .TCAAGCCCG GCTTGTGTGA TGGGCGAACG TCCCTCTCC. ......TCCT 
Chrysosporum keratinophilum 83       CTCAAGCACA GCTTGTGTGT TGGGCCATCG TCCCTCTT.. .......... 
Arachniotus ruber 84                 .TCAAGCACG GCTTGTGAGT TGGGCCACCG TCCCCTAA.. .......... 
M. gallinae 32                       CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCT... ......CCCC 
A. grubyi 56                         CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCT... ......CCCC 
M. vanbreuseghemii 55                CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCT... ......CCCC 
A. cajetani (M. cookei)87            CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCC... ......CCCG 
M. audouinii 34                      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCC... CCAATAACCA 
M. audouinii 13                      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCC... CCAATAACCA 
M. audouinii var. langeronii 59      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCC... CCAATAACCA 
M. audouinii var. rivalierii 58      CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCC... CCAATAACCA 
M. ferrugineum 79                    CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAACAACCA 
M. ferrugineum 77                    CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAACAACCA 
M. canis 33                          CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAGTAACCA 
M. canis 69                          CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAGTAACCA 
A. otae 51                           CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAATAACCA 
A. otae 52                           CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAGTAACCA 
M. canis var. distortum 70           CTCAAGCCCG GCTTGTGTGA TGGACGACCG TCCCCCCTCC CCAGTAACCA 
M. equinum 60                        CTCAAGCCCG GCTTGTGTGA TGGACGACCG TTCCCCCTCC CCAGTAACCA 
                                                                              **** Indel 5 ******         



Speziesname / Labornummer            601                      ITS 2                     650
T. m. var. goetzii 17                TCTT...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. m. var. interdigitale 22          TCTT...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
A. vanbreuseghemii 72                TCTT...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. m. var. nodulare 18               TCTT...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. tonsurans var. epilans 40         TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. tonsurans 39                      TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. tonsurans 4                       TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. tonsurans var. crateriforme 41    TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAGGCAG 
T. tonsurans var. sulfureum 62       TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. simii   48                        TCTT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
A. simii   43                        TCTT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
A. simii   47                        TCTT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. m. var. mentagrophytes 20         TTCT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. m. var. quinckeanum 19            TTCT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T.schoenleinii 2                     TTCT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T.schoenleinii 38                    TTCT...... .......... .CGGGGGTGC GGGACGCGCC CGAAAAGCAG 
A. benhamiae 71                      TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
A. benhamiae 86                      TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. concentricum 66                   TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. concentricum 73                   TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. verruco. var. verrucosum 61       TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. verruco. var. verrucosum 6        TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. verruco. var. verrucosum 64       TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. m. var. erinacae 15               TTC....... .......... ....GGGGGC TGGACGCGCC CGAAAAGCAG 
T. m. var. erinacae 68               TTC....... .......... ....GGGGGC TGGACGCGCC CGAAAAGCAG 
T. m. var. granulosum 16             TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. rubrum 37                         TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. rubrum var. granulare 78          TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. megninii 10                       TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. fischeri 76                       TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
T. kanei  65                         TTC....... .......... ....GGGGGC GGGACGCGCC CGAAAAGCAG 
M. gypseum var. gypseum 12           CCGGC.TCCC GGG....... ......GAGG GGGACGCGCC CGAAAAGCAG 
A. incurvatum 29                     CCGGCGTCCC GGG....... ......GAGG GGGACGCGCC CGAAAAGCAG 
