El Fari, Mustafa: Untersuchungen zur Taxonomie und Phylogenie der Familie Arthrodermataceae (Dermatophyten) und Entwicklung einer spezifischen Sonde für Trichophyton rubrum.

39

Kapitel 4. Ergebnisse

4.1. Vergleich unterschiedlicher Verfahren zur DNA-Extraktion bei Dermatophyten

Die mechanische Stabilität ihrer Zellwand verleiht den Pilzzellen die Fähigkeit, verschiedene Formen anzunehmen und verzweigte Hyphen sowie Sporen unterschiedlicher Größe zu bilden. Die Zellwand der Ascomyceten, zu den unter anderem die Dermatophyten gehören, besteht aus Chitin, beta(1-3)-beta(1-6)-Glucan, alpha(1-3)-Glucan und Galaktomannoproteinen (Gooday 1995), die kovalent miteinander quervernetzt sind. Die chemische und physikalische Zusammensetzung der Zellwände schützt den Protoplast vor einer Reihe von Umwelteinflüssen: dem Aufplatzen durch den osmotischen Druck, Schäden durch ultraviolette Strahlung, enzymatische Lyse, organische Lösungsmittel, giftige Chemikalien und Austrocknung (De Nobel et al. 1989).

Wegen der großen Stabilität ihrer Zellwand bereitete die DNA-Extraktion aus Dermatophyten-Zellen große Schwierigkeiten. In dieser Arbeit wurden verschiedene Methoden ausgetestet, um möglichst große Mengen reiner und wenig degradierter DNA zu erhalten. Prinzipiell sollten bei einer DNA-Präparationsmethode folgende Kriterien beachtet werden:

  1. Rasche Inaktivierung zellulärer DNAsen
  2. Vermeidung mechanischer Scherkräfte, um eine unspezifische Fragmentierung der DNA auszuschließen
  3. Restlose Entfernung der mit der DNA assoziierten Proteine
  4. Ausreichende Reinigung der DNA für nachfolgende PCR-Amplifizierungen.

Die Präparationsmethode nach Gruber, die sich z.B. bei der DNA-Isolation aus Hefezellen bewährt hat (Schönian et al. 1993), erbrachte für Dermatophyten leider nur geringe DNA-Ausbeuten. Das könnte auf folgende Gründe zurückzuführen sein:

  1. Nach dem Mörsern in N2 blieben noch viele intakte Dermatophyten-Zellen erhalten.

    40

  2. Aufgrund fehlender Proteinase-K-Behandlung und nicht ausreichender Reinigungsschritte enthielten die DNA-Proben noch Proteinkontaminationen, die eine weitere Verwendung der DNA z.B. in der PCR erschwerte.

Es wurden daher andere Methoden verwendet, insbesondere um einen besseren Zellaufschluß zu erreichen. Die Verwendung einer Magnetmühle (siehe 3.2.2.1) führte zwar tatsächlich zu einer effizienteren Zellyse, hatte aber den Nachteil, daß durch die schnellen Hin- und Herbewegungen der Stahlspäne in dem magnetischen Feld höhere Scherkräfte auftraten. Dies führte zu stark fragmentierten DNA-Proben ( Abb. 7 ), die insbesondere für die PCR-Amplifikation mit Zufallsprimern beim PCR-Fingerprinting (s. 42) nicht geeignet waren.

Abb. 7: Agarosegelelektophorese von gereinigter Dermatophyten-DNA

Bahnen 1-5: Zellaufschuß mit der Magnetmühle, Bahnen 6-10: Zellaufschluß durch Mörsern in flüssigem N2, M= Molekulargewichtsstandard (1 Kb-Leiter). Die besten Ergebnisse bei der Zellyse wurden durch eine Kombination von mechanischer Einwirkung sowie Frieren und Tauen erreicht (siehe 3.2.2.3). Dazu wurden die Zellen in flüssigem Stickstoff gemörsert, 3x in N2 gefroren und anschließend bei 80 °C schnell aufgetaut.


41

Durch die anschließende Proteinase-K-Behandlung wurden die DNasen und die meisten anderen Proteine denaturiert. Die DNA-Reinigung mit Chloroform-Phenol- Isoamylalkohol-Gemisch führte zu einem relativ hohen Reinigungsgrad, aber auch zu einem entsprechenden DANN-Verlust. Diese Reinigungsmethode ist deswegen nur bei Maxi-DNA-Präparation sinnvoll anzuwenden. Bei kleinen Mengen sollten DNA-Reinigungskits verwendet werden, die keine Phenol-Reinigungsschritte beinhalten.

Für eine schnellere Identifizierung von Trichophyton rubrum mit der TRS-20-Sonde ohne vorherige Anzucht sollte eine einfache DNA-Extraktionsmethode direkt aus Patientenmaterial etabliert werden, was sich jedoch als sehr problematisch erwies. Während die Dermatophyten-DNA erfolgreich aus den zwei infizierten Hautproben isoliert werden konnte, bereitete die DNA-Extraktion aus 35 Nagelproben, bei denen Trichophyton rubrum mikroskopisch nachgewiesen war, große Probleme ( Abb. 8 ).

Abb. 8: Nachweis von Dermatophyten-DNA durch ihre Amplifizierung mit den Primern LR1 und SR6R

Bahnen 1a und 2a: isolierte DNA aus infizierter Haut, Bahnen 1 - 3: isolierte DNA aus Nagelmaterial und M= Molekulargewichtsstandard (1 Kb-Leiter)


42

Da bis jetzt keine effiziente DNA-Isolationsmethode aus Nagelmaterial beschrieben ist, wurde zunächst versucht, eine leicht modifizierte Mini-Präparationsmethode (siehe 3.2 2.3) anzuwenden. Vorversuche zeigten jedoch, daß diese Methode nicht gut geeignet war, weil sich die äußert stabile Nagelstruktur nicht durch Mörsern allein aufschließen ließ und weil große DNA-Verluste bei den Phenol-Extraktionen auftraten. Zunächst wurden verschiedene zusätzliche Zellaufschluß-Methoden getestet:

  1. Das Nagelmaterial wurde erst mit Proteinase-K (über Nacht) verdaut. Bei dieser Methode blieb jedoch die Nagelstruktur noch weitgehend intakt.
  2. Durch eine Verdauung des Materials mit dem Enzym Lytikase (3 h) vor der Proteinase-K-Behandlung sollte ein effektiverer Aufschluß des Nagelmaterials erreicht werden. Mit dieser Vorbehandlung war jedoch keine Verbesserung im Vergleich zu der alleinigen Behandlung mit Proteinase-K zu verzeichnen.
  3. Das Nagelmaterial wurde erst durch eine 10- stündige Inkubation in 15 -20%ige KOH aufgelöst. Im Anschluß an diese Vorbehandlungen wurden die Proben wie üblich in flüssigem Stickstoff gemörsert und durch wiederholtes Frieren und Tauen aufgeschlossen.

Es ist unklar, ob mit den oben aufgeführten Verfahren zum Zellaufschluß tatsächlich alle Dermatophyten-Zellen lysiert werden konnten. Verluste könnten auch darauf zurückzuführen sein, daß ein Teil der DNA an der rauhen Mörserinnenfläche bzw. zwischen den Poren hängen blieb.

Zur Vermeidung weiterer DNA-Verluste bei der Phenol-Chloroform-Isoamylalkohol-Extraktion wurden für die weitere Reinigung der DNA unterschiedliche DNA-Präparationskits verschiedener Firmen (siehe. 3.2.2.4) verwendet. Die Quantität und die Qualität der mit diesen Methoden isolierten DNA wurde anhand der Amplifizierung der ITS-Region überprüft.

Auch bei Anwendung der modifizierten Zellaufschlußverfahren und unterschiedlicher DNA-Extraktionskits konnte kein zufriedenstellendes Ergebnis bei der Isolierung von Dermatophyten-DNA aus infiziertem Nagelmaterial erzielt werden. Nur bei 10 von insgesamt 35 Nagelproben, bei denen Trichophyton rubrum mikroskopisch nachweisbar war, gelang die Identifizierung dieses


43

Erregers über die Amplifizierung der ITS-Region ( Abb. 8 ) und die anschließende Hybridisierung mit der TR20S-Sonde. Möglicherweise könnte eine kurze Kultivierung des infizierten Materials in flüssigem Nährmedium zu einer Verbesserung des PCR-Nachweises führen.

Sowohl von den Nagelproben, bei denen Trichophyton rubrum in der PCR nachweisbar war, als auch von den negativen Proben wurde keine humane DNA amplifiziert. Dies konnte durch die Amplifikation mit den human-spezifischen Primern für das Gen DXYS156 (DXYS156X und DXYS156Y) in der PCR gezeigt werden. Nur bei der positiven Kontrolle (humane DNA aus Blut) wurde das erwartete PCR-Produkt erhalten ( Abb. 9 ). Bei der Amplifikation von humaner DNA mit den Kontrollprimern wurden unterschiedlich große Amplifikate für Männer (165 bp) und Frauen (160 bp) erhalten; d.h. daß diese Primer verschiedene Allele auf dem X-Chromosom amplifizieren (Chen 1994).

Abb. 9: Nachweis humaner DNA mit den Primern DXYS156X und DXYS156Y unter Verwendung von 2 verschiedenen Polymerasen

Bahn 1-6: mit TFL-Polymerase, Bahn 1a und 2a: mit Taq-Polymerase, Bahnen 1 und 2a: DNA aus nicht infiziertem humanen Blut (Frau), Bahnen 2 und 1a: DNA aus nicht infiziertem humanen Blut (Mann), Bahn 3-6: genomische DNA aus mit T. rubrum infiziertem Nagelmaterial und M= Molekulargewichtsstandard (1 Kb-Leiter)


44

4.2. Identifizierung und Charakterisierung der Dermatophyten mittels PCR-Fingerprinting

Das PCR-Fingerprinting wurde zur Charakterisierung verschiedener Spezies der Familie Arthrodermataceae eingesetzt mit dem Ziel der Typisierung solcher klinischen Isolate, die mit konventionellen Techniken nicht oder schwer zu differenzieren waren. Bei jedem Versuch wurden dabei die erhaltenen Muster mit denen von Referenzstämmen der Arthrodermataceae ( Tab. 5 ) verglichen.

