Rickers, Anke: Identifikation molekularer Regulatoren der anti-IgM induzierten B-Zell Apoptose

21

Kapitel 3. Methoden

3.1. Molekularbiologische Methoden

3.1.1. DNA Standardprozeduren

Alle Standardmethoden, wie Plasmidpräparationen, Restriktionsspaltungen, gelelektro-phoretische Trennungen, u.s.w. wurden nach Sambrock et al. (96) bzw. dem jeweiligen Protokoll des Herstellers durchgeführt. Alle für diese Arbeit relevanten, modifizierten Methoden werden hier aufgeführt.

3.1.2. Herstellung von lambda-Zap cDNA-Phagenbanken

Zur Herstellung von lambda-Zap cDNA-Phagenbanken wurde Gesamt-RNA von unstimulierten und stimulierten BL-41 Zellen (4h anti-IgM) nach der Methode von Kroczek et al. präpariert (3.1.8.1). Die Qualität der Gesamt-RNA wurde auf einem RNA Agarosegel überpüft (3.1.9.1). Die poly(A)+-mRNA wurde mit dem Oligotex mRNA Mini-Kit von QIAGEN präpariert. Die Konstruktion der lambda-Zap cDNA Phagenbanken erfolgte mit dem lambda-ZAPII cDNA-Synthese Kit von Stratagene. Die einzelnen Schritte werden hier kurz dargestellt:

5 µg poly(A)+-mRNA von stimulierten und nicht stimulierten BL41-3s Zellen wurden mit einem Oligo-(dT) Linker-Primer hybridisiert, der eine XhoI Restriktionsschnittstelle besitzt. Die RNA wurde durch Reverse Transkription in Einzelstrang cDNA konvertiert. Durch den Einsatz von 5´-Methyl dCTP in der Erststrangsynthese wurde die cDNA hemimethyliert, was interne XhoI Restriktionsschnittstellen schützt. In die RNA des RNA/DNA-Hybrids wurde durch die RNaseH Brüche eingeführt, so daß durch die Exo- und Endonukleaseaktivität der DNA-Polymerase I der Zweitstrang synthetisiert werden konnte. Ein Aliquot des Erst- und Zweitstrangsynthese-Ansatzes (1/10 V) wurde jeweils vor Beginn der Reaktion entnommen und mit radioaktiv markiertem alpha32P-dATP versetzt. Diese radioaktiv markierte cDNA wurden auf einem 1 %-igen Agarosegel aufgetrennt und durch Autoradiographie detektiert. Die Synthese einer Kontrolle bekannter Größe gab Aufschluß über die Größenverteilung der synthetisierten cDNAs ( 500 bp - 4 Kb) und damit über die Qualität der cDNA-Synthese.


22

Abb. 3 Herstellung einer lambda-Zap cDNA-Phagenbank
Die Gesamt-RNA von BL41-3s Zellen vor bzw. nach Apoptose Stimulation (4h anti-IgM) wurde präpariert. Die poly(A)+-RNA wurde isoliert und mit einem oligo(dT)-Linkeroligonukleotid als Primer in cDNA konvertiert. Die Enden der doppelsträngigen cDNA-Fragmente wurden aufgefüllt und an Linkerfragmente ligiert. Nach XhoI Spaltung wurde die cDNA gerichtet in lambda-Zap Vektor-Arme ligiert. Die lambda-DNA wurde in Phagen verpackt.


23

Die Enden der cDNA-Doppelstränge wurden durch die PfU DNA-Polymerase mit dNTP´s aufgefüllt und mit EcoRI-Linkern ligiert. Die Enden der cDNA-Linker-Fragmente wurden phosphoryliert und mit XhoI gespalten, wodurch asymmetrische EcoRI-XhoI doppelsträngige DNA-Fragmente entstanden. Über Sephacryl-Säulen (Sephacryl S-400 spin columns) wurden die entstandenen DNA-Fragmente der Größe nach getrennt und von nicht ligierten Linkern bzw. abgespaltenen Linkerfragmenten abgetrennt. 1/10 Volumen jeder Fraktion wurde auf einem 5 %-igen Polyacrylamidgel analysiert. Die Größenverteilung der cDNAs wurde für jede Fraktion nach Exposition des Autoradiogramms kontrolliert und ist ein Maß für die Qualität der cDNA-Synthese (Abb.4 ).

Abb. 4 Trennung der dscDNA nach Sephacryl-Säulenchromatographie
In die Zweitstrangsynthese der cDNA stimulierter BL41-3s Zellen (4), sowie unstimulierter Zellen (0) wurde alpha-32P-dATP eingebaut. Über Sephacryl-Säulen wurden doppelsträngige cDNAs der Größe nach fraktioniert und von nicht-ligierten Linker, sowie abgespaltenen Linkerfragmenten abgetrennt. Die einzelnen Fraktionen der Chromatographie (Fraktion 1-3) wurden eluiert und 1/10 V auf einem 5 %-igen Polyacrylamidgel elektrophoretisch getrennt. Als Kontrolle (K) wurde eine RNA von 1,8 Kb Größe in die cDNA-Synthese eingesetzt. Die Detektion erfolgte durch Autoradiographie.