A. fulvum 30                         CCGAT..CCC GGG....... ......GAGG GGGACGCGCC CGAAAAGCAG 
M. fulvum 57                         CCGAT..CCC GGG....... ......GAGG GGGACGCGTC CGAAAAGCAG 
M. persicolor 54                     CCGCC..TCG GGG....... ......AGGG GGGACGCGCC CGAAAAGCAG 
A. persicolor 53                     CCGCC..TCG GGG....... ......AGGG GGGACGCGCC CGAAAAGCAG 
E. floccosum  74                     CCGTTCCACC GGGAGAGGAG AAAGGTGGAG GGGACGCGCC CGAAAAGCAG 
E. floccosum  75                     CCGTTCCACC GGGAGAGGAG AAAGGTGGAG GGGACGCGCC CGAAAAGCAG 
E. floccosum  14                     CCGTTCCACC GGGAGAGGAG AAAGGTGGAG GGGACGCGCC CGAAAAGCAG 
T. ajelloi var. nanum 82             TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. ajelloi 49                        TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
A. uncinatum 50                      TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. vanbreuseghemii 26                TT........ .......... ....GGGGGC GGGACGCGTC CGAAAAGCAG 
A. insingulare 27                    TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. equinum var. equinum 44           TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. equinum var. autotrophicum 85     TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGAAAAGCAG 
T. equinum var. autotrophicum 67     TCTC...... .......... .TGGGGGTGC GGGACGCGCC CGATAAGCAG
E. stockdaleae 31                    TT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. terrestre 8                       CT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
A. quafrifidum 24                    CT........ .......... ....AGGGGC GGGACGCGTC CGAAAAGCAG 
T. gloriae 89                        AC........ .......... ....CTTTAG GGGACGCGCC CGAAATGCAG 
A. cuniculi 25                       TA........ .......... ....GGGGGC GGGACGCGTC CGAAAAGCAG 
Chrysosporum keratinophilum 83       TT........ .......... .....GT... .GGACGGGCC TGAAATGCAG 
Arachniotus ruber 84                 .......... .......... .....GA... AGGACGGGCC CGAAACGCAG 
M. gallinae 32                       TTCATCTCT. .......... ..GAAGAGGG GGGACGCGCC CGAAAAGCAG 
A. grubyi 56                         TTCATCTCT. .......... ..GAAGAGGG GGGACGCGCC CGAAAAGCAG 
M. vanbreuseghemii 55                TTCATCTCT. .......... ..GAAGAGGG GGGACGCGCC CGAAAAGCAG 
A. cajetani (M. cookei)87            T......CA. .......... ..GACGGAGG GGGACGCGCC CGAAAAGCAG 
M. audouinii 34                      CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. audouinii 13                      CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. audouinii var. langeronii 59      CCCACCGCTT AGGGGGGTG. .G.AGGGAGG GGGACGCGCC CGAAAAGCAG 
M. audouinii var. rivalierii 58      CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. ferrugineum 79                    CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. ferrugineum 77                    CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. canis 33                          CCCACCGCTT AGGGGGGTG. .G.AGGGAGG GGGACGCGCC GGAAAAGCAG 
M. canis 69                          CCCACCGCTT AGGGGGGTG. .G.AGGGAGG GGGACGCGCC GGAAAAGCAG 
A. otae 51                           CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
A. otae 52                           CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. canis var. distortum 70           CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
M. equinum 60                        CCCACCGCTT AGGGGGGTG. .GGAGGGAGG GGGACGCGCC CGAAAAGCAG 
                                        ********** ****** Indel 5 ****** *   



Speziesname / Labornummer            651                      ITS 2                     700
T. m. var. goetzii 17                TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
T. m. var. interdigitale 22          TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
A. vanbreuseghemii 72                TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
T. m. var. nodulare 18               TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
T. tonsurans var. epilans 40         TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. tonsurans 39                      TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. tonsurans 4                       TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. tonsurans var. crateriforme 41    TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. tonsurans var. sulfureum 62       TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. simii   48                        TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
A. simii   43                        TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
A. simii   47                        TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
T. m. var. mentagrophytes 20         TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..AACAAA 
T. m. var. quinckeanum 19            TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GC..TACAAA 
T.schoenleinii 2                     TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCGCAACAAA 
T.schoenleinii 38                    TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCGCAACAAA 