Zunächst wurde, wie unter 3.2.2.3 beschrieben, die genomische DNA präpariert und mit den Fingerprinting-Primern M13core, AP3, T3B, und (AC)10 amplifiziert (siehe 3.2.4.3). Alle Primer erzeugten charakteristische PCR-Profile, die sich jedoch in der Anzahl, in der Intensität und in der Größe der amplifizierten Fragmente unterschieden ( Abb. 10 und Abb. 11 ). Beim PCR-Fingerprinting mit den verschiedenen Primern wurden Amplifikationsprodukte, die zwischen 0,2 - 4,0 Kb groß waren, erhalten. Die Abbildungen ( Abb. 10 a und b) zeigen charakteristische Amplifikationsmuster für jede der 17 untersuchten Spezies mit den Primern M13 core und AP3. Bei 4 Gruppen von Speziespaaren wurden ähnliche Fingerprintingprofile beobachtet:

  1. Trichophyton mentagrophytes var. erinacei und Trichophyton verrucosum ( Abb. 10 b)
  2. Microsporum canis und Microsporum audouinii ( Abb. 10 a)
  3. Microsporum vanbreuseghemii und Microsporum gallinae ( Abb. 10 a)
  4. Trichophyton mentagrophytes-Variante nodulare bzw. interdigitale und Trichophyton tonsurans mit all seinen Varianten ( Abb. 11 b).

Die PCR-Fingerprintingmuster von Trichophyton schoenleinii und Trichophyton mentagrophytes var. mentagrophytes wiesen geringere Ähnlichkeiten ( Abb. 10 ). Die 6 verschiedenen Trichophyton mentagrophytes-Varianten ( Tab. 5 ) konnten anhand ihrer charakteristischen Fingerprintingmuster in 3 Gruppen eingeteilt werden:


45

Abb. 10: PCR-Fingerprinting von verschiedenen Dermatophyten-Spezies mit den Primern M13 (A) und AP3 (B)

(A und B) Bahn 1: T. m. var. Mentagrophytes, Bahn 2: T. m. var. Nodulare, Bahn 3: T. m. var. erinacei (15), Bahn 4: T. verrucosum (6), Bahn 5: T. tonsurans, Bahn 6: T. rubrum (37), Bahn 7: T. schoenleinii (38), Bahn 8: T. concentricum (36), Bahn 9: T. terrestre, Bahn 10: T. ajelloi, Bahn 11: M. canis (33), Bahn 12: M. audouinii (34), Bahn 13: M. vanbreuseghemii, Bahn 14: M. gallinae, Bahn 15: M. gypseum, Bahn 16: M. fulvum, Bahn 17: M. persicolor (54), Bahn 18: E. stockdaleae, Bahn 19: E. floccosum (74), und M = Molekulargewichtsstandard (1 Kb-Leiter)


46

Abb. 11: Differenzierung von Trichophyton-Varianten und Identifizierung klinischer Isolate mittels PCR-Fingerprinting mit den Primern M13 (A) und AP3 (B)

(A und B) Bahn 1: T. m. var. quinckeanum, Bahn 2: T. m. var. mentagrophytes, Bahn 3: T. m. var. interdigitale, Bahn 4: T. m. var. nodulare, Bahn 5: T. m. var. erinacei (15), Bahn 6: T. m. var. granulosum, Bahn 7: atypisches klinisches Isolat von T. mentagrophytes (NB 6), Bahn 8: T. tonsurans (39), Bahn 9: T. t. var. epilans, Bahn 10: Trichophyton t. var. crateriforme, Bahn 11: T. t. var. sulfureum (62), Bahnen 12-13: klinische Isolate von T. tonsurans (A7 und A6), Bahn 14: T. rubrum (37), Bahn 15: klinisches Isolat von T. rubrum (R1), Bahn 16: T. t. var. sulfureum, Bahn 17: M. canis, Bahn 18: atypisches klinisches Isolat von M. canis (NB 3) und M= Molekulargewichtsstandard (1 Kb-Leiter)


47

  1. Trichophyton mentagrophytes var. granulosum und Trichophyton mentagrophytes var. erinacei ( Abb. 11 b)
  2. Trichophyton mentagrophytes var. mentagrophytes und Trichophyton mentagrophytes var. quinckeaum ( Abb. 11 a und b)
  3. Trichophyton mentagrophytes var. interdigitale und Trichophyton mentagrophytes var. nodulare. ( Abb. 11 a und b)

Während die Varianten granulosum und erinacei mit allen Primern ähnliche, aber nicht identische PCR-Profile zeigten, konnten die Varianten in den beiden letzteren Gruppen, unabhängig davon, welcher Primer verwendet wurde, nicht unterschieden werden.

Bei Trichophyton tonsurans und seinen Varianten Trichophyton tonsurans var. sulfureum, Trichophyton tonsurans var. crateriforme und Trichophyton tonsurans var. epilans waren die PCR-Fingerprinting-Profile, die mit den verschiedenen Primern erzeugt wurden, identisch ( Abb. 11 a und b).

Bei Verwendung von Primer (AC)10 ( Abb. 12 ) wurden im PCR-Fingerprinting ähnliche Bandenmuster bei Trichophyton rubrum, Trichophyton rubrum var. granulare, Trichophyton megninii , Trichophyton kanei, Trichophyton fischeri, Trichophyton soudanense und Trichophyton violaceum beobachtet, eine bessere Diskriminierung dieser Spezies wurde mit dem Primer T3B erreicht. Diese Ergebnisse lassen folgende Schlußfolgerungen zu:

  1. Trichophyton rubrum und Trichophyton kanei; Trichophyton fischeri und Trichophyton rubrum var. granulare; Trichophyton megninii und Trichophyton soudanense zeigten gleiche PCR-Fingerprinting-Profile.
  2. Trichophyton violaceum-PCR-Fingerprinting-Muster wiesen die größte Ähnlichkeit zu denen der Trichophyton megninii- und Trichophyton soudanense-Isolate auf.

Um die Beziehung zwischen Microsporum canis und anderen nahestehenden Microsporum-Spezies zu untersuchen, wurde ebenfalls ein PCR-Fingerprinting mit den Primern (AC)10 und (T3B) durchgeführt. In Abbildung ( Abb. 13 ) ist zu sehen, daß die PCR-Profile von Microsporum canis, Microsporum canis var. distortum und Microsporum equinum identisch sind. Die PCR-Muster von Microsporum audouinii, Microsporum audouinii var. rivalierii, Microsporum audouinii var. langeronii, Microsporum canis, Microsporum canis var. distortum, Microsporum equinum und Microsporum ferrugineum waren mit beiden Primern ähnlich.


48

Abb. 12: DNA-Fingerprinting von Trichophyton rubrum und nah verwandten Spezies mit den Primern (AC)10 (1-9) und T3B (1a-9a)

Bahn 1: T. rubrum (37), Bahn 2: T. kanei, Bahn 3: T. fischeri, Bahn 4: T. megninii, Bahn 5: T. r. var. granulare, Bahn 6: T. soudanense, Bahn 7: T. violaceum, Bahn 8: T. m. var. erinacei (15), Bahn 9: T. verr. var. verrucosum und M= Molekulargewichtsstandard (1Kb-Leiter)

Abb. 13: DNA-Fingerprinting von Microsporum canis und nah verwandten Spezies mit den Primern (AC)10 (1-9) und T3B (1a-9a)

Bahn 1: M. audouinii (34), Bahn 2: M. audou. var. rivalierii, Bahn 3: M. audo. var. langeronii, Bahn 4: M. canis (69), Bahn 5: M. c. var. distortum, Bahn 6: M. equinum, Bahn 7: M. ferrugineum (77), Bahn 8: M. gallinae, Bahn 9: M. cookei und M= Molekulargewichtsstandard


49

Die phylogenetisch verwandten Arten Microsporum gallinae und Microsporum cookei konnten jedoch mit beiden Primern sicher unterschieden werden.

Mit Hilfe des PCR-Fingerprinting konnten auch anamorphe (ana.) und teleomorphe (teleo.) Partner identifiziert werden. Unter Verwendung der Primer (AC)10 und T3B wurden für die folgenden anamorphen Dermatophyten-Spezies und ihre dazugehörigen teleomorphen Formen identische PCR-Fingerprintingmuster erhalten ( Abb. 14 A und B):

  1. Microsporum persicolor (ana.) und Arthroderma persicolor (teleo.),
  2. Trichophyton terrestre (ana.) und Arthroderma quadrifidum (teleo.).

Die PCR-Profile von Trichophyton terrestre und seiner zweiten teleomorphen Form Arthroderma insingulare waren allerdings klar unterschiedlich ( Abb. 15 und 4.10; Bahn 16 - NB7, Bahn 17 - NB8). Ähnliche PCR-Profile zeigten:

  1. Trichophyton mentagrophytes var. interdigitale (ana.) und Arthroderma van- breusehemii (teleo.),
  2. Microsporum canis (ana.) und Arthroderma otae (teleo.),
  3. Microsporum gallinae (anamorph) und die telemorphe Arthroderma grubyi (teleo.),
  4. Trichophyton mentagrophytes var. granulosum (ana.) und Arthroderma benhamiae (teleo.),
  5. Microsporum fulvum (ana.) und Arthroderma fulvum (teleo.).