24

Im Vergleich zu einem pBR322 Standard wurden die Mengen der synthetisierten cDNA jeder Fraktion auf EtBr-Agrose-Platten quantifiziert. 100 ng der cDNA der Fraktion 1 und 2 wurde gerichtet (EcoRI/XhoI) in lambda-ZAP Vektor Arme, die ein internes Blueskript Plasmid enthalten, ligiert. Ca. 20 ng der Ligationsansätze wurde mit lambda-Zap-Verpackungsextrakt vermischt und auf dem E.coli Stamm XL1-blue MRF´ ausplattiert. Kolonien, die kein Insert haben, wurden durch Blau-weiß Selektion (IPTG/X-Gal) detektiert. Weniger als 0,02% der Kolonien waren ohne Insert.

Um einen stabilen Phagenstock mit hohem Titer zu erhalten, wurden die lambda-ZAP cDNA-Phagen auf E.coli ausplattiert. Um den Titer der cDNA-Phagenbanken zu bestimmen, wurden verschiedene Verdünnungen des Phagenstocks ausplattiert und Plaques gezählt (pfu = plaque forming unit pro ml Phagensuspension). Einzelne Phagenplaques wurden aus dem Agar ausgestochen und in SM Puffer eluiert. Die Größe der klonierten cDNA wurde nach in vivo Exzision (3.1.5) des Blueskript Plasmids, anschließender Mini-Präparation und Restriktionsspaltung (XhoI/EcoRI) bestimmt.

3.1.3. Herstellung einer subtraktiven lambda-Zap cDNA-Phagenbank

Um eine Anreicherung Apoptose-spezifischer Transkripte zu erreichen, wurde eine subtraktive lambda-Zap cDNA-Phagenbank hergestellt. Die Anreicherung erfolgte über eine subtraktive Hybridisierung komplementärer Sequenzen aus stimulierten und nicht stimulierten BL41 Zellen.

Die Gesamt-RNA von stimulierten (4 h anti-IgM) und unstimulierten BL41-3s Zellen wurde nach der Methode von Krozcek et al. präpariert, die poly(A)+-mRNA mit dem mRNA Isolation Kit von QIAGEN. Die Subtraktion erfolgte gemäß dem Protokoll des Subtractor Kits von Invitrogen. Die einzelnen Schritte werden in den folgenden Punkten 3.1.3.1-3.1.3.4 beschrieben. In Abb. 24 ist das Prinzip der Subtraktion dargestellt.

3.1.3.1. Photobiotinylierung von RNA

1 x Maleinsäurepuffer, pH7,5:

0,1 M Maleinsäure

0,15 M NaCl

0,3 % v/v Tween

10 µg der poly(A)+-RNA von nicht induzierten BL60-2 Zellen wurde in 30 µl Volumen photobiotinyliert (200 Watt, 20 Min bei 350-370 nm), wobei eine Biotinmarkierung an jeder fünfzigsten bis hundertsten Base erreicht werden sollte. Freies Biotin wurde mit Butanol ausgeschüttelt, bis die Butanol Phase klar war (ca. 6 x). Die Biotinylierung wurde durch die spezifische Bindung von Streptavidin gekoppelter alkalischer Phosphatase und der Umsetzung des Substrates NBT, X-Phosphat in einer Farbreaktion auf einer Nylon-Membran erreicht. Die Effizienz wurde anhand eines biotinylierten Standards überprüft, von


25

dem verschiedene Mengen auf eine Nylonmembran gedottet wurden (0,5-100 ng). Ein Vergleich der Signalintensitäten, ergab eine Biotinylierung an jeder 50-100-sten Base. Die Farbreaktion auf der Membran verlief nach folgendem Schema:

Waschen

5 Min in Maleinsäurepuffer

Blocken

30 Min 10 % blocking reagent in Maleinsäurepuffer

Streptavidin-AP Bindung

30 Min 1:1000 Streptavidin-AP (10 % blocking reagent in Maleinsäurepuffer)

Waschen

2 x 15 Min Maleinsäurepuffer

Äquilibrieren

2 Min 0,1 M Tris-HCl, pH 9,5; 0,1 M NaCl; 50 mM MgCl2

Farbreaktion

15 Sek-5 Min Western blue substrate for AP (Promega)

3.1.3.2. Subtraktive Hybridisierung von einzelsträngiger cDNA mit photobiotinylierter RNA

1,5 µg mRNA der induzierten BL41 Zellen (4 h anti-IgM) sowie einer Kontrolle wurden durch Reverse Transkription in einzelsträngige cDNA konvertiert (cDNA Synthese Kit, Boehringer). 10 µg photobiotinylierter mRNA nicht induzierter BL41-3s Zellen wurde mit der einzelsträngigen cDNA gemischt und für 1 Min bei 95 0C denaturiert. Die DNA wurde gefällt und in 1 x Hybridisierungspuffer (Subtractor-Kit, Invitogen) für 24 Stunden bei 68 0C inkubiert. Komplementäre Sequenzen bildeten ein hemibiotinyliertes Hybrid, daß durch Phenol/Chloroform-Extraktion abgetrennt wurde (s. Abb. 24).