A. benhamiae 71                      TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.GTCAAA 
A. benhamiae 86                      TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.GTCAAA 
T. concentricum 66                   TGGCCAGG.C CGCGATCCCG GCTTC...CT GGGCGAATGG GCA.GTCAAA 
T. concentricum 73                   TGGCCAGG.C CGCGATCCCG GCTTC...CT GGGCGAATGG GCA.GTCAAA 
T. verruco. var. verrucosum 61       TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.ATCAAA 
T. verruco. var. verrucosum 6        TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.ATCAAA 
T. verruco. var. verrucosum 64       TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.ATCAAA 
T. m. var. erinacae 15               TGGCCAGG.C CGCGATTTCG GCTTC...CT GGGCGAATGG GCA.ATCAAA 
T. m. var. erinacae 68               TGGCCAGG.C CGCGATTTCG GCTTC...CT GGGCGAATGG GCA.ATCAAA 
T. m. var. granulosum 16             TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.GTCAAA 
T. rubrum 37                         TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCA.GCCAAT 
T. rubrum var. granulare 78          TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCA.GCCAAT 
T. megninii 10                       TGGCCAGG.C CGCGATTCCG GCTTC...CT GGGCGAATGG GCA.GCCAAA 
T. fischeri 76                       TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCA.GCCAAT 
T. kanei  65                         TGGCCAGG.C CGCGATTCCG GCTTC...CT AGGCGAATGG GCA.GCCAAT 
M. gypseum var. gypseum 12           TGGCCAGG.C CGCGATTCCG G.CTC...CT GGGCGAATGG GCAACA.AA. 
A. incurvatum 29                     TGGCCAGG.C CGCGATTCCG G.CTC...CT GGGCGAATGG GCAATA.A.. 
A. fulvum 30                         TGGCCAGGGC CGCGATTCCG G.CTC...CT GGGCGAATGG GCAACA.AA. 
M. fulvum 57                         TGGCCAGG.C CGCGATTCCG G.CTC...CT GGGCGAATGG GCAACA.AA. 
M. persicolor 54                     TGGCCAGG.C CGCGATTCCG G.CTC...CT GGGCGAATGG GCAACA.AA. 
A. persicolor 53                     TGGCCAGG.C CGCGATTCCG G.CTC...CT GGGCGAATGG GCAACA.AA. 
E. floccosum  74                     TGGCCAGG.C CGCGATTCCG GGCCC...CT GGGCGAATGG GCAACA.AAA 
E. floccosum  75                     TGGCCAGG.C CGCGATTCCG GGCCC...CT GGGCGAATGG GCAACA.AAA 
E. floccosum  14                     TGGCCAGG.C CGCGATTCCG GGCCC...CT GGGCGAATGG GCAACA.AAA 
T. ajelloi var. nanum 82             TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAT.....TT 
T. ajelloi 49                        TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAT.....TT 
A. uncinatum 50                      TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAT.....TT 
T. vanbreuseghemii 26                TGGCTAGG.C CGCGACTCTG GCGC....CT GAGCGAATGG GAT.....TT 
A. insingulare 27                    TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAC.....TT 
T. equinum var. equinum 44           TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAT.....TT 
T. equinum var. autotrophicum 85     TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA 
T. equinum var. autotrophicum 67     TGGCCAGG.C CGCGATTCCG GCTTT...CT AGGCGAATGG GC..AACAAA
E. stockdaleae 31                    TGGCTAGG.C CGCGACTTCG GCGC....CT GAGCGAATGG GAT.....TT 
T. terrestre 8                       TGGCTAGG.C CGCGATTCCG GCGC....CT GAGCGAATGG GAC.....TT 
A. quafrifidum 24                    TGGCTAGG.C CGCGATTCCG GCGC....CT GAGCGAATGG GAC.....TT 
T. gloriae 89                        TGGCCAGG.C CGCGAATCCG GTGC....CT GAGCGAATGG GACA..T.CT 
A. cuniculi 25                       TGGCCAGG.C CGAGATTCCG GCGC....CT GAGCGAATGG GAC.....TT 
Chrysosporum keratinophilum 83       TGGCAGCA.C CGAG.TTCTG GTGT....CT GAGTGTATGG GAAT..C.TC 
Arachniotus ruber 84                 TGGCGGCG.T CGCGGTTTCT CGATCAGCCA GAGTGTATGG GGATTTCATT 
M. gallinae 32                       TGGCCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACAAAC.CA 
A. grubyi 56                         TGGCCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACAAAC.CA 
M. vanbreuseghemii 55                TGGCCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACAAAC.CA 
A. cajetani (M. cookei)87            TGGCCAGG.C CGCGCTTCCG GCAC....CT AGGCGAATGG GACACAC.CA 
M. audouinii 34                      TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. audouinii 13                      TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. audouinii var. langeronii 59      TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. audouinii var. rivalierii 58      TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. ferrugineum 79                    TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. ferrugineum 77                    TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. canis 33                          TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. canis 69                          TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
A. otae 51                           TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
A. otae 52                           TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. canis var. distortum 70           TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
M. equinum 60                        TGGTCAGG.C CGCGATTCCG GCTC....CT GGGCGAATGG GACATAC.CA 
                                                                                     * * Indel 6 *                 



Speziesname / Labornummer            701                      ITS 2                     750
T. m. var. goetzii 17                CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. m. var. interdigitale 22          CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
A. vanbreuseghemii 72                CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. m. var. nodulare 18               CCAGCGCCTC CAGGACC.GG CCGCGGG... TGGCCTCAAA A..TCTG... 
T. tonsurans var. epilans 40         CCAGCGCCTC CAGGACC.GG CCGCTC.... TGGCCTCAAA A..TCTG... 
T. tonsurans 39                      CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. tonsurans 4                       CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. tonsurans var. crateriforme 41    CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A.ATCTG... 
T. tonsurans var. sulfureum 62       CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. simii   48                        CCAGCGCCCC CAGGACC.GG CCGCCC.... TGGCCTCAGA A.T.CTG... 