Die artspezifischen DNA-Polymorphismen, die beim PCR-Fingerprinting nachweisbar waren, wurden für die Identifizierung klinischer Dermatophyten-Isolate verwendet. In Abb. 11 sind die Ergebnisse für 5 klinische Isolate dargestellt (NB3, NB6, A6, A7 und R1, siehe Tab. 8 ). Bei 2 von diesen Isolaten konnte die auf Grund der phänotypischen Merkmale erfolgte Identifizierung als Trichophyton tonsurans (Bahn 12) bzw. Trichophyton rubrum (Bahn 15) bestätigt werden. Die Identifizierung der anderen drei Isolate war morphologisch problematisch, weil ihre Konidienbildung reduziert oder ausgeblieben war. Mit dem PCR-Fingerprinting konnte gezeigt werden, daß es sich bei diesen drei Isolaten um Trichophyton tonsurans (Bahn 13, A6) Trichophyton mentagrophytes var. granulosum (Bahn 7, NB6) und Microsporum canis (Bahn 18, NB3) handelt ( Abb. 11 a und b).


50

Abb. 14: PCR-Fingerprinting von anamorphen (A) Dermatophyten-Spezies und den dazugehörigen teleomorphen (T) Formen mit den Primern a= (AC)10 und b= T3B

(a und b) Bahn 1: T. m. var. granulosum, Bahn 2: A. benhamiae (71), Bahn 3: T. m. var. nodulare, Bahn 4: T. m. var. interdigitale (22), Bahn 5: A. vanbreuseghemii, Bahn 6: M. canis (69), Bahn 7: M. canis (33), Bahn 8: A. otae (51), Bahn 9: A. otae (52), Bahn 10: M. fulvum, Bahn 11: A. fulvum, Bahn 12: M. persicolor, Bahn 13: A. persicolor, Bahn 14: M. gallinae, Bahn 15: A. grubyi, Bahn 16: T. terrestre, Bahn 17: A. quadrifidum und M= Molekulargewichtsstandard (1Kb-Leiter)


51

Tab. 8: Klinische Isolate und CBS-Referenzstämme, die bei der Fingerprinting-Studie verwendet wurden

Spezies

CBS Nr.:

Isolations-stelle

Quelle

Geogr. Herkunft

A. behamiae

623.66

Unbekannt

Mensch

GB

A. insingulare

521.71

Erde

 

Kanada

A. quadrifidum

464.62

Zeh

Mensch

Holland

M. canis ?

NB3

Haar

Katze

Rostock

T. equinum

292.81

Haar/Haut

Pferd

Holland

T. equinum ?

NB14

Haar/Haut

Pferd

Jena

T. mentagrophytes ?

NB6

Haar

Schwein

Rostock

T. mentagrophytes ?

NB10

Haar/Haut

Rind

M/V

T. mentagrophytes ?

NB11

Haar/Haut

Pferd

M/V

T. m. var. interdigitale

558.66

Haut

Mensch

Holland

T. m. var. nodulare

429.63

Haut

Mensch

Holland

T. m. var. goetzii

392.68

Haut

Mensch

Holland

T. m. var. mentagrophytes

318.56

Unbekannt

Mensch

Holland

T. m. var. quinckeanum

106.67

Haut

Mensch

Holland

T. m. var. erinacei

344.79

Haut

Mensch

Holland

T. m. var. granulosum

280.83

Zeh

Mensch

Holland

T. rubrum

R1

Nagel

Mensch

Berlin

T. soudanense ?

A20

Haut

Mensch

Cottbus

T. soudanense ?

A21

Haut

Mensch

Afrika

T. terrestre ?

NB7

Haar/Haut

Mensch

M/V

T. terrestre ?

NB8

Haar/Haut

Mensch

M/V

T. tonsurans ?

A6

Haut

Mensch

Cottbus

T. tonsurans ?

A7

Haut

Mensch

Berlin

T. verrucosum?

NB15

Haar/Haut

Rind

M/V

T. verrucosum var. ochraceum

564.50

Unbekannt

Mensch

Holland

T. verrucosum

134.66

Haar

Mensch

Holland

T. verrucosum

554.84

Haut

Mensch

Holland

M/V= Mecklenburg Vorpommern; ?= klinische Isolate


52

Die Abbildungen ( Abb. 15 und Abb. 16 ) zeigen die Ergebnisse der Fingerprinting-Analyse von weiteren 8 schwer zu identifizierenden Isolaten ( Tab. 8 ) aus verschiedenen Städten Deutschlands.

Mit der konventionellen Diagnostik wurden diese Isolate wie folgt identifiziert: 2 Trichophyton soudanense, 2 Trichophyton terrestre, 1 Trichophyton equinum, 1 Trichophyton verrucosum und 2 Trichophyton mentagrophytes. Alle Isolate waren atypisch in Bezug auf ihre morphologischen und physiologischen Merkmale. Die genotypische Charakterisierung ergab, daß die beiden als Trichophyton soudanense identifizierten Isolate (A20 und A21, Bahn 1 und 2) das gleiche PCR-Profil wie die Trichophyton mentagrophytes-Varianten interdigitale, nodulare und goetzii aufwiesen. ( Abb. 15 und Abb. 16 ). Das gleiche traf auch für 2 weitere Isolate zu, die morpholgisch als Trichophyton equinum (NB14, Bahn 3) und Trichophyton mentagrophytes (NB 11, Bahn 4) bestimmt worden waren. Die phänotypische Differenzierung dieser beiden Spezies ist oft schwierig und basiert nur auf der Nikotinsäureabhängigkeit von Trichophyton equinum, welche manchmal keine eindeutige Aussagen zuläßt. Das Isolat NB10 (Bahn 8) wurde aufgrund der vermehrten Mikrokonidien- und fehlenden Chlamydosporenbildung als Trichophyton mentagrophytes identifiziert. Das für das Isolat erhaltene Fingerprintingmuster (Bahn 8) entspricht jedoch dem für Trichophyton verrucosum. Aus der gleichen Probe wurde auch ein Trichophyton verrucosum-Stamm (NB 15) isoliert, der sowohl phänotypisch als auch genotypisch dieser Spezies zugeordnet werden konnte ( Abb. 15 und Abb. 16 , Bahn 9). Beide Stämme wurden aus Rindern, die gegen Trichophyton verrucosum geimpft worden waren, isoliert. Eine Unterscheidung von Trichophyton verrucosum und seiner Variante ochraceum war mit den verwendeten Primern nicht möglich.

Bei zwei atypischen, geruchlosen Trichophyton terrestre-Isolaten (Bahn 16 - NB7, Bahn 17 - NB8) konnte die phänotypische Identifizierung im PCR-Fingerprinting bestätigt werden, wobei das PCR-Profil dieser Stämme mit dem der teleomorphen Form Arthroderma quadrifidum übereinstimmte, aber Unterschiede zu dem der zweiten teleomorophen Form Arthroderma insingulare aufwies.


53

Abb. 15: Identifizierung problematischer klinischer Dermatophyten-Isolate (?) anhand des Vergleichs ihrer PCR-Fingerprintingprofile mit dem der entsprechenden CBS-Referenzstämme (Primer T3B)

Bahn 1: T. soudanense? (A20), Bahn 2: T. soudanense? (A21), Bahn 3: T. equinum? (NB14), Bahn 4: T. mentagrophytes? (NB11), Bahn 5: T. m. var. interdigitale, nodulare oder goetzii, Bahn 6: T. m. var. mentagrophytes oder quinckeanum, Bahn 7: T. equinum, Bahn 8: T. mentagrophytes? (NB10), Bahn 9: T. verrucosum? (NB15), Bahn 10: T. verrucosum var. ochraceum, Bahn 11: T. verrucosum, Bahn 12: T. verrucosum, Bahn 13: T. m. var. erinacei, Bahn 14: T. m. var. granulosum, Bahn15: A. benhamiae, Bahn 16: T. terrestre? (NB7), Bahn 17: T. terrestre? (NB8), Bahn 18: A. quadrifidum (anamorph Trichophyton terrestre), Bahn 19: A. insingulare und M = Molekulargewichtsstandard (1Kb-Leiter)


54

Abb. 16: Identifizierung problematischer klinischer Dermatophyten-Isolate (?) anhand des Vergleichs ihrer PCR-Fingerprintingprofile mit den der CBS-Referenzstämme mittels (AC)10 Primer

Bahn 1: T. soudanense? (A20), Bahn 2: T. soudanense? (A21), Bahn 3: T. equinum? (NB14), Bahn 4: T. mentagrophytes? (NB11), Bahn 5: T. m. var. interdigitale, nodulare oder goetzii, Bahn 6: T. m. var. mentagrophytes oder quinckeanum, Bahn 7: T. equinum, Bahn 8: T. mentagrophytes? (NB10), Bahn 9: T. verrucosum? (NB15), Bahn 10: T. verrucosum var. ochraceum, Bahn 11: T. verrucosum, Bahn 12: T. verrucosum, Bahn 13: T. m. var. erinacei, Bahn 14: T. m. var. granulosum, Bahn15: A. benhamiae, Bahn 16: T. terrestre? (NB7), Bahn 17: T. terrestre? (NB8), Bahn 18: A. quadrifidum (anamorph Trichophyton terrestre), Bahn 19: A. insingulare und M = Molekulargewichtsstandard (1Kb-Leiter)


55

4.3. Epidemie-Studie von Trichophyton tonsurans

Im Zeitraum von 1993 - 1996 wurden aus verschiedenen Städten Deutschlands, besonders aus dem Großraum Berlin, 46 Patienten bzw. Pilzisolate von Patienten mit dem Verdacht auf anthropophile Trichophytie in die Ambulanz der Hautklinik der Charité überwiesen. Bei den meisten Patienten wurde mit konventionellen Methoden Trichophyton tonsurans als ätiologisches Agens gefunden. 15 dieser Pilzisolate wiesen jedoch atypische morphologische und physiologische Eigenschaften auf, waren makroskopisch pleomorph und auf den Rückseiten der Kolonien unterschiedlich gefärbt ( Tab. 9 ). Eine eindeutige Identifizierung dieser Isolate war nicht möglich, es wurde aber in fast allen Fällen die Verdachtsdiagnose Trichophyton tonsurans gestellt. Da die meisten dieser Patienten Ringer waren, wurde eine Epidemie durch Trichophyton tonsurans vermutet.

