Rickers, Anke: Identifikation molekularer Regulatoren der anti-IgM induzierten B-Zell Apoptose

15

Kapitel 2. Materialien

2.1. Chemikalien

Alle nicht aufgeführten Chemikalien wurden von der Firma Carl Roth GmbH und Co bezogen. In der Regel wurden Chemikalien höchsten Reinheitsgrades (pro analysi) verwendet.

Acridinorange

Sigma

Acrylamid

Biorad

Agarose

Biozym

Ammoniumperoxodisulfat

Sigma

Ampicillin

Sigma

Aprotinin

Sigma

alpha-Thioglycerol

Sigma

Bacto-Agar

Difco

Bacto-Trypton

Difco

Bacto-Yeast Extract

Difco

BCS (Bathocuproindisulfonsäure)

Sigma

blocking reagent

Boehringer

Casein

Gibco

Coomassie Brilliant Blue

Sigma

dNTP´s

Boehringer

Ethidiumbromid (EtBr)

Sigma

FCS

Gibco

Hydroxyapatit

Biomed

Leupeptin

Sigma

Magermilchpulver

Extra

Maleinsäure

Merck

Ponceau-Rot

Sigma

RPMI 1640

Seromed

Tetracyclin

Clontech

Triton X 100

Sigma

Trypsin

Promega

Venimun

Behringwerke AG

X-Gal (5-Bromo-4-Chlor-3-Indolyl-ß-D-Galaktosid)

Sigma


16

2.2. Enzyme, Proteine und Peptide

Avidin-Alkalische Phosphatase

Biorad

T4-DNA-Ligase

Gibco BRL

RNasin

Promega

Restriktionsenzyme

MBI

T4-DNA-Polynukleotidkinase

USB

Taq Polymerase

Clontech

Klenow Fragment

MBI

Rekombinantes SP1

Promega

Rekombinante Caspase 1 und 3

Rudi Bayaert, Gent, Belgien

Rekombinante Caspase 6 und 7

Pharmingen

z-DEVD-fmk

Calbiochem

ac-YVAD-cmk

Calbiochem

2.3. Antikörper

Alle hier nicht aufgeführten Antikörper wurden von der Firma Santa Cruz bezogen.

anti-IgM F(ab)2-Antikörper

Dianova

anti-FITC microbeads

Miltenyi

anti-hnRNP A1 Antikörper 4B10

Gideon Dreyfuss, Pennsylvania

anti-hnRNP K Antikörper 3C2

Gideon Dreyfuss, Pennsylvania

anti-hnRNP C1/C2 Antikörper 4F4

Gideon Dreyfuss, Pennsylvania

anti-CD5

Becton Dickinson

anti-CD10

Becton Dickinson

anti-CD19-FITC

Becton Dickinson

anti-CD20

Becton Dickinson

anti-CD21-FITC

Becton Dickinson

anti-CD38-FITC

Immunotech

anti-CD40

Pharmingen

anti-Apo-1/FAS-PE

Pharmingen

anti-IgD

Immunotech

anti-IgM

Becton Dickinson

Ziege anti-Maus-FITC

Jackson Immuno Research Lab.


17

2.4. Kits

PCR-SelectTM cDNA Subtraction Kit

Clontech

Apo AlertTM CPP32 Assay Kit

Clontech

AdvantageTM cDNA PCR KIT

Clontech

cDNA-Synthese Kit

Boehringer

High Prime

Boehringer

lambda-Zap II cDNA-Synthese Kit

Stratagene

pGEM-T Kloning-Kit

Promega

polyATract mRNA Isolation Systems

Promega

TNT coupled Reticulocyte Lysate System

Promega

Riboprobe System

Promega

QIAquick PCR Purification Kit

QIAGEN

Plasmid Mini-, Midi-, Maxi-Kit

QIAGEN

Oligotex mRNA Mini-Kit

QIAGEN

QIAEXII Gel Extraction Kit

QIAGEN

RNeasy Mini-, Midi-Kit

QIAGEN

Subtractor Kit

Invitrogen

Cycle Sequencing Kit

ABI

2.5. Membranen

Hybond N+

Amersham

Nitrocellulose Membran

Schleicher und Schüll

Multiple tissue northern Membranen

Clontech

2.6. Radioaktive Nukleotide

alpha32 P-dCTP

NEN

gamma_32 P-dATP

NEN

35S-Methionin (1000 µCi/ml)