A. simii   43                        CCAGCGCCTC CAGGACC.GG CCGCTC.... TGGCCTCAGA A.T.CTG... 
A. simii   47                        CCAGCGCCCC CAGGACC.GG CCGCCC.... TGGCCTCAGA A.T.CTG... 
T. m. var. mentagrophytes 20         CCAGCGCCTC CAGGAC..GG CCGCTC.... CGGCCTCAGA A.T.CTG... 
T. m. var. quinckeanum 19            CCAGCGCCTC CAGGACC.GG CCGCTC.... CGGCCTCAGA A.TACTG... 
T.schoenleinii 2                     CCAGCGCCTC CAGGACC.GG CCGCTC.... TGGCCTCAGA A.T.CTG... 
T.schoenleinii 38                    CCAGCGCCTC CAGGACC.GG CCGCTC.... TGGCCTCAGA A.T.CTG... 
A. benhamiae 71                      CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
A. benhamiae 86                      CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. concentricum 66                   CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. concentricum 73                   CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. verruco. var. verrucosum 61       CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC C.AAATC... 
T. verruco. var. verrucosum 6        CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. verruco. var. verrucosum 64       CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. m. var. erinacae 15               CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGGCTTCCC CCAAATC... 
T. m. var. erinacae 68               CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGGCTTCCC CCAAATC... 
T. m. var. granulosum 16             CCAGCGCCCT CAGGACC.GG CCGCTC.... TGGCCTTCCC CCAAATC... 
T. rubrum 37                         TCAGCGCCCT CAGGACC.GG CCGCCC.... TGGCCCCAAT CTTTATA... 
T. rubrum var. granulare 78          CCAGCGCCCT CAGGACC.GG CCGCCC.... TGGCCCCAAT CTTTATA... 
T. megninii 10                       CCAGCGCCCT CAGGACC.GG CCGCCC.... TGGCCCCAAT CTTTATA... 
T. fischeri 76                       TCAGCGCCCT CAGGACC.GG CCGCCC.... TGGCCCCAAT CTTTATA... 
T. kanei  65                         TCAGCGCCCT CAGGACC.GG CCGCCC.... TGGCCCCAAT CTTTATA... 
M. gypseum var. gypseum 12           CCAGCGCCTC TAGGACC.GG CCGGCTC.TC TGGCC.TAGT TTCCGTCAGA 
A. incurvatum 29                     CCAGCGCCTC TAGGACC.GG CCGGCTC.TC TGGCC.TAGT TTCCGTCAG. 
A. fulvum 30                         CCTACGCCTC TAGGACC.GG CCGGCTC.TC TGGCC.TAGT TTCCGTTAGG 
M. fulvum 57                         CCTACGCCTC TAGGACC.GG CCGGCTC.TC TGGCC.TAGT TTCCGTTAGG 
M. persicolor 54                     CCAGCGCCTC TAGGACCCGG CCGGCTC.TC TGGCC.TAGT TTTGGTCAAG 
A. persicolor 53                     CCAGCGCCTC TAGGACCCGG CCGGCTC.TC TGGCC.TAGT TTTGGTCAAG 
E. floccosum  74                     CCAGCGCCTT CAGGACC.GG CCGGCTC.TC TGGCCCTAGT TTGCGTCGGG 
E. floccosum  75                     CCAGCGCCTT CAGGACC.GG CCGGCTC.TC TGGCCCTAGT TTGCGTCGGG 
E. floccosum  14                     CCAGCGCCTT CAGGACC.GG CCGGCTC.TC TGGCCCTAGT TTGCGTCGGG 
T. ajelloi var. nanum 82             CCAGCGCTTC TAGGACC.GA CCGGCCC.C. TAGCCTCCAA ACAAACTA.. 
T. ajelloi 49                        CCAGCGCTTC TAGGACC.GA CCGGCCC.C. TAGCCTCCAA ACAAACAG.. 
A. uncinatum 50                      CCAGCGCTTC TAGGACC.GA CCGGCCC.C. TAGCCTCCAA ACAAACAG.. 
T. vanbreuseghemii 26                CCAGCGCTTA TAGGACC.AG CCGGCAC.T. TGGTCTTTAA CCAATG.... 
A. insingulare 27                    CCAGCGCTTC TAGGACC.GG CCGGCAC.T. TGGCCTTTAA CCAAAGTC.. 
T. equinum var. equinum 44           CCAGCGCTTC TAGGACC.GA CCGGCCC.C. TAGCCTCCAA ACAAACAG.. 
T. equinum var. autotrophicum 85     CCAGCGCCTC CAGGACC.GG CCGCCC.... TGGCCTCAAA A..TCTG... 
T. equinum var. autotrophicum 67     CCAGCGCCTC CAGGACC.GG CCGCC..... TGGCCTCAAA A..TCTG...
E. stockdaleae 31                    CCAGCGCTTC TAGGACC.GA CCGGCCC.C. TAGCCTCCAA ACAAAC.A.. 
T. terrestre 8                       CCACCGCTTC TAGGACC.GG CCGGCAC.T. TGGCCTTCAA ACACGG.... 
A. quafrifidum 24                    CCACCGCTTC TAGGACC.GG CCGGCAC.T. TGGCCTTTAA ACACGG.... 
T. gloriae 89                        CCAACGCTCC AGGGCCC.GG CCGGCAC.C. TGGCCTC..G CCAGAT.G.. 
A. cuniculi 25                       CCACCGCTTC TAGGACC.GG CCGGCAC.C. TGGACTTTAA CTGGAGAGCT 
Chrysosporum keratinophilum 83       TTATCGCTCA AAGACCC.AA TCGGCGC... TGATGTCAGA TTTTTA.... 