In der vorliegenden Arbeit sollte versucht werden, diese Stämme, bei denen die traditionelle Identifizierung schwierig war, anhand molekularbiologischer Methoden eindeutig zu klassifizieren. Dabei wurden sowohl das PCR-Fingerprinting als auch die Analyse der jeweiligen ITS-Sequenzen genutzt.

Die Isolate wurden je nach ihrer geographischen Herkunft 6 verschiedenen Gruppen zugeordnet. Von jeder Gruppe wurden repräsentative Isolate in die Analyse einbezogen ( Tab. 9 ). Die meisten Patienten waren Ringer. Das Durchschnittsalter der Patienten lag zwischen 7 und 14 Jahren, mit Ausnahme des 40-jährigen Trainers (J6). Die verschiedenen Patientengruppen hatten keinen unmittelbaren Kontakt zueinander. Eine Ausnahme stellten die Isolate J7, J8 und J9 dar. Dabei handelte es sich um eine mögliche Übertragung des Erregers von Patientin J7 auf ihre Schwester J9, die ihrerseits ihre Freundin (J8) infizierte.

Die verschiedenen Isolate wurden auf Sabouraud-Agar (siehe 3.2.1) geimpft und für 2 Wochen bei Raumtemperatur inkubiert. Die DNA-Präparation erfolgte, wie unter 3.2.2.3 beschrieben, anschließend wurde das PCR-Fingerprinting mit den Primern (GTG)5, (AC)10 und M13core durchgeführt. Zum Vergleich wurden auch die Referenz-Stämme bzw. Varianten von Trichophyton tonsurans bei jeder Reaktion mitamplifiziert.


56

Abb. 17: PCR-Fingerprinting von klinischen Trichophyton tonsurans- Isolaten sowie von den dazu gehörigen Referenzstämmen mit den Primern M13 (A), (AC)10 (B) und (GTG)5 (C)

(A, B und C) Bahn 1: E. floccosum, Bahn 2: T. tonsurans, Bahn 3: T. tonsurans var. epilans, Bahn 4: T. tonsurans var. crateriforme , Bahn 5: T. tonsurans var. sulfureum, Bahn 6: T. tonsurans (A1), Bahn 7: T. tonsurans (A3), Bahn 8: T. tonsurans (A4), Bahn 9: T. tonsurans (A5), Bahn 10: T. tonsurans (J1), Bahn 11: T. tonsurans (J2), Bahn 12: T. tonsurans (J3), Bahn 13: T. tonsurans (J4), Bahn 14: T. tonsurans (J5), Bahn 15: T. tonsurans (J6), Bahn 16: T. tonsurans (J7), Bahn 17: T. tonsurans (J8), Bahn 18: T. tonsurans (J9), Bahn 19: T. tonsurans (J10) und M = Molekulargewichtsstandard (1 Kb-Leiter)


57

Das PCR-Fingerprinting zeigte bei allen Primern, daß alle 15 untersuchten Isolate das gleiche PCR-Fingerprinting-Profil wie die Trichophyton tonsurans-Referenzstämme aufwiesen ( Abb. 17 ). Eine Abgrenzung zu Epidermophyton floccosum, welcher häufig auf der Basis phänotypischer Merkmale mit Trichophyton tonsurans verwechselt wird, war mit allen Primern möglich. Eine Differenzierung der Varianten von Trichophyton tonsurans sowie eine Detektion von Intraspezies-Unterschieden bei den klinischen Isolaten war mit dieser Methode nicht möglich.

Parallel zum PCR-Fingerprinting wurde die Gesamt-ITS-Region der 15


58

atypischen Isolate mit den Primern LR I und SR6R (siehe 4.4.1) amplifiziert und anschließend sequenziert. Mit dieser Methode konnte ebenfalls bestätigt werden, daß die untersuchten Isolate zur Spezies Trichophyton tonsurans gehören. Beim Vergleich der ITS-Sequenzen der klinischen Isolate mit denen der Referenz-Stämme zeigte sich eine größere Homologie (2 - 3 Basenunterschiede) zu Trichophyton tonsurans var. sulfureum als zu den anderen Varianten ( Alignment 1 , Anhang A), wobei die meisten Unterschiede in dem ITS 1-Bereich zu finden waren. Somit ist anzunehmen, daß die atypischen klinischen Isolate dieser Variante zugeordnet werden können

Tab. 9: Dermatophytenstämme, die in der Epidemiologie-Studie von Trichophyton tonsurans verwendet wurden

Nr.

Name

Ref. Stamm

L. Nr.

Herkunft

Gruppe

Tätigkeit

1

T. tonsurans

1261/96

J1

Cottbus

1

Ringer

2

T. tonsurans

1262/96

J2

Forst

2

Ringer

3

T. tonsurans

1768/96

J3

Halle

3

Ringer

4

T. tonsurans

2698/96

J4

Berlin

4

Ringer

5

T. tonsurans

2697/96

J5

Cottbus

1

Schüler

6

T. tonsurans

969/96

J6

Berlin

4

Ringertrainer

7

T. tonsurans

538/96

J7

Potsdam

5

Schülerin

8

T. tonsurans

1253/96

J8

Potsdam

5

Schülerin

9

T. tonsurans

910/96

J9

Potsdam

5

Schülerin

10

T. tonsurans

965/96

J10

Berlin

4

Ringer

11

T. tonsurans

 

A1

Berlin

6

Ringer

12

T. tonsurans

 

A2

Berlin

6

Ringer

13

T. tonsurans

 

A3

Berlin

6

Ringer

14

T. tonsurans

 

A4

Berlin

6

Ringer

15

T. tonsurans

 

A5

Berlin

6

Ringer

L. Nr.= Labornummer


59

4.4. Amplifizierung und Sequenzierung der ITS-Region der Dermatophyten

Für die Klärung der phylogenetischen Verwandtschaft innerhalb der Familie Arthrodermataceae wurde die Sequenzen der ITS-Region (internal transcribed spacer) des ribosomalen Operon ermittelt und verglichen.

4.4.1. Amplifizierung der ITS-Regionen

Mit den Universalprimern (LR I und SR6R) wurde die Gesamt-ITS-Region, d. h. die ITS 1, ITS 2, und die dazwischen liegende 5.8 S-rDNA sowie Teile der large subunit (LSU)-DNA (71 bp) und der small subunit (SSU)-DNA (53 bp) amplifiziert ( Abb. 18 ). Die Primerpaare SR6R und 5.8S sowie LR1 und 5.8SR wurden zur Amplifizierung der ITS1 bzw. ITS 2 verwendet.

Das PCR- Protokoll wurde nach der modifiziertenTaguchi-Methode, besonders hinsichtlich der Primerkonzentration, der DNA-Template-Konzentration und der Annealing-Temperatur optimiert (siehe 3.2.4). Zur Kontrolle der PCR-Amplifikate wurden jeweils 5 µl der PCR-Ansätze auf 1%igen Agarose-Gelen aufgetrennt.

Abb. 18: Schematische Darstellung der Gesamt-ITS-Region mit der Lokalisation der in der PCR verwendeten Primer


60

Die Gesamt-ITS-Regionen der verschiedenen Spezies der Familie Arthrodermataceae ( Tab. 5 ) wiesen zahlreiche Längenpolymorphismen auf; ihre Größe variierte zwischen 640 und 800 bp. Diese Polymorphismen traten auch innerhalb der Spezies der anamorphen Gattungen dieser Familie auf. ( Abb. 19 ). Im Vergleich zur ITS 2-Region waren die PCR-Produkte der ITS 1-Region schon im Gel variabler ( Abb. 19 ). Das wurde nach der Sequenzierung der ITS-Region noch deutlicher.

Abb. 19: Amplifizierung der ITS-Regionen von Spezies der Familie Arthrodermataceae

Bahnen 1-10: Gesamt ITS-, Bahnen 1a-10a: ITS1- und Bahnen 1b- 0b: ITS 2-Region.
Bahn 1: T. verrucosum (64), Bahn 2: T. m. var. interdigitale, Bahn 3: T. terrestre, Bahn 4: M. gallinae, Bahn 5: T. simii, Bahn 6: M. fulvum, Bahn 7: E. floccosum (74), Bahn 8: E. stockdaleae, Bahn 9: A. grubyi, Bahn 10: A. insingulare und M= Molekulargewichtsstandard (1 Kb-Leiter)


61

4.4.2. Sequenzierung der ITS-Regionen

Die amplifizierte Gesamt-ITS-Region wurde mittels infrarotfarbstoffmarkierten Primern ( Abb. 18 ) mit dem “Cycle-Sequencing“-Verfahren sequenziert (siehe 3.2.7.1). Die verwendeten Primer zeigten dabei eine unterschiedliche Effektivität. Die äußeren Primer (LR I und SR6R) erwiesen sich zwar als geeignet für die Sequenzierung, eine bessere Auftrennung und stärkere Signale wurden jedoch bei Verwendung der inneren Primer (5.8 S und 5.8 SR) erhalten. Daß innere Primer besser für die Sequenzierung geeignet sind, zeigte sich auch bei einer Modifikation des Primers LR1 (Verschiebung um 5 Basen nach innen = LR1*, siehe Tab. 7 ), was zu einer Verbesserung der Qualität der Sequenzierung, insbesondere bei problematischen Isolaten, führte.