Amersham

3H-Thymidin Amersham

2.7. Zellinien

BL41

erhalten von P. Falk, München

BL60

erhalten von P. Daniel, MDC, Berlin


18

2.8. Plasmide

pGEM-T

Promega

pGEM-T easy

Promega

Blueskript SK+/-

Stratagene

pQE 16, 17, 51

QIAGEN

Il1ß in pGEM11

R. Bayaert, Gent, Belgien

SP1 in Blueskript M13-SK+

J.T. Kadonaga, Berkeley, USA

2.9. Bakterienstämme

E.coli XL-1 blue

E.coli SOLR

E.coli JM 109


19

2.10. Oligonukleotide

Alle Oligonukleotide sind in 5´-3´ Orientierung angegeben

Linkeroligonukleotid 1:

AGCTAGAATTCGGTACCGTCGACC

Linkeroligonukleotid 2:

GGTCGACCCTACCCAATTCTAGCT

hnRNPA1 PCR Oligonukleotide:

ATCGGAGATCTAAATCTGCCACT

GGTTCCAGATCTTCTAAGTCAGAGTCT

Oct-2 Bindungssequenz:

GATCCTATAGAATCGCTTATGCAA

GGTTGCATAAGCGATTCTATAGGA

B8 PCR Oligonukleotide:

GCTAGAATTCGGTACCGTCG

ATATCACTGGTGGACACGCC

B54 PCR Oligonukleotide:

CTGGACGATACACCGATGTTC

GCATCGCCCTGCAAATAGAC

SP1 Bindungssequenz:

ATTCGATCGGGGCGGGGCGAGC

GCTCGCCCCGCCCCGATCGAAT

mutierte SP1 Bindungssequenz:

ATTCGATCGG TT CGGGGCGAGC

GCTCGCCCCG AA CCGATCGAAT

c-myc PCR Oligonukleotide:

TTCGGGTAGTGGAAAACCAG

ACTCAGCCAAGGTTGTGAGG

(poly dT)15-18 Oligonukleotid:

Boehringer Mannheim

T3

AATTAACCCTCACTAAAGGG

T7

GTAATACGACTCACTATAGGGC

SP6

GATTTAGGTGACACTATAG

KS

TCGAGGTCGACGGTATC

SK

CGCTCTAGAACTAGTGGATC


20

2.11. Medien und Puffer

LB-Medium

10 g

Bacto-Trypton

5g

Hefe-Extrakt

5 g

NaCl

auf 1 l

H2O

10 x PBS

8 mM

Na2HPO4x2H2O

2 mM

NaH2PO4xH2O

140 mM

NaCl

20 x SSC 3,0 M NaCl

0,3 M Tri-Natriumcitrat

5 x TBE

0,5 M

Tris-Base

0,5 M

Borsäure

12,5 mM

EDTA

SM Puffer

0,5%

(w/v) NaCl

20 mM

Tris-HCl, pH 7,5

1 mM

MgSO4

2 % (w/v)

Gelatine

10 x MOPS

0,2 M

MOPS (3-(N-Morpholin)Propansulfonsäure)

0,05 M

Natriumacetat

0,01 M

EDTA

pH 5,5-7,0

2.12. besondere Verbrauchsmaterialien

Nensorb Säulen

DUPONT

Talon Nickel spin coumns

Clontech

Annexin-V/FITC

Bender Med System

Silikonisierte Eppendorfgefäße

Appligene

Sephadex spin columns

Pharmacia

Western blue substrate

Promega

for Alkaline Phosphatase


[Titelseite] [1] [2] [3] [4] [5] [6] [7] [Bibliographie] [Anhang] [Abkürzungsverzeichnis] [Selbständigkeitserklärung] [Lebenslauf] [Danksagung] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiDi DTD Version 1.1
a subset from ETD-ML Version 1.1
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Nov 26 14:02:57 1999