Arachniotus ruber 84                 CACACGCTCA CGGCCGG.GA CCGGCGC... CAGTCGATAA CCAAAC.... 
M. gallinae 32                       CCGCCTCTTG GGGGACC.GG CCGGCA..GC TGGCCTC.GT TTCAATAATT 
A. grubyi 56                         CCGCCTCTTG GGGGACC.GG CCGGCA..GC TGGCCTC.GT TTCAATAATT 
M. vanbreuseghemii 55                CCGCCTCTTG GGGGACC.GG CCGGCA..GC TGGCCTC.GT TTCAATAATT 
A. cajetani (M. cookei)87            ..ACCGTCTA AGGGACC.GG CCGGTACTGC TGGCCTT.GA CTGGACT.TC 
M. audouinii 34                      ...CCGCCTC TAGGACC.GG CCGGTAG.GC TGGCCT.... ...AACGCAC 
M. audouinii 13                      ...CCGCCTC TAGGACC.GG CCGGTAG.GC TGGCCT.... ...AACGCAC 
M. audouinii var. langeronii 59      ...CCGCCTC TAGGACC.GG CCGGTAG.GC TGGCCT.... ...AACGCAC 
M. audouinii var. rivalierii 58      ...CCGCCTC TAGGACC.GG CCGGTAG.GC TGGCCT.... ...AACGCAC 
M. ferrugineum 79                    ...CCGCCTC CAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGAAC 
M. ferrugineum 77                    ...CCGCCTC CAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGCAC 
M. canis 33                          ...TCGCCTC CAGGACC.GG CCGGCAG.G. TGGCCT.... ...AACGGAC 
M. canis 69                          ...TCGCCTC CAGGACC.GG CCGGCAG.G. TGGCCT.... ...AACGGAC 
A. otae 51                           ...CCGCCTC TAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGCAC 
A. otae 52                           ...CCGCCTC CAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGCAC 
M. canis var. distortum 70           ...CCGCCTC CAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGCAC 
M. equinum 60                        ...CCGCCTC CAGGACC.GG CCGGCAG.GC TGGCCT.... ...AACGCAC 
                                        ** Indel 6 *****           ***** ** Indel 7 **********        



Speziesname / Labornummer            751                      ITS 2                harr   800
T. m. var. goetzii 17                ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. m. var. interdigitale 22          ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
A. vanbreuseghemii 72                ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. m. var. nodulare 18               ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. tonsurans var. epilans 40         ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. tonsurans 39                      ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. tonsurans 4                       ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. tonsurans var. crateriforme 41    ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. tonsurans var. sulfureum 62       ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. simii   48                        ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
A. simii   43                        ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
A. simii   47                        ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. m. var. mentagrophytes 20         ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. m. var. quinckeanum 19            ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T.schoenleinii 2                     ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T.schoenleinii 38                    ..TTTCT... .......... ......ATAC ..TTATC..A GGTTGACCTC 
A. benhamiae 71                      ..TCTCTG.. .......... ....AGATAT ..TTTTT.CA GGTTGACCTC 
A. benhamiae 86                      ..TCTCTG.. .......... ....AGATAT ..TTTTT.CA GGTTGACCTC 
T. concentricum 66                   ..TCTCTG.. .......... ....AGATAT ..TTTTT.CA GGTTGAACTC 
T. concentricum 73                   ..TCTCTG.. .......... ....AGATAT ..TTTTT.CA GGTTGAACTC 
T. verruco. var. verrucosum 61       ..TCTCTG.. .......... ....AGATTT ..TTTTC..A GGTTGACCTC 
T. verruco. var. verrucosum 6        ..TCTCTG.. .......... ....AGATTT ..TTTTC..A GGTTGACCTC 
T. verruco. var. verrucosum 64       ..TCTCTG.. .......... ....AGATTT ..TTTTC..A GGTTGACCTC 
T. m. var. erinacae 15               ..TCTCTG.. .......... ....AGATTT ..TTTTT.CA GGTTGACCTC 
T. m. var. erinacae 68               ..TCTCTG.. .......... ....AGATTT ..TTTTT.CA GGTTGACCTC 
T. m. var. granulosum 16             ..TCTCTG.. .......... ....AGATAT ..TTTTTTCA GGTTGACCTC 
T. rubrum 37                         ..TATAT... .......... ....ATATAT ..CTTTT.CA GGTTGACCTC 
T. rubrum var. granulare 78          ..TATAT... .......... ....ATAT.. ..CTTTT.CA GGTTGACCTC 
T. megninii 10                       ..TATAT... .......... ....ATATNT ..NNNTN.NA GGTTGACCTC 
T. fischeri 76                       ..TATAT... .......... ....ATATAT ..CTTTT.CA GGTTGACCTC 
T. kanei  65                         ..TATAT... .......... ....ATATAT ..CTTTT.CA GGTTGACCTC 
M. gypseum var. gypseum 12           ..GATGTA.. .......... ...TTTCTCT GCAA..TTTA GGTTGACCTC 
A. incurvatum 29                     ..GATGCA.. .......... ...TTTCTCT GCGAATCTCA GGTTGACCTC 
A. fulvum 30                         ..GATGAA.. .......... ...CTTCCCT ACAA..TTCA GGTTGACCTC 
M. fulvum 57                         ..GATGAA.. .......... ...CTTCCCT ACAA..TTCA GGTTGACCTC 
M. persicolor 54                     ..GACTCG.. .......... ...CTCCTTC ACAA...TCA GGTTGAC.TC 
A. persicolor 53                     ..GACTCG.. .......... ...CTCCTTC ACAA...TCA GGTTGAC.TC 
E. floccosum  74                     AGGACGAAAG GGGGCGACCC CTCTCTCCCC TCCGCATTCA GGTTGACCTC 
E. floccosum  75                     AGGACGAAAG GGGGCGACCC CTCTCTCCCC TCCGCATTCA GGTTGACCTC 
E. floccosum  14                     AGGACGAAAG GGGGCGACCC CTCTCTCCCC TCCGCATTCA GGTTGACCTC 