Die Sequenzierung von doppelsträngiger DNA erwies sich trotz zahlreicher Optimierungsbemühungen als problematisch, deshalb wurde in der vorliegenden Arbeit mit einsträngiger DNA gearbeitet, die durch die Verwendung von biotinmarkierten Primern in der PCR (siehe 3.2.4.2) und die Separierung der Doppelstränge über Dynabeads® M-280 Streptavidin-Moleküle (siehe 3.2.6.2) erhalten wurde.

Bei besonders GC-reichen DNA-Templates konnte erst durch die Verwendung von 1,5 bis zu 3%igem DMSO oder einer höheren Annealing-Temperatur eine gute Sequenzierung erreicht werden. Die Sequenzierungsstrategie beinhaltete die Sequenzierung beider DNA-Stränge, wobei DNA-Regionen mit widersprüchlichen Ergebnissen mit weiteren internen Primern nachsequenziert wurden. Zur Auswertung wurden die Sequenzen in ein Peak-Diagramm ( Abb. 20 ) umgewandelt, manuell nachgelesen und gegebenenfalls korrigiert.

Die Längen der Gesamt-ITS-Regionen konnten für alle Spezies durch die Sequenzierung genau bestimmt werden ( Tab. 5 ). Sie betrugen bei den Spezies der Gattung Trichophyton 685 bis 732 bp und bei der Gattung Microsporum 650 und 771 bp. Bei den beiden bis jetzt bekannten Spezies der Gattung Epidermophyton ergab sich eine 692 bp große Sequenz für Epidermophyton stockdaleae und eine 812 bp Sequenz für Epidermophyton floccosum.


62

Abb. 20: Chromatogramm und Nukleotidsequenz der ITS 1-Region.

Repräsentatives Ergebnis einer Sequenzierung mit Hilfe des verwendeten automatischen Sequenziergerätes (LI-COR 4000)


63

4.4.3. Alignment und Sequenzanalyse

Das Alignment der ITS-Sequenzen ( Alignment 2 , Anhang A) wurde wie unter 3.2.7.5.1 beschrieben erstellt. Der Sequenzvergleich bestätigte die höhere Längen- und Sequenzvariabilität der ITS1-Region gegenüber der ITS2-Region. Vergleicht man die ITS-Regionen aller Spezies miteinander, so zeigen sich neben den variablen auch konservierte Regionen. Ein Beispiel dafür sind die Regionen 5´ GTCTGAGCGTTAGCAAGCAAAAATCAGTTAA 3´ (Position 353 - 385), 5´ CAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCC 3´ (Position 545 - 583) und 5´ GGACGCGCCCGAAAAGCAGTGGCCAGG 3´ (Position 642 - 657), die an die 5.8S-rDNA-Region angrenzen. Das Vorhandensein dieser konservierten Regionen sowohl in der ITS1 als auch in der ITS2 könnte auf mögliche, bisher noch unbekannte Funktionen dieser DNA-Regionen hindeuten. Da einige dieser konservierten Bereiche bei Vertretern nahverwandter Familien [Onygenaceae (Chrysosporium keratinophilum) und Gymnoascaceae (Arachinotus ruber)] unterschiedliche Sequenzen aufwiesen, könnten sie zur Entwicklung von Primern oder Sonden verwendet werden, die die Identifizierung der Dermatophyten auf der Ebene der Familien ermöglichen könnten (z.B. Positionen 161 - 192, 290 - 317 und 674 - 682).

4.4.4. Variabilität der ITS-Regionen innerhalb der Arthrodermataceae

Um die ITS-Sequenzen von unterschiedlichen Vertretern der Arthodermataceae vergleichen zu können, wurde ein Variationsindex errechnet, der die prozentuale Variation zwischen jeweils zwei Sequenzen ausdrückt und sowohl Punktmutationen als auch Insertionen/Deletionen berücksichtigt. Die Berechnung dieses Indexes erfolgte nur auf der Basis der variablen ITS1- und ITS2-Regionen; die konservierte Sequenz des 5.8 S rRNA-Gens wurde nicht mit ausgewertet.

Für die Bestimmung der Variabilitäten innerhalb einer Spezies (Intraspezies-Variationen) wurden die ITS-Sequenzen unterschiedlicher Varianten bzw. Stämme derselben Spezies verglichen.


64

Innerhalb der Familie Arthrodermataceae wurden für diese Intraspeziesvergleiche Variationsindices zwischen 0 und 0,6% erhalten. Diese betrugen 0,0% bei beiden Trichophyton schoenleinii-Stämmen, bei den 3 Epidermophyton floccosum- und bei den beiden Arthroderma benhamiae- Stämmen. Für die beiden verwendeten Arthroderma simii-Stämme wurde ein Variationsindex von 0,5% und für die Microsporum ferrugineum-Stämme von 0,6% bestimmt ( Tab. 10 ). Den größten Variationsindex innerhalb der Spezies zeigten die beiden Arthroderma otae-stämme mit 1,2%.

Tab. 10: Prozentualer Variationsindex für die ITS-Sequenzen innerhalb der zur Familie Arthrodermataceae gehörenden Spezies (Intraspezies-Variationen)

Spezies 1

Spezies 2

Variationsindex

Trichophyton schoenleinii 2

Trichophyton schoenleinii 38

0,0

Arthroderma simii 47

Arthroderma simii 43

0,5

Arthroderma otae 51

Arthroderma otae 52

1,2

Microsporum canis 33

Microsporum canis 69

0,0

Microsporum ferrugineum 77

Microsporum ferrugineum 79

0,6

Epidermophyton floccosum 14

Epidermophyton floccosum 74

Epidermophyton floccosum 75

0,0

0,0

Arthroderma benhamiae 71

Arthroderma benhamiae 86

0,0

Bei den durch Kreuzungsexperimente bestätigten anamorphen und teleomorphen Spezies-Paaren wurde ein Variationsindex zwischen 0,0 - 2,7% ermittelt ( Tab. 11 ). Identisch waren die Sequenzen bei den Paaren Microsporum vanbreuseghemii und Arthroderma grubyi, Microsporum persicolor und Arthroderma persicolor und Trichophyton ajelloi und Arthroderma unicinatum. Bei Trichophyton simii und seinen 2 teleomorphen Stämmen der Spezies Arthroderma simii lag der Variationsindex bei 0,0% bei Vergleich mit dem Arthroderma simii-Stamm CBS 449.65 und bei 0,5% bei Vergleich mit dem Arthroderma simii-Stamm CBS 448.65. Beim Vergleich von Microsporum canis mit den beiden teleomorphen Stämmen von Arthroderma otae wurden Werte von 1,4% (mit CBS 496.86) und 2,7% (mit CBS 495.86) ermittelt. Ähnlich lagen die


65

Werte bei Trichophyton mentagrophytes var. granulosum und Arthroderma benhamiae (1,6%) sowie bei Trichophyton terrestre und Arthroderma quadrifidum (1,9%).

Tab. 11: Prozentualer Variationsindex für die ITS-Sequenzen einiger bekannter anamorpher und teleomorpher Spezies der Familie Arthrodermataceae

Anamorphe Spezies

Teleomorphe Spezies

Variationsindex

Trichophyton simii 48

Arthroderma simii 43

Arthroderma simii 47

0,5

0,0

Trichophyton terrestre 8

Arthroderma quadrifidum 24

Arthroderma insingulare

1,9

16,8

Trichophyton m. var. granulosum 16

Arthroderma benhamiae 71

1,6

Trichophyton ajelloi

Arthroderma unicinatum 50

0,0

M. canis 69

Arthroderma otae 51

Arthroderma otae 52

2,7

1,4

Microsporum fulvum 57

Arthroderma fulvum 30

0,1

Microsporum persicolor 54

Arthroderma persicolor 53

0,0

Microsporum vanbreuseghemii 55

Arthroderma grubyi 56

0,0

Die Analyse der ITS-Sequenzen der folgenden Spezies der Gattung Trichophyton T. rubrum, T. kanei, T. fischeri, T. rubrum var. granulare, T. megninii, T. soudanense und T. violaceum ergab Variationsindices zwischen 0,0 und 2,9% ( Tab. 12 ), wobei der höchste Wert (2.9%) bei Trichophyton violaceum und Trichophyton kanei bzw. Trichophyton megninii zu verzeichnen war. Trichophyton rubrum und Trichophyton fischeri (0,0%) hatten identische ITS-Sequenzen. Trichophyton rubrum unterschied sich von Trichophyton kanei um 0,2%, von Trichophyton megninii und Trichophyton soudanense um 1,6% sowie von Trichophyton violaceum um 2,7% ( Tab. 12 ).

Auch für Microsporum canis, seine Varianten distortum und die dazugehörige teleomorphe Spezies A. otae, für Microsporum audouinii und seine Varianten rivalierii und langeronii, für Microsporum equinum sowie für Microsporum ferrugineum wurde ein eher kleiner Variationsindex bestimmt (0,0 - 2,7; Tab. 13 ).


66

Tab. 12: Prozentualer Variationsindex für die ITS-Sequenzen der Trichophyton rubrum-Spezies und ausgewählter Arthrodermataceae- Spezies.

Name / Labornummer

T.r

37

T.r.v.g 78

T.fisch. 76

T.Kan. 65

T.meg. 10

T.vio.

7

T.soud. 42

T.con. 66

T.verr. 64

T.m.veri.15

T.m.vm. 20

T.m.v n. 18

T.ton.