3.1.3.3. Herstellung von Linkeroligonukleotiden

Zur Amplifikation der verbliebenen cDNA-Sequenzen (s. 3.1.3.2) und zur anschließenden Klonierung wurden Linkeroligonukleotide hergestellt. Dazu wurden komplementäre Oligonukleotide synthetisiert, die eine interne EcoRI-Schnittstelle besitzen. Die Synthese erfolgte bei der Firma Biotez, Berlin-Buch.

Linkeroligonukleotid 1: 5´ GCTAGAATTCGGTACCGTCGACC 3´;

Linkeroligonukleotid 2: 5´ GGTCGACCCTACCCAATTCTAGCT 3´

Das Oligonukleotid 2 wurde kinasiert (s. 3.1.13). Je 10 µg Oligonukleotid 1 und 2 wurden gemischt und über Nacht hybridisiert. Die Hybridisierung erfolgte in einem 50 µl Ansatz in 70 mM NaCl und 50 mM Tris-HCl, pH 8,0. Die Oligonukleotide wurden zunächst für 5 Min bei 95 0C denaturiert und ü.N. bei 56 0C hybridisiert. 2 µg des Hybridisierungsansatzes wurden auf einem 20 %-igen nicht denaturierendem Polyacrylamidgel getrennt. Dabei lassen sich doppelsträngige Hybride sowie die einzelsträngigen Linkeroligonukleotide nach Färbung des Gels mit EtBr unter UV-Licht nachweisen. Die nicht hybridisierenden Einzelstränge wurden über HPLC getrennt (Firma Biotez).


26

3.1.3.4. Trennung der subtrahierten cDNAs und Klonierung in lambda-Zap DNA

Nicht hybridisierte cDNAs sollten eine Anreicherung Apoptose-spezifischer Sequenzen aus BL60-2 anti-IgM induzierten Zellen sein. Diese einzelsträngigen cDNAs wurden nach dem Protokoll des Herstellers (Subtractor-Kit, Invitrogen) in doppelsträngige cDNA konvertiert, die Enden mit der Pfu-Polymerase aufgefüllt und phosphoryliert (s. 3.1.2). Die doppelsträngige cDNA wurde nach der Kinasierung Phenol/Chloroform extrahiert, gefällt und das Pellet für die Ligation der EcoRI-Linker an die glatten Enden der cDNA eingesetzt (s. 3.1.3.3).

Linker-Ligation:

dsDNA (ca. 3 µg)

6 µl Linker 500 ng/µl

1 µl 10 x Ligase Puffer

1 µl T4-DNA Ligase (4 U)

Die doppelsträngigen cDNA-Linker-Fragmente wurden in einer Polymerase-Kettenreaktion (PCR) mit einem Linker spezifischen Primer (Linkeroligonukleotid 1) amplifiziert:

PCR-Reaktion:

10 µl

1/5 der synthetisierten cDNA

10 µl

10 x Taq Polymerase

2 µl

dNTPs (je 10 mM dATP, dTTP, dCTP, dGTP)

1 µl

Linkeroligonukleotid 1 (1 µg/µl)

1 µl

Taq Polymerase (5 U/µl)

5 µl

MgCl2 (25 mM)

1 µl

alpha32P-dATP

auf 100 µl mit H2O

Die DNA wurde 5 Min bei 95 0C denaturiert und unter folgenden Bedingungen amplifiziert

30 Zyklen: 30 Sek 95 0C, 1 Min 50 0C, 1 Min 72 0C

anschließender Elongationsschritt: 5 Min 72 0C

Chase -PCR:

100 µl PCR-Reaktion

30 µl10 x PCR Puffer

6 µl dNTPs (je 10 mM dATP, dTTP, dCTP, dGTP)

1 µl Linkeroligonukleotid 1 (1 µg/µl)

3 µl Taq Polymerase (5 U/ µl)

15 µl MgCl2 (25 mM)

auf 300 µl mit H2O


27

Die Chase -Reaktion wurde folgenden Bedingungen unterworfen:

3 Zyklen: 30 Sek 95 0C, 1 Min 50 0C, 2 Min 72 0C

4 Zyklen: 1 Min 50 0C, 5 Min 72 0C

5 µl der PCR-Reaktion wurden entnommen und auf einem 2 %-igen EtBr-Agarosegel elektrophoretisch getrennt. Die Amplifikate wurden unter UV-Licht sichtbar gemacht und die Größe abgeschätzt. Der Hauptanteil der Amplifikate lag zwischen 200 und 500 Bp. Die PCR-Fragmente wurden Phenol/Chloroform extrahiert, mit EcoRI gespalten und über Sephacryl S-400 spin columns fraktioniert (s. 3.1.2). Ein Aliquot (1/10 V) jeder Fraktion wurde auf Ethidiumbromidplatten quantifiziert. 100 ng DNA (50 ng Fraktion 2 und 50 ng Fraktion 3) wurden in EcoRI lambda-Zap DNA Phagen-Arme ligiert und in Phagen verpackt (s. 3.1.2). Die Phagen wurden amplifiziert und der Titer der cDNA Phagenbank wurde bestimmt. Die Insertgröße wurde über eine PCR-Amplifikation bestimmt. Dazu wurden 20 Plaques aus dem Agar ausgestochen und die Phagen in je 500 µl SM-Puffer über Nacht in einem Schüttelinkubator eluiert. 10 µl dieses Phageneluates wurde in einer PCR-Reaktion mit spezifischen Oligonukleotiden (T3 und T7) für das Blueskript-Plasmid unter Standardbedingungen amplifiziert und auf einem Agarosegel analysiert.

3.1.4. Screening der lambda-Zap cDNA-Phagenbanken

1 x 105 bis 1 x 106 pfu wurden auf XL1-blue E.coli Zellen ausplattiert (105 pfu pro 20 cm x 20 cm Platte) und auf Nylonmembranen transferiert. Die Filter wurden in 1,5 M NaCl, 0,5 M NaOH für 2 Min denaturiert, in 1,5 M NaCl, 0,5 M Tris-HCl (pH 8,0) neutralisiert und in 0,2 M Tris-HCl (pH 7,5), 2 x SSC für 30 Sek geschwenkt. Die DNA wurde durch UV Licht (Stratalinker) auf der Membran fixiert.

3.1.4.1. Hybridisierung mit einer spezifischen Sonde

Die spezifischen DNA-Fragmente wurden mit alpha32P-dCTP radioaktiv markiert (s. 3.1.12) und in einer Konzentration von 106 cpm/ml für die Hybridisierungsreaktion eingesetzt. Die Membranen wurden über Nacht bei 47 0C hybridisiert und gewaschen (s. 3.1.9.3). Positiv hybridisierende Phagenplaques wurden durch Autoradiographie detektiert, und den entsprechenden Phagenplaques auf der Agarplatte zugeordnet, isoliert und in 500 µl SM Puffer eluiert (3.1.2). Die eluierten Phagen wurden erneut ausplattiert, auf eine Membran transferiert und mit derselben Sonde hybridisiert. Positiv hybridisierende Klone wurden durch in vivo Exzision in Blueskript-Plasmid konvertiert (3.1.5) und sequenziert.


28

3.1.4.2. Differentielle Hybridisierung

1 x 105 Phagen der subtraktiven und 1 x 106 Phagen von stimulierten BL41 Zellen generierten lambda-Zap cDNA-Phagenbank wurden ausplattiert (1 x 105 Phagen pro 20 x 20 cm Platte) und auf jeweils 2 Nylonmembranen transferiert. Die DNA wurde wie unter 3.1.4 beschrieben auf der Membran denaturiert und fixiert. Je eine Nylonmembran wurde mit 32P-markierter Gesamt-cDNA aus unstimulierten und stimulierten BL41-3s Zellen, bzw. einer 32P-markierten subtrahierten Probe hybridisiert. Hybridisierende Plaques konnten durch Autoradiographie detektiert werden. Die Autoradiogramme der beiden Filter wurden verglichen und differentiell hybridisierende Phagenpaques aus der Agarplatte isoliert, und die Phagen in SM Puffer eluiert (s. 3.1.2). Diese Phagen wurden in einer zweiten Runde ausplattiert, erneut hybridisiert und differentielle Klone isoliert (s. Abb. 25).

3.1.5. In vivo Exzision

Die lambda-Zap Vektoren erlauben eine in vivo Exzision des Blueskript-Plasmids, der das integrierte cDNA-Fragment enthält. Dazu wurde zunächst ein Plaque aus der Agarplatte ausgestochen und in 500 µl SM Puffer eluiert. Die klonierten cDNA-Fragmente konnten durch Doppelinfektion des E. coli Stammes XL1-blue MRF´ durch lambda-Phagen und einen Helferphagen freigesetzt werden. Dabei wurde zunächst einzelsträngige Blueskript-DNA synthetisiert, die die klonierte cDNA enthält. Diese einzelsträngige DNA wird zirkularisiert und das Phagemid aus der Wirtszelle sekretiert. In einem zweiten Schritt wurde der E.coli Stamm SOLR mit dem sekretierten Phagemid transformiert und die transformierten Klone auf Ampicillin Platten selektioniert. Einzelne Bakterien Kolonien wurden gepickt und kultiviert. Die Plasmid DNA wurde nach dem Plasmid Mini-Kit von Qiagen präpariert. Durch einen Restrikionsverdau konnten die Insertgrößen analysiert werden.