T. ajelloi var. nanum 82             ..GCCTGA.. .......... ...CGGAC.. ....TTCTTA GGTTGACCTC 
T. ajelloi 49                        ..TCCTGA.. .......... ...CGGAC.. ....TTCTTA GGTTGACCTC 
A. uncinatum 50                      ..TCCTGA.. .......... ...CGGAC.. ....TTCTTA GGTTGACCTC 
T. vanbreuseghemii 26                ..CCCTAA.. .......... ...TAGGC.. ....TATCTA GGTTGACCTC 
A. insingulare 27                    ..CCCCAG.. .......... ...GGACT.. ....CATCTA GGTTGACCTC 
T. equinum var. equinum 44           ..TCCTGA.. .......... ...CGGAC.. ....TTCTTA GGTTGACCTC 
T. equinum var. autotrophicum 85     ..TTT.T... .......... ......ATAC ..TTATC..A GGTTGACCTC 
T. equinum var. autotrophicum 67     ..TTT.T... .......... ......ATAC ..TTATC..A GGT.GACCTC
E. stockdaleae 31                    ..TCCTGA.. .......... ...CGGAC.. ....TTCTTA GGTTGACCTC 
T. terrestre 8                       ..TCTTAA.. .......... ...CTGAC.. ....CATCTA GGTTGACCTC 
A. quafrifidum 24                    ..TCTTAA.. .......... ...CTGAC.. ....CATCTA GGTTGACCTC 
T. gloriae 89                        ..TACATA.. .......... ...CGTATAT CTTTCTTCTA GGTTGACCTC 
A. cuniculi 25                       ..CCTTGG.. .......... ...CTGGAGC TCTACTTCTA GGTTGACCTC 
Chrysosporum keratinophilum 83       ....TC.... .......... .......... ........CA GTTTGACCTC 
Arachniotus ruber 84                 ..TATTTA.. .......... .......... ......TCAA GGTTGACCTC 
M. gallinae 32                       ..GTCGTT.. .......... ...AGAGAAT TATTCTTCAA GGTTGACCTC 
A. grubyi 56                         ..GTCGTT.. .......... ...AGAGAAT TATTCTTCAA GGTTGACCTC 
M. vanbreuseghemii 55                ..GTCGTT.. .......... ...AGAGAAT TATTCTTCAA GGTTGACCTC 
A. cajetani (M. cookei)87            ..TTTGTC.. .......... ...CGTTAA. .ATTTTTTCA GGTTGACCTC 
M. audouinii 34                      ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. audouinii 13                      ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. audouinii var. langeronii 59      ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. audouinii var. rivalierii 58      ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. ferrugineum 79                    ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. ferrugineum 77                    ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. canis 33                          ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. canis 69                          ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
A. otae 51                           ..CATGT... .......... .......... .ATTATTC.A GGTTGAC.TC 
A. otae 52                           ..CATGT... .......... .......... .ATTATTC.A GGTTGAC.TC 
M. canis var. distortum 70           ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
M. equinum 60                        ..CATGT... .......... .......... .ATTATTC.A GGTTGACCTC 
                                        ********** ** Indel 7 ********** **********



Speziesname / Labornummer            801                       LSU                      850
T. m. var. goetzii 17                GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. interdigitale 22          GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. vanbreuseghemii 72                GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. nodulare 18               GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. tonsurans var. epilans 40         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. tonsurans 39                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. tonsurans 4                       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. tonsurans var. crateriforme 41    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. tonsurans var. sulfureum 62       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. simii   48                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. simii   43                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. simii   47                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. mentagrophytes 20         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. quinckeanum 19            GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T.schoenleinii 2                     GGATCAGGTA GGGATACCCG CTGAACTTAA .CATATCAAT AAGCGGAGGA 
T.schoenleinii 38                    GGATCAGGTA GGGATACCCG CTGAACTTAA .CATATCAAT AAGCGGAGGA 
A. benhamiae 71                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. benhamiae 86                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. concentricum 66                   GGATCAGGTA GGGATACC.G CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. concentricum 73                   GGATCAGGTA GGGATACC.G CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. verruco. var. verrucosum 61       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. verruco. var. verrucosum 6        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. verruco. var. verrucosum 64       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. erinacae 15               GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. erinacae 68               GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. m. var. granulosum 16             GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. rubrum 37                         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. rubrum var. granulare 78          GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. megninii 10                       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. fischeri 76                       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. kanei  65                         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. gypseum var. gypseum 12           GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. incurvatum 29                     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. fulvum 30                         GGATCAGGTA GGGATACCCG CTGAAACTTA GCATATCAAT AAGCGGAGGA 