39

A.sem 47

A.ben 71

A.van. 72

T. rubrum 37

--

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

T. rubrum var. granulare 78

0,2

--

 

 

 

 

 

 

 

 

 

 

 

 

 

 

T. fischeri 76

0,0

0,2

--

 

 

 

 

 

 

 

 

 

 

 

 

 

T. kanei 65

0,2

0,4

0,2

--

 

 

 

 

 

 

 

 

 

 

 

 

T. megninii 10

1,6

1,6

1,6

1,8

--

 

 

 

 

 

 

 

 

 

 

 

T. violaceum 7

2,7

2,7

2,7

2,9

2,9

--

 

 

 

 

 

 

 

 

 

 

T. soudanense 42

1,6

1,3

1,6

1,8

1,3

1,3

--

 

 

 

 

 

 

 

 

 

T. concentricum 66

11,8

11,3

11,8

12,0

13,1

12,4

11,3

--

 

 

 

 

 

 

 

 

T. verr. var. verrucosum 64

9,9

9,9

9,9

10,2

11.1

10,9

9,5

3,9

--

 

 

 

 

 

 

 

T. m. var. erinacei 15

10,8

10,1

10,8

11,1

12,0

12,0

10,6

3,9

2,1

--

 

 

 

 

 

 

T. m. var. metagrophytes20

12,3

13,0

12,3

12,6

14,4

13,9

11,6

12,7

10,6

11,3

--

 

 

 

 

 

T. m. var nodulare 18

12,8

12,6

12,8

13,0

14,6

13,2

11,9

12,7

10,4

11,3

3,9

--

 

 

 

 

T. tonsurans 39

12,7

12,5

12,7

13.0

14,5

14,1

11,4

13,1

10,9

12,0

3,7

2,3

--

 

 

 

A. simii 47

11,1

11,1

11,1

11,3

12,2

11,5

10,0

12,0

11,1

10,6

2,5

3,2

3,4

--

 

 

A. benhamiae 71

10,8

11,6

10,8

11,1

12,2

11,5

10,4

0,9

3,0

3,0

11,8

11,8

12,2

11,1

--

 

A. .vanbreuseghemii 72

11,6

11,4

11,6

11,9

13,5

12,3

10,7

12,2

9,9

11,1

2,7

1,4

1,6

2,1

11,3

--


67

Tab. 13: Prozentualer Variationsindex für die ITS-Sequenzen einiger Microsporum-Spezies und ausgewählter Arthrodermataceae-Spezies.

Name / Labornummer

M.aud.34

M.aud. lan 59

M.aud. riv 58

A. ote 51

M. canis. 69

M. canis dist. 70

M. eq 60

M. ferr 77

M. gal 32

A. grubyi 56

M. cookei 87

A. quad. 24

M. audouinii 34

--

 

 

 

 

 

 

 

 

 

 

 

M. aud. langeronii 59

0,2

--

 

 

 

 

 

 

 

 

 

 

M. aud. rivalierii 58

0,0

0,0

--

 

 

 

 

 

 

 

 

 

A. otae 51

1,4

1,6

1,6

--

 

 

 

 

 

 

 

 

M. canis 69

2,0

1,8

2,0

2,7

--

 

 

 

 

 

 

 

M. canis distortum 70

1,4

1,4

1,6

2,0

1,0

--

 

 

 

 

 

 

M. equinum 60

1,8

1,8

1,8

2,5

1,4

0,8

--

 

 

 

 

 

M. ferrugineum 77

1,2

1,4

1,4

1,2

1,2

1,2

1,2

--

 

 

 

 

M. gallinae 32

18,2

17,6

17,9

17,6

17,6

16,8

16,8

16,8

--

 

 

 

A. grubyi 56

18,3

17,7

18,0

17,5

18,0

17,2

17,2

17,2

0,3

--

 

 

M. cookei 87

24,9

23,8

24,3

24,1

24,7

26,3

24,9

25,6

18,4

18,8

--

 

A. quadrifidum 24

24,8

25,0

25,2

25,0

25,5

24,8

25,0

25,5

24,9

25,0

30,0

--


68

Der kleinste Variationsindex wurde dabei zwischen Microsporum audouinii und seinen Varianten errechnet (0,0 - 0,2%). Erheblich größere Unterschiede wurden zwischen dieser Gruppe von Spezies und den am nächsten verwandten Microsporum-Arten wie Microsporum gallinae (16,8 - 18,2%) und Microsporum cookei (23,8 - 26,3%) ( Tab. 13 ) gefunden.

Bei Trichophyton tonsurans und seinen Varianten betrug der Variationsindex 0,0 - 1,1%, wodurch die enge Verwandtschaft zwischen ihnen bestätigt ( Tab. 14 ). Im Gegensatz dazu wiesen die Trichophyton mentagrophytes-Varianten erhebliche Unterschiede, bis zu 12,0%, auf. Innerhalb der Komplex I- Varianten (Trichophyton m. var. goetzii, nodulare und interdigitale) lag der Variationsindex zwischen 0,0 - 0,7%, bei den Komplex II-Varianten (Trichophyton m. var. mentagrophytes und quinckeanum) bei 0,2% und bei den Komplex III-Varianten (Trichophyton m. var. granulosum und erinacei) bei 2,1% ( Tab. 15 ).

Tab. 14: Prozentualer Variationsindex für die ITS-Sequenzen von Trichophyton tonsurans und seinen Varianten

Name / Labornummer

T. ton.

4

T. ton. 39

T. t. var. epil. 40

T. t. var. cratri. 41.

T. t. var. sulfu. 62

Trichophyton tonsurans 4

-

 

 

 

 

Trichophyton tonsurans 39

0,0

-

 

 

 

Trichophyton t. var. epilans 40

0,7

0,7

-

 

 

Trichophyton t. var. crateriforme 41

1,1

1,1

1,1

-

 

Trichophyton t. var. sulfureum 62

0,7

0,7

0,2

0,9

-

Vergleicht man den Variationsindex der einzelnen Trichophyton mentagrophytes-Komplexe mit denen anderer Spezies ( Tab. 15 ) so stellt man fest , daß der Index beim Vergleich von Trichophyton tonsurans mit den Komplex I- Varianten (1,6 - 2,3%) oder von Trichophyton schoenleinii mit den Komplex II- Varianten (0,7 - 1,1%) kleiner ist als derjenige zwischen den 3 Komplexen (1,6 - 30%) (Tab. 4.5 und Tab. 15 ).


69

Tab. 15: Prozentualer Variationsindex für die ITS-Region einiger Trichophyton mentagrophytes-Varianten und ausgewählter Spezies der Familie Arthodermataceae-.

Name / Labornummer

T.m go 17

T.m.nod 18

T.m.int 22

T.ton

39

T.m. m 20

T.m.qui 19

T,m. er 15

T.m.gra 16

T.sch

38

T.con

66

T.verr 64

A.ben 71

A.Van 72

A.sem 47

A.otae 51

T. m. var. goetzii 17

--

 

 

 

 

 

 

 

 

 

 

 

 

 

 

T. m. var. nodulare 18

0,5

--

 

 

 

 

 

 

 

 

 

 

 

 

 

T. m. var. interdigitale 22

0,0

0,7

--

 

 

 

 

 

 

 

 

 

 

 

 

T. tonsurans 39

1,6

2,3

2,0

--

 

 

 

 

 

 

 

 

 

 

 

T. m. var. mentagrophytes 20

3,4

3,9

3,4

3,7

--

 

 

 

 

 

 

 

 

 

 

T. m. var. quinckeaum 19

3,4

3,9

3,6

3,7

0,2

--

 

 

 

 

 

 

 

 

 

T. m. var. erinacei 15

11,3

11,3

11,1

12,0

11,5

12,0

--

 

 

 

 

 

 

 

 

T. m. var. granulosum 16

10,3

10,8

10,1

11,3

11,5

11,5

2,1

--

 

 

 

 

 

 

 

T. schoenleinii 38

3,2

3,7

3,4

3,9

0,7

1,1

11,8

11,1

--

 

 

 

 

 

 

T. concentricum 66

12,2

12,7

12,0

13,1

12,7

12,7

3,9

2,5

12,0

--

 

 

 

 

 

T. verr. var. verrucosum 64

10,2

10,6

9,9

10,9

10,6

10,9

2,1

2,3

10,9

3,9

--

 

 

 

 

A. benhamiae 71

12,3

11,8

11,1

12,2

11,8

11,8

3,0

1,6

10,1

0,9

3,0

--

 

 

 

A.vanbreuseghemii 72

0,7

1,4

0,7

1,6

2,7

2,7

11,1

10,3

2,5

12,2

9,9

11,3

--

 

 

A. simii 47

2,5

3,2

2,7

3,4

2,5

3,0

10,6

10,1

2,9

12,0

11,1

11,1

2,1

--

 

A. .otae 51

22,4

22,4

23,0

24,3

24,2

23,6

22,3

22,3

24,5

23,0

21,9

21,9

13,5

23,3

--


70

4.4.5. GC-Gehalt der ITS-Regionen

Die ITS-Region der Dermatophyten zeichnet sich durch einen im Vergleich zum Gesamtgenom (48 - 50%) hohen GC-Gehalt aus. Bei den verschiedenen Gattungen ergaben sich folgende Werte: Arthroderma 54,1 - 63,9%; Trichophyton 53 - 59,2%, Microsporum 54,4 - 59,1% und bei den beiden Epidermophyton-Spezies Epidermophyton stockaleae 55,1% bzw. Epidermophyton floccosum 58,6% ( Tab. 5 ). Durch den hohen Anteil an G und C lassen sich unter anderem die Schwierigkeiten bei der Sequenzierung einiger Spezies erklären.

4.5. Phylogenie der Dermatophyten (Arthrodermataceae)

Basierend auf den ITS-Sequenzen wurden in dieser Arbeit die phylogenetischen Beziehungen innerhalb der Dermatophyten mit zwei unterschiedlichen Methoden rekonstruiert. Abb. 21 zeigt 2 mit Wurzeln dargestellte phylogenetische Stammbäume von 72 Arthrodermataceae-Spezies, die mit der Parsimonie-Methode ( Abb. 21 a) bzw. mit der Neighbor-Joining-Methode ( Abb. 21 b) konstruiert wurden (siehe 3.2.7.5.3). Beide Analysen ergaben eine weitgehend ähnliche Topologie für die Familie Arthrodermataceae.