3.1.6. Herstellung einer subtrahierten DNA-Probe

Zur differentiellen Hybridisierung der cDNA-Phagenbanken wurde eine subtrahierte Probe hergestellt. Diese Probe wurde mit dem PCR-SelectTM cDNA Subtraction KIT, sowie dem AdvantageTM cDNA PCR KIT von Clontech gemäß dem Protokoll des Herstellers präpariert. Eingesetzt wurde poly(A)+-RNA von unstimulierten und stimulierten (4 h anti-IgM) BL60-2 Zellen. Zur Überprüfung der Subtraktionseffizienz wurde je 1/10 V der PCR-Reaktion mit den angereicherten Sequenzen auf einem 2 %-igen Agarosegel elektrophoretisch getrennt, das Gel wurde geblottet und mit einer 32P-markierten ß-Aktin spezifischen Sonde hybridisiert. Spezifische ß-Aktin Signale wurden nach Autoradiographie sichtbar (Abb. 26).


29

3.1.7. Subtraktive Klonierung über Hydroxyapatit-Chromatographie

5 x Hybridisierungspuffer:

3 M

NaCl

100 mM

Tris-HCl, pH 7,4

10 mM

EDTA

Apoptose-spezifische, differentiell exprimierte Sequenzen wurden durch zwei Hybridisierungen und anschließende Hydroxyapatit (HAP)-Säulenchromatographie abgetrennt. Hydroxyaptatit ist eine kristalline Form des Calcium Phosphats, das DNA über die Interaktion der Phosphate des DNA-Rückrats bindet. Einzelsträngige und doppelsträngige DNA-Moleküle können durch verschiedene Pufferkonzentrationen voneinander getrennt werden. Die optimalen Hybridisierungsbedingungen müssen für jedes batch Hydroxyapatit neu ausgetestet werden. Um Apoptose-spezifische Sequenzen anzureichern, wurde zunächst Gesamt-RNA von unstimulierten BL60-2 Zellen und Zellen, die 4 Stunden mit anti-IgM F(ab)2-Fragmenten inkubiert wurden, über CsCl-Gradienten präpariert (s. 3.1.8.1). Die poly(A)+-RNA wurde mit dem RNeasy Midi- Kit von QIAGEN isoliert. Die isolierte poly(A)+-RNA wurde dann ein zweitesmal über die RNeasy Midi-Säulen aufgereinigt um hochreine poly(A)+-RNA zu erhalten. Für die Hybridisierungen wurden 5 µg poly(A)+-RNA aus stimulierten Zellen und 50 µg poly(A)+-RNA aus unstimulierten BL60-2 Zellen (subtraktive RNA) präpariert. Die poly(A)+-RNA aus stimulierten Zellen wurde in cDNA konvertiert und mit 25 µg poly(A)+-RNA aus unstimulierten Zellen hybridisiert (68 0C, 2 Tage). Die Hybridisierungsreaktion wurden in 1 x Hybridisierungspuffer und 0,2 % SDS in 5 µg Reaktionsvolumen gemäß dem Protokoll des Subtractor Kits in siliconisierten Eppendorfgefäßen durchgeführt. Nach der Hybridisierung wurden die Ansätze in 250 µg 0,12 M Phosphatpuffer aufgenommen und auf die Hydroxyapatit Säulen gegeben. Einzelsträngige, subtrahierte cDNA wurde in 6 ml 0,12 M Phosphatpuffer, pH 6,8 eluiert, doppelsträngige Hybride, in 0,3-0,4 M Phosphatpuffer. Die einzelsträngige, subtrahierte cDNA wurde dann über Nensorb Säulen, gemäß dem Protokoll des Herstellers konzentriert und in einem zweiten Hybridisierungsschritt mit 25 µg poly(A)+-RNA aus unstimulierten Zellen subtrahiert. Differentiell exprimierte Sequenzen wurden so von cDNA/mRNA Hybriden, die Sequenzen darstellen, die in beiden Zelltypen vorhanden sind, getrennt. In einer zweiten, positiven Selektion wurden die subtrahierten Sequenzen mit zweifachem Überschuß der poly(A)+-RNA von stimulierten BL60-2 Zellen (10 µg) hybridisiert. Die mRNA/cDNA Hybride wurden isoliert und in doppelstängige DNA konvertiert. Die Enden wurden mit der T4-DNA-Polymerase aufgefüllt und kinasiert (s. 3.1.13). Die DNA wurde gefällt und an Linker ligiert (3.1.2). Die angereicherte DNA wurde in einer PCR, mit einem Linker spezifischen Oligonukleotid (Linkeroligonukleotid 1) amplifiziert. Zur Überprüfung der Subtraktionseffizienz wurde die Probe radioaktiv markiert (High Prime). Im Vergleich mit einer radioaktiv markierten Probe nicht stimulierter BL60-2 Zellen, wurde ein Slot Blot, auf dem zuvor spezifische DNAs gedottet worden war, hybridisiert. Beide Proben wurden


30

auf 1,2 x 105 cpm/ml Hybridisierungspuffer eingestellt und 2 Tage bei 47 0C, wie unter 3.1.9.3 beschrieben, mit den Slot Blots hybridisiert (Abb. 29).

3.1.8. RNA Präparation

3.1.8.1. Präparation von Gesamt-RNA

GTC-Puffer :

4 M

Guanidinium Isothiocyanat

20 mM

Natrium Acetat, pH 5,2

0,1 mM

DTT

0,5 %

N-Lauryl-Sarcosine

Die Lösung wird mit DEPC Wasser angesetzt: pH 5,5-6,0

CsCl Lösung :

5,7 M

CsCl

100 mM

EDTA pH 8,0

Die Lösung wird mit DEPC Wasser angesetzt und autoklaviert: pH 5,5-6,0

TE Puffer :

10 mM

Tris-HCl, pH 7,4

5 mM

EDTA

Für die RNA-Präparation nach Kroczek et al. (97) wurden ca. 107 Zellen in je 9,5 ml GTC-Lösung resuspendiert und lysiert. Die DNA wurde mit einer Kanüle (20g) auf Eis gescheert. 2,6 ml der CsCl Lösung wurden in ein Beckmann-Zentrifugationsröhrchen (15 ml) vorgelegt und mit der GTC-Zellsuspension überschichtet. Die RNA wurde dann bei 21 000 g in einer Ultrazentrifuge pelletiert (27 h, 18 0C). Das RNA-Pellet wurde in 200 µl TE-Puffer resuspendiert und zweimal mit Ethanol gefällt. Die Konzentration der RNA wurde bei einer OD260 in einem UV-Spektrophotometer gemessen.

3.1.8.2. Präparation von poly(A)ä-RNA

Ca. 1,2 % der Geamt RNA einer Zelle ist poly(A)+-RNA. Diese poly(A)+-RNA kann über Hybridisierungen des poly(A)+-Endes mit poly(dT) Matrizen isoliert werden. In dieser Arbeit wurde die polyA+-RNA mit Hilfe des Oligotex mRNA Mini-, Midi-Kits von QIAGEN oder des polyA-Tract mRNA Isolation System von Promega isoliert. Die Präparation erfolgte gemäß der Anleitung der Hersteller.


31

3.1.9. Northern Blot Anlayse

Die Northern Blot Analyse dient dem Nachweis spezifischer RNA in einem heterogenen RNA-Gemisch z.B. aus Zellen oder Geweben. Die Northern Blot Analyse wurde in Anlehnung an das Protokoll von Kroczek et al. durchgeführt. Dazu wurde Gesamt-RNA isoliert. 10 µg jeder RNA-Probe wurde auf einem Agarosegel elektrophoretisch getrennt (3.1.9.1), auf eine Nylonmembranen transferiert, und UV fixiert. Die Membranen wurden nun mit einer spezifischen radioaktiv markierten DNA oder antisense-RNA Sonde hybridisiert, und die spezifisch hybridisierenden Signale konnten nach Autoradiographie detektiert werden.

3.1.9.1. RNA Agarose Gelelektrophorese

RNA Gel:

1,2 %

Agarose

1,1 %

Formaldehyd

1 x

MOPS

Premix:

1,3 x

MOPS

3 M

Formaldehyd

4 %

Fromamid

Ladepuffer:

1 mM

EDTA, pH 8,0

0,25 %

gesättigtes Bromphenol Blau

0,25 %

gesättigtes Xylen Cyanol

50 %

Glycerol

Die elektrophoretische Trennung der RNA erfolgte auf einem denaturierenden Agarosegel, was Sekundärstrukturen auflöst. 10 µg RNA (in 5,5 µl H20) wurden in 19,5 µl denaturierendem Premix und 5 µl Ladepuffer wie 1 µl EtBr (0,5 mg/ml) aufgenommen. Die Proben wurden bei 55 0C für 15 Min denaturiert und auf Eis gestellt. Sie wurden auf das Gel geladen und in 1 x MOPS Puffer bei 80 V elektrophoretisch aufgetrennt. Da die Ionenkapazität des Puffers sehr niedrig ist, wurde der Puffer ständig mit einer Pumpe umgewälzt. Die getrennte RNA konnte unter UV-Licht visualisiert werden und wurde mit einem Lineal als Größenstandard im Videoprinter von Appligene fotografiert. Die 28 S, 18 S und 5 S rRNA sind dabei als deutliche Banden bei 5,0; 1,87 und 0,16 Kb zu sehen.


32

3.1.9.2. Kapillartransfer von RNA

Das RNA-Gel wurde zunächst 10 Min in 20 x SSC äquilibriert und in einer Naßblotkammer ü.N. auf eine Nylonmembran transferiert. Die RNA wurde durch UV-crosslinking (Stratalinker) auf der Membran fixiert. Der Transfer der RNA wurde anhand der 28 S und 18 S rRNA Banden unter UV-Licht überprüft.

3.1.9.3. Northern Blot Hybridisierung

Prähybridisierungs-/Hybridisierungspuffer:

50 % Formamid

0,25 M NaCl

0,12 M Natriumhydrogenphosphat, pH 7,2

7 % SDS

Waschschritte für DNA und antisense-RNA-Sonden:

Schritt

Waschlösung

DNA antisense-RNA

1. Schritt:

2 x SSC;

0,1 % SDS

RT

RT

2. Schritt

2 x SSC;

0,1 % SDS

50-60

60-68

3. Schritt

0,1 x SSC;

0,1 % SDS

50-60

60-68

Die Nylonmembran mit der transferierten RNA wurden für mindestens 1 Stunde bei 47 0C in Prähybridisierungspuffer inkubiert. Die spezifische, radioaktiv markierte, denaturierte DNA oder antisense-RNA Sonde wurde in einer Konz. von 1-3 x 106 cpm/ml Hybridisierungspuffer eingesetzt und über Nacht, bzw. 48 Stunden (bei schwacher Expression) bei 47 0C (DNA Sonden) oder 68 0C (antisense-RNA Sonden) hybridisiert. Nach der Hybridisierung wurden die Nylonmembranen gewaschen (Schritt 1-3) und die spezifischen Signale nach Autoradiographie detektiert.

3.1.10. Run-on-Analyse

Die Run on-Analyse dient dem Nachweis von neu synthetisierter mRNA in Zellen zu einem bestimmten Zeitpunkt. Die Analyse erfolgt in 4 Schritten:

Lysepuffer:

10 mM

Tris-HCl, pH 7,4

5 mM

MgCl2

10 mM

KCl

0,5 %

NP-40


33

Einfrierpuffer:

50 mM

Tris-HCl, pH 7,4

5 mM

MgCl2

40 %

Glycerin

0,1 mM

EDTA

2 x Transkriptionspuffer:

10 mM

Tris-HCl, pH 8,0

5 mM

MgCl2

0,3 M

KCl

1 mM

NTP (jedes)

5 mM

DTT

HSB-Puffer:

0,5 M

NaCl

50 mM

MgCl2

2 mM

CaCl2

10 mM

Tris-HCl, pH 7,4

Alle Puffer wurden unter RNA-Bedingungen hergestellt und auf 4 0C vorgekühlt.

1.Präparation der Zellkerne:

0,5 - 1 x 108 BL60-2 Zellen vor und nach anti-IgM Stimulation (4 h) wurden pelletiert (500 g, 10 Min, 4 0C), in 1 x PBS gewaschen, erneut pelletiert und vorsichtig in 10 ml Lysepuffer aufgenommen. Der Lyseansatz wurde 5 Min auf Eis inkubiert. Die lysierten Zellen wurden erneut pelettiert (500 g, 10 Min, 4 0C), und mit einem Dounce Homogenisator (Typ B) aufgeschlossen, wobei die Zellkerne intakt blieben. Die Zellkerne wurden bei 2000 rpm für 10 Min abzentrifugiert. Der Überstand wurde verworfen. Die Kernpellets wurden in 200 µl Einfrierpuffer resuspendiert, in flüssigem Stickstoff schockgefroren und bei -80 0C gelagert.

2. Radioaktive Markierung neu synthetisierter RNA

Die radioaktive Markierung neu synthetisierter RNA erfolgte bei 30 0C für 30 Min in 1 x Transkriptionspuffer. 200 µl Kerne wurden langsam auf Eis aufgetaut und mit 200 µl 2 x Transkriptionspuffer, sowie 10 µl alpha32-UTP (760 Ci/mmol, 10 mCi/ml) versetzt.

3. Isolierung der radioaktiven RNA

Der Transkriptionsansatz wurde in 0,6 ml HSB-Puffer (versetzt mit 200 U RNase freie DNase I) aufgenommen und für 5 Min bei 30 0C inkubiert. In diesem Hochsalzpuffer lysieren die Kerne und die DNA wird durch die DNase I degradiert. Die RNA Präparation erfolgte nun über einen CsCl-Gradienten (s. 3.1.8.1) unter Zusatz von 100 µg t-RNA.

4. Hybridisierung der radioaktiven RNA mit gedotteten Plasmiden

Die Prähybridisierung und Hybridisierung erfolgte wie unter 3.1.9.3, beschrieben bei 60 0C. 105 cpm radioaktiv markierte RNA wurde pro ml Hybridisierungspuffer eingesetzt. Die zu


34

analysierenden Plasmide wurden in einer Konz. von ca. 1-3 µg pro Slot mit einer Slot Blot Apparatur von Schleicher und Schüll auf eine Nylonmembran transferiert. Die DNA wurde auf der Membran denaturiert (s. 3.1.15) und UV-fixiert (Stratalinker). Nach der Hybridisierung wurde die Membran wie unter 3.1.9.3 beschrieben gewaschen. Die spezifischen Signale konnten durch Autoradiographie sichtbar gemacht werden.

3.1.11. Southern Blot Analyse

Die Southern Blot Analyse dient dem Nachweis spezifischer DNA-Moleküle in einem heterogenen Gemisch von DNA. Die zu analysierende DNA wurde zunächst auf einem Agarosegel elektrophoretisch getrennt und im Gel denaturiert. Dazu wurde das Gel in 0,5 M NaOH; 1,5 M NaCl für 15 Min inkubiert und in 0,5 M Tris-HCl, pH 7,5; 1,5 M NaCl für 10 Min neutralisiert. Die so denaturierte DNA wurde durch Kapillartransfer auf eine Nylonmembran transferiert. Durch UV crosslinking (Stratalinker) wurde die DNA auf der Membran fixiert. Die so präparierte Membran wurde mit einer radioaktiv markierten DNA-Sonde hybridisiert. Die DNA-Sonde wurde in einer Endkonzentration von 106 cpm/ml eingesetzt. Die Signale wurden durch Autoradiographie detektiert.

3.1.12. Radioaktive Markierung von DNA

Doppelsträngige DNA wurde nach der Methode von Feinberg und Vogelstein radioaktiv markiert (98). Dazu wurde die DNA denaturiert und mit einem Gemisch von Nonanukleotiden hybridisiert, die als Primer für die Synthese durch das Klenow Fragment der DNA-Polymerase in Gegenwart von alpha32P-dCTP dienten.

25 ng DNA wurde in 21 µl H20 denaturiert (5 Min, 95 0C), mit 4 µl High Prime-Mix (Boehringer) und 5 µl alpha32P-dCTP bei 37 0C für 30 Min inkubiert. Nicht eingebaute, radioaktiv markierte Nukleotide wurden über Sephadex spin columns (Pharmacia) abgetrennt. Die spezifische Aktivität dieser radioaktiv markierten DNA-Sonden lag zwischen bis 1-3 x 109 cpm/µg und wurde in einer Konzentration von 1-3 x 106 cpm/ml Hybridisierungspuffer eingesetzt.

3.1.13. Endmarkierung von DNA mit der T4-Polynucleotidkinase

Zur radioaktiven Markierung kurzer Oligounkleotide kann das gamma-ständige Phosphat des gamma32P-dATP auf die dephosphorylierte 5´-OH Gruppe des Oligonukleotides übertragen werden.

In einem 20 µl Reaktionsansatz wurden 100 ng Oligonukleotid in 1 x Kinasepuffer (USB), mit 3 µCi gamma32P-dATP und 10 U T4-Polynukleotidkinase (USB) für 30 Min bei 37 0C inkubiert. Nicht eingebaute, radioaktive Nukleotide wurden über Sephadex Spin columns (Pharmacia) abgetrennt. Die spezifische Aktivität betrug 1-2 x 109 cpm/µg Oligonukleotid.


35

3.1.14. Herstellung von antisense-RNA Sonden

Für die Northern Blot Analysen wurden antisense-RNA Sonden hergestellt. Antisense-RNA Sonden bieten gegenüber radioaktiv markierten DNA-Sonden den Vorteil, das nur der zur mRNA komplementäre Strang radioaktiv markiert wird, was unspezifische Bindungen reduziert. Da RNA/RNA Bindungen stärker sind als DNA/DNA Bindungen, kann außerdem eine Sensitivitätserhöhung erreicht werden.

Antisense-RNA Sonden wurden mit dem Riboprobe System von Promega mit der entsprechenden RNA-Polymerase (SP6, T3, T7) hergestellt. 1 µg Plasmid DNA wurde mit 5 µl alpha32P-UTP und den Reagenzien gemäß dem Protokoll des Herstellers für 1 Stunde bei 37 0C inkubiert. Die synthetisierte antisense-RNA wurde 