M. fulvum 57                         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. persicolor 54                     GGATCAGGTA GGGATACCGC TGAACCTTAA GCATATCAAT AAGCGGAGGA 
A. persicolor 53                     GGATCAGGTA GGGATACCGC TGAACCTTAA GCATATCAAT AAGCGGAGGA 
E. floccosum  74                     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
E. floccosum  75                     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
E. floccosum  14                     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. ajelloi var. nanum 82             GGATCAGGTA GG.ATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. ajelloi 49                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. uncinatum 50                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. vanbreuseghemii 26                GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. insingulare 27                    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. equinum var. equinum 44           GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. equinum var. autotrophicum 85     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. equinum var. autotrophicum 67     GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA
E. stockdaleae 31                    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATACTAAT AAGCGGAGGA 
T. terrestre 8                       GAATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. quafrifidum 24                    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
T. gloriae 89                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. cuniculi 25                       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
Chrysosporum keratinophilum 83       GGATCAGGTA GGAGTACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
Arachniotus ruber 84                 GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. gallinae 32                       GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. grubyi 56                         GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. vanbreuseghemii 55                GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. cajetani (M. cookei)87            GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. audouinii 34                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. audouinii 13                      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. audouinii var. langeronii 59      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. audouinii var. rivalierii 58      GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. ferrugineum 79                    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. ferrugineum 77                    GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. canis 33                          GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. canis 69                          GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. otae 51                           GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
A. otae 51                           GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. canis var. distortum 70           GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 
M. equinum 60                        GGATCAGGTA GGGATACCCG CTGAACTTAA GCATATCAAT AAGCGGAGGA 



Speziesname / Labornummer            851 LR 1   863                         rekodierte Indels
T. m. var. goetzii 17                AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. m. var. interdigitale 22          AAAGAAACCA ACC                        1  1  1  1  1  0  0
A. vanbreuseghemii 72                AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. m. var. nodulare 18               AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. tonsurans var. epilans 40         AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. tonsurans 39                      AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. tonsurans 4                       AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. tonsurans var. crateriforme 41    AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. tonsurans var. sulfureum 62       AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. simii   48                        AAAGAAACCA ACC                        1  1  1  1  1  0  0
A. simii   43                        AAAGAAACCA ACC                        1  1  1  1  1  0  0
A. simii   47                        AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. m. var. mentagrophytes 20         AAAGAAACCA ACC                        1  1  1  1  1  0  0
T. m. var. quinckeanum 19            AAAGAAACCA ACC                        1  1  1  1  1  0  0
T.schoenleinii 2                     AAAGAAACCA ACC                        1  1  1  1  1  0  0
T.schoenleinii 38                    AAAGAAACCA ACC                        1  1  1  1  1  0  0
A. benhamiae 71                      AAAGAAACCA ACC                        1  1  1  2  2  0  1