Da bei der Berechnung der Stammbäume mit der Parsimonie-Methode große Insertionen bzw. Deletionen ausgeschlossen oder als umkodierte Charakterzustände eingeschlossen wurden, blieben 83 informative Stellen übrig, um die Verwandtschaft zwischen den Spezies auflösen zu können, wodurch sich an manchen Verzweigungen nichtsignifikante Bootstrap-Werte ergaben. Bei der Neighbour-Joining-Methode, die auf der Berechnung der genetischen Distanzen beruht, wurden die rekodierten Charaktere nicht berücksichtigt. Generell wurden für die mit dieser Methode errechneten Bäume höhere Bootstrap-Werte erhalten.

In beiden phylogenetischen Stammbäumen bildeten die Spezies der Familie Arthrodermataceae mit 100%iger Unterstützung eine monophyletische Gruppe mit Arachniotus ruber und Chysosporium keratinophilum als Außengruppen. Innerhalb der Familie Arthrodermataceae konnte gezeigt werden, daß die Gattung Trichophyton polyphyletisch und die Gattung Microsporum paraphyletisch ist.


71

Die Gattung Trichophyton besteht aus zwei Gruppen; in einer Gruppe sind die anthropophilen und zoophilen Spezies vereint und die zweite enthält die geophilen Arten. Diese Einteilung wird durch 96- bzw. 89%ige Bootstrap-Werte unterstützt. Eine Ausnahme stellt Trichophyton fischeri dar, der als einzige geophile Spezies unter den anthropohilen Dermatophyten zu finden ist. Die geophile Gruppe ist heterogen. Sie schließt Spezies der anamorphen Gattungen Trichophyton (wie Trichophyton terrestre und Trichophyton ajelloi), Epidermophyton (Epidermatophyton stockdaleae) ein. Trichophyton equinum var. equinum ist die einzige zoophile Spezies innerhalb dieser Gruppe. (siehe Disskusion).

Innerhalb der Gattung Microsporum war mit Hilfe der Parsimonie-Analyse keine Auflösung zwischen den Microsporum canis, Microsporum canis var. distortum, Microsporum audouinii einschließlich der Varianten langeronii und rivalieri, Microsporum equinum, Microsporum ferrugineum und Arthroderma otae möglich. Daß diese Spezies sehr eng miteinander verwandt sind, wird durch die Neighbor-Joining-Analyse jedoch noch deutlicher bestätigt (100% Bootstrap gegenüber 69% bei der Parsimonie-Analyse).

Beide Analysen zeigen mit 96- und 100%iger Bootstrap-Unterstützung eine enge Verwandtschaft zwischen Microsporum gallinae und Arthroderma grubyi.

Die Gattung Epidermophyton stellt keine monophyletische Gruppe dar, wie die konventionelle Systematik vermuten läßt. Beide Vertreter dieser Gattung sind in den Stammbäumen weit voneinander entfernt ( Abb. 21 a und b). Die geophile Art Epidermophyton stockdaleae wird zusammen mit den geophilen Spezies der Gattung Trichophyton in einer Gruppe gefunden, wohingegen Epidermophyton floccosum als anthropophile Art enger mit den anthropophilen Trichophyton-Spezies verwandt ist (85- bzw. 100%ige Bootstrap-Unterstützung). Er bildet einen Komplex mit den anamorphen Arten Microsporum fulvum, M. persicolor und M. gypseum var. gypseum sowie den teleomorphen Arthroderma-Spezies incurvatum, fulvum und persicolor. Die geophilen Spezies Trichophyton gloriae und Arthroderma curreyi nehmen eine Zwischenstellung zwischen den geophilen Trichophyton-Spezies und dem Microsporum canis-Komplex ein. Diese Gruppierung ist jedoch nicht sehr gut durch die Bootstrap-Analyse unterstützt.


72

Abb. 21a: Konsensus-Baum von 72 verschiedenen Isolate nder Familie Arthrodermataceae, der durch eine Prsimonie- Analyse der Gesamt-ITS-Sequenz erhalten wurde. Die oberen Zahlen entsprechen den Boot- strapwerten, die unteren Zahlen stehen für die Anzahl der Nukleotidaustausche. ( 83 von 429 informative Stellen, Schritte 303, CI= 0,693,HI= 0,379 ). Rot: anthropophil, Blau: zoophil und Grün: geophil


73

Abb. 21b: Konsensus-Baum von 72 verschiedenen Spezies der Familie Arthrodermataceae, der durch eine Neighbor-Joining-Analyse der Gesamt-ITS-Sequenz erhalten wurde. Die Zahlen entsprechen den Bootstrapwerten. Rot: anthropophil, Blau: zoophil und Grün: geophil


74

Um die Verwandtschaft innerhalb der antropophilen und zoophilen Trichophyton-Spezies bzw. des Microsporum canis-Komplex näher zu analysieren, wurden separate Alignments durchgeführt, welche jeweils 34 bzw. 12 Stämme einschlossen. Aufgrund der engeren Verwandtschaft dieser Varianten und Spezies waren die Längenpolymorphismen in der ITS-Region nicht so groß, so daß diesmal alle variablen Stellen in die phylogenetischen Analysen (Parsimonie- und Neighbor-Joining-Analyse) einbezogen werden konnten. Mit beiden Methoden wurden Stammbäume (ohne Wurzeln) mit ähnlichen Topologien erhalten.

Die phylogenetischen Bäume in 22a und b zeigen die Verwandtschaftsbeziehungen zwischen den anthropophilen und zoophilen Trichophyton-Spezies. Dabei fällt besonders auf, daß die Trichophyton mentagrophytes-Spezies im Vergleich zu den anderen Trichophyton Arten eine komplexe Spezies darstellen. Die 7 untersuchten Varianten dieser Art bilden 3 Komplexe, was mit ihrem Vorkommen in der Umwelt korreliert. Die Trennung von Trichophyton mentagrophytes in diese 3 Gruppen wird mit 84, 89 und 89%igen Bootstrap-Werten unterstützt ( Abb. 22 a). Die Bootstrap-Werte des Neighbor-Joining-Baums sind ähnlich hoch und liegen bei 89, 100 und 81% ( Abb. 22 b).

Mit 84%iger Bootstrap-Unterstützung sind die anthropophilen Trichophyton mentagrophytes-Varianten goetzii, nodulare und interdigitale (Komplex I) enger zu Arthroderma vanbreuseghemii und zu den anthropophilen Trichophyton tonsurans verwandt, als zu den anderen, zoophilen Trichophyten mentagrophytes-Varianten ( Abb. 22 a). Dies ist bei der Neighbor-Joining-Methode mit 100% noch stärker unterstützt ( Abb. 22 b). Innerhalb dieser Gruppe bildet Trichophyton tonsurans mit seinen Varianten eine mit 100%igem Bootstrap unterstützte Untergruppe.

Die zoophilen Trichophyton mentagrophytes-Varianten mentagrophytes und quinckeanum ( Komplex II) sind mit 89%iger (Parsimonie) bzw. 100%iger (Neighbor-Joining) Bootstrap-Unterstützung am engsten mit dem anthropophilen Trichophyton schoenleinii verwandet. Arthoderma simii wies eine enge Verwandtschaft zu dieser Gruppe auf.


75

Abb. 22a: Konsensus-Baum von Trichophyton-Isolaten, der durch eine Parsimonie-Analyse der Gesamt-ITS-Sequenzen erhalten wurde. Die oberen Zahlen entsprechen den Bootstrapwerte, die unteren Zahlen stehen für die Anzahl der Nukleotidaustausche. (139 von 757 informative Stellen, Schritte 232, CI= 0,853, HI= 0,147). Rot: anthropophil, Blau: zoophil und Grün: geophil


76

Abb. 22b: Konsensus-Baum von Trichophyton-Isolaten abgeleitet durch eine Neighbor-Joining- Analyse der Gesamt-ITS-Region. Die Zahlen entsprechen Bootstrapwerten. Rot: anthropophil, Blau: zoophil und Grün: geophil


77

Die zoophilen Trichophyton mentagrophytes Varianten erinacei und granulosum (Komplex III) bilden mit den zoophilen Trichophyton verrucosum, Trichophyton verrucosum var. ochraceum und Arthroderma benhamiae eine Gruppe (100% Bootstrap). Als anthropophile Spezies stellt Trichophyton concentricum hier eine Ausnahme dar.

Eine enge Verwandtschaft wurde auch zwischen Trichophyton rubrum und seiner Variante granulare, Trichophyton fischeri, Trichophyton kanei, Trichophyton megninii, Trichophyton soudanense und Trichophyton violaceum gefunden. Diese Spezies bilden eine monophyletische Gruppe, die durch einen hohen Bootstrap-Wert (100%) unterstützt wird. ( Abb. 23 a und b). Dies wird auch durch den kleinen Variationsindex der ITS-Sequenzen dieser Spezies (0,0 - 2,9%) und die Ähnlichkeit der DNA-Fingerprinting-Muster bestätigt (siehe Seite 67).

Die phylogenetischen Bäume ( Abb. 23 a und b, beide ohne Wurzel) zeigen eine bessere Auflösung innerhalb des Microsporum canis-Komplexes als der Baum mit allen Dermatophytenarten. Microsporum audouinii mit seinen Varianten bildet eine separate Gruppe im Vergleich zu Microsporum canis var. distortum, Microsporum equinum, Microsporum ferrugineum und Arthroderma otae. Diese Trennung ist mit 95%igem Bootstrap-Wert bei der Parsimonie-Analyse ( Abb. 23 a) und 97%igem Bootstrap-Wert bei der Neighbor-Joining-Analyse ( Abb. 23 b) gesichert. Innerhalb der Hauptgruppe sind die beiden Arthroderma otae-Stämme mit 72% bzw. 87%iger Bootstrap-Unterstützung klar von dem Komplex abgegrenzt, der die Spezies Microsporum canis, seine Variante distortum, Microsporum equinum und Microsporum ferrugineum beinhaltet ( Abb. 23 a und b). Dabei war Microsporum canis var. distortum enger zu Microsporum equinum verwandt als zu Microsporum canis.


78

Abb. 23a: Konsensus-Baum von Microsporum canis und nahstehenden Spezies, der durch eine Parsimonie-Analyse der Gesamt-ITS-Sequenz erhalten wurde. Die oberen Zahlen entprechen den Bootstrapwerten, die unteren Zahlen stehen für die Anzahl der Nukleotidaustausche. (14 von 775 informative Stellen, Schritte 244, CI= 0,841, HI= 0,159). Rot: anthropophil und Blau: zoophi


79

Abb. 23b: Konsensus-Baum von Microsporum canis und nahstehenden Spezies, der durch eine Neighbor-Joining-Analyse der Gesamt-ITS-Sequenz erhalten wurde. Die Zahlen entsprechen den Bootstrapwerten. Rot: anthropophil und Blau: zoophil.


80

4.6. Entwicklung der TR20S-Sonde und ihre Anwendung zur Identifizierung von Trichophyton rubrum

Trichophyton rubrum ist der häufigste Erreger von Dermatomykosen, besonders von Onychomykosen, in Deutschland. Seine Kultivierung ist oft mit Schwierigkeiten verknüpft; so sind beispielsweise ca. 30% der mikroskopisch positiven Isolate nicht kultivierbar (Tietz, persönliche Mitteilung).

Um die Diagnostik zu verbessern, sollte eine Sonde auf der Basis der ITS-Sequenzen entwickelt werden, die spezifisch eine Oligonukleotidsequenz bei Trichophyton rubrum erkennt, also speziesspezifisch ist.

Der Sequenzvergleich der beiden in der ITS-PCR verwendeten Primer (LR I und SR6R) mit der Datenbank HUSAR des D eutschen K rebs f orschungs z entrums (DKFZ) zeigte, daß homologe Sequenzen bei allen dort erfaßten Pilzen aber auch bei den humanpathogenen Protozoen der Gattung Leishmania vorkommen. Weitere signifikante Sequenzhomologien wurden weder innerhalb der Prokaryonten noch innerhalb der Eukaryonten gefunden.

Die Gesamt-ITS-Region der in dieser Studie untersuchten Spezies der Familie Arthrodermataceae (Trichophyton, Microsporum, Epidermophyton, Arthorderma) ( Tab. 5 ) wurde mit diesen Universalprimern amplifiziert und sequenziert. Basierend auf dem Vergleich der erhaltenen Sequenzen wurde aus dem Bereich der variablen ITS 2 von Trichophyton rubrum ( Tab. 16 ) ein spezifisches Oligonukleotid (20-mer) ausgewählt. In der HUSAR-Datenbank konnten für dieses Oligonukleotid keine Sequenzhomologien zu Prokaryonten und anderen Eukaryonten festgestellt werden.

Für den Nachweis von Trichophyton rubrum mit der TR20S-Sonde wurde zunächst genomische DNA genutzt, die aus Frühkulturen (1-2 Wochen) isoliert wurde. Später wurde versucht, DNA direkt aus dem Haut- und Nagelmaterial der Patienten zu isolieren (siehe 3.2.2.4).

Um die Spezifität der Sonde zu prüfen, wurde die Gesamt-ITS-Region von 50 klinischen Trichophyton rubrum Isolaten sowie von 10 eukaryontischen Mikroorganismen (Scopulariopsis, Aspergillus fumigatus , Candida guilliermondii, Candida


81

Tab. 16 : Teil-Sequenzalignment der ITS 2-Region unterschiedlicher Arthodermataceae-Spezies. Die TR20S-Sonde ist rot geschieben und unterstrichen


82

famata, Candida parapsilosis, Candida zeylanoides, Candida lipolytica, Cryptococcus albidus, Trichosporum cutaneum und Leishmania tropica ), die ebenfalls als potentielle Erreger von Haut- und Nagelinfektion in Frage kommen können, sowie von humaner DNA amplifiziert

Abb. 24: Amplifikation der Gesamt-ITS-Region verschiedener potentieller Erreger von Haut und Nagelinfektionen

Bahn 1: Scopulariopsis, Bahn 2: Aspergillus fumigatus, Bahn 3: Candida guilliermondii, Bahn 4: Candida famata, Bahn 5: Candida parapsilosis, Bahn 6: Candida zeylanoides, Bahn 7: Candida lipolytica, Bahn 8: Cryptococcus albidus, Bahn 9: Trichosporum cutaneum, Bahn 10: Leishmania tropica, Bahn 11: Microsporum canis, Bahn 12: Trichophyton m. var. Interdigitale, Bahn 13: Trichophyton rubrum und M = Molekulargewichtsstandard (1 Kb-Leiter)

Innerhalb der Dermatophyten zeigte das PCR-Produkt der Gesamt-ITS- Region von Trichophyton mentagrophytes var. interdigitale eine mit Trichophyton rubrum vergleichbare Amplifkatgröße. Bei allen anderen getesteten potentiellen Infek-tionserregern waren die Amplifikationsprodukte immer größer oder kleiner als die


83

von Trichophyton. rubrum ( Abb. 24 ). Humane DNA wurde durch die verwendeten Primer nicht amplifiziert. Trotzdem wurden auch diese PCR-Ansätze für die Hybridisierung geblottet.

Die verschiedenen Amplifikate wurde per Dot-Blot-Verfahren geblottet und anschließend mit der digoxigeninmarkierten TR20S-Sonde hybridisiert. Positive Hybridisierungssignale wurden nur bei den ITS-PCR-Produkten von verschiedenen Trichophyton rubrum-Isolaten sowie bei den mit Trichophyton rubrum eng verwandten Spezies Trichophyton fischeri, Trichophyton kanei, Trichophyton megninii und Trichophyton soudanense detektiert ( Abb. 25 bzw. Abb. 26 ). Die Amplifikationsprodukte aller übrigen Spezies der Familie Arthrodemataceae, auch von Microsporum canis und Trichophyton metagrophytes var.interdigitale, die ebenfalls Nagelinfektionen hervorrufen können sowie der anderen getesteten Infektionserreger waren negativ.

Versuche, die Sonde für die Hybridisierung an nicht amplifizierter gereinigter chromosomaler DNA von Trichophyton rubrum einzusetzen, zeigten erst nach dem Blotten von ca. 20 - 25 µg DNA leicht positive Signale ( Abb. 25 ), was auf eine möglicherweise unzureichende bzw. geringe Kopienzahl der ITS-Region im Genom zurückzuführen sein könnte.

Da aus Abbildung Abb. 27 zu sehen ist, daß bei der Amplifizierung mit der TFL-Polymerase ein stärkeres PCR-Produkt erhalten wird, wurde diese Polymerase auch für die Amplifizierung der ITS-Region bei den Proben aus dem Patientenmaterial eingesetzt (siehe 4.1).


84

Abb. 25: Dot-Blot-Hybridisierung der amplifizierten ITS-Region bzw. chromo-somaler DNA verschiedener Vertreter der Arthrodermataceae sowie anderer potentieller Erreger von Haut- und Nagel-Infektionen mit der TR20S-Sonde

Nr. 1-9: verschiedene T. rubrum (klinische) Isolate, Nr. 10: T. rubrum (CBS), Nr. 11: Sco-pulariopsis, Nr. 12: Aspergillus fumigatus, Nr. 13: Candida guilliermondii, Nr. 14: Candida famata, Nr. 15: Candida parapsilosis, Nr. 16: Candida zeylanoides, Nr.17: Candida lipolytica, Nr. 18: Cryptococcus albidus, Nr. 19: Trichosporum cutaneum, Nr. 20: Leishmania tropica, Nr. 21: T. verrucosum, Nr. 22: M. canis, Nr. 23: E. floccosum, Nr. 24: T. m. var. interdigitale, Nr. 25: M. audouinii, Nr. 26: T. schoenleinii , Nr. 27: T. tonsurans, Nr. 28: T. simii, Nr. 29: A. vanbreuseghemii, Nr. 30: A. benhamiae, Nr. 31-35: chromosomale T. rubrum-DNA (Klinische Isolate), Nr. 36: chomosomale T. tonsurans-DNA (CBS), Nr. 37: chromosomale T. rubrum-DNA (CBS), Nr. 38: chromosomale Human-DNA, Nr. 39-40: PCR-Ansätze mit den ITS-Primern LR1 und SR6R mit DNA aus nichtinfiziertem humanen Blut und Nr. 41: markierte Sonde.


85

Abb. 26: Detektion von Trichoython rubrum und nahverwandten Spezies anhand der Dot-Blot-Hybridisierung der amplifizierten ITS-Region mit der TR20S-Sonde

Nr. 1- 5: verschiedene T. rubrum (klinische Isolate), Nr. 6: Trichophyton rubrum var. granulare, Nr. 7: Trichophyton fischeri, Nr. 8: Trichophyton kanei, Nr. 9: Trichophyton megninii, Nr. 10: Trichophyton soudanense, Nr. 11: markierte Sonde und Nr. 12: T. rubrum (CBS).

Abb. 27: Amplifikation der ITS-Region von Trichophyton rubrum direkt aus Patientenmaterial unter Verwendung von 2 verschiedenen Polymerasen in der PCR

Bahn 1-3: Amplifizierung der DNA aus Nagelmaterial mit der Taq-Polymerase, Bahn 1a-3a: Amplifizierung der gleichen Proben mit der TFL-Polymerase und M= Molekulargewichts-standard (123 bp. Leiter)


[Titelseite] [Widmung] [1] [2] [3] [4] [5] [6] [Bibliographie] [Anhang] [Abkürzungsverzeichnis] [Lebenslauf] [Selbständigkeitserklärung]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Thu Apr 6 19:42:41 2000