A. benhamiae 86                      AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. concentricum 66                   AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. concentricum 66                   AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. verruco. var. verrucosum 61       AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. verruco. var. verrucosum 6        AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. verruco. var. verrucosum 64       AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. m. var. erinacae 15               AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. m. var. erinacae 68               AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. m. var. granulosum 16             AAAGAAACCA ACC                        1  1  1  2  2  0  1
T. rubrum 37                         AAAGAAACCA ACC                        1  1  1  2  2  0  2
T. rubrum var. granulare 78          AAAGAAACCA ACC                        1  1  1  2  2  0  2
T. megninii 10                       AAAGAAACCA ACC                        1  1  1  2  2  0  2
T. fischeri 76                       AAAGAAACCA ACC                        1  1  1  2  2  0  2
T. kanei  65                         AAAGAAACCA ACC                        1  1  1  2  2  0  2
M. gypseum var. gypseum 12           AAAGAAACCA ACC                        2  1  2  3  3  0  3
A. incurvatum 29                     AAAGAAACCA ACC                        2  1  2  3  3  0  3
A. fulvum 30                         AAAGAAACCA ACC                        2  1  2  3  3  0  3
M. fulvum 57                         AAAGAAACCA ACC                        2  1  2  3  3  0  3
M. persicolor 54                     AAAGAAACCA ACC                        2  1  2  3  3  0  3
A. persicolor 53                     AAAGAAACCA ACC                        2  1  2  3  3  0  3
E. floccosum  74                     AAAGAAACCA ACC                        2  1  4  4  4  0  4
E. floccosum  75                     AAAGAAACCA ACC                        2  1  4  4  4  0  4
E. floccosum  14                     AAAGAAACCA ACC                        2  1  4  4  4  0  4
T. ajelloi var. nanum 82             AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. ajelloi 49                        AAAGAAACCA ACC                        3  2  5  5  5  1  5
A. uncinatum 50                      AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. vanbreuseghemii 26                AAAGAAACCA ACC                        3  2  5  5  5  1  5
A. insingulare 27                    AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. equinum var. equinum 44           AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. equinum var. autotrophicum 85     AAAGAAACCA ACC                        3  2  5  7  6  1  5
T. equinum var. autotrophicum 67     AAAGAAACCA ACC                        3  2  5  7  6  1  5
E. stockdaleae 31                    AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. terrestre 8                       AAAGAAACCA ACC                        3  2  5  5  5  1  5
A. quafrifidum 24                    AAAGAAACCA ACC                        3  2  5  5  5  1  5
T. gloriae 89                        AAAGAAACCA ACC                        3  2  5  6  5  1  5
A. cuniculi 25                       AAAGAAACCA ACC                        3  2  5  5  5  1  5
Chrysosporum keratinophilum 83       AAAGAAACCA ACC                        7  5  5  9  5  3  D
Arachniotus ruber 84                 AAAGAAACCA ACC                        7  5  5  9  5  3  D
M. gallinae 32                       AAAGAAACCA ACC                        5  3  6  7  6  2  7
A. grubyi 56                         AAAGAAACCA ACC                        5  3  6  7  6  2  7
M. vanbreuseghemii 55                AAAGAAACCA ACC                        5  3  6  7  6  2  7
A. cajetani (M. cookei)87            AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. audouinii 34                      AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. audouinii 13                      AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. audouinii var. langeronii 59      AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. audouinii var. rivalierii 58      AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. ferrugineum 79                    AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. ferrugineum 77                    AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. canis 33                          AAAGAAACCA ACC                        6  3  7  8  7  1  8
M. canis 69                          AAAGAAACCA ACC                        6  3  7  8  7  1  8
A. otae 51                           AAGAAAACCA ACC                        6  3  7  8  7  1  8
A. otae 51                           AAGAAAACCA ACC                        6  3  7  8  7  1  8
M. canis var. distortum 70           AAAGAAACCA ACC                        6  3  7  8  7  1  8 
M. equinum 60                        AAAGAAACCA ACC                        6  3  7  8  7  1  8

Alignment 2: Sequenzvergleich der in der Arbeit verwendeten Isolate. Die zur Amplifizieung der ITS-Regionen verwendeten Primer wurden fett markiert. Die Indels 1-7 bezeichnen Regionen, die von der Parsimonie-Analyse ausgeschlossen und dann als einzelne Charaktere am Ende des Alignment rekodiert wurden.


[Titelseite] [Widmung] [1] [2] [3] [4] [5] [6] [Bibliographie] [Anhang] [Abkürzungsverzeichnis] [Lebenslauf] [Selbständigkeitserklärung]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Thu Apr 6 19:59:06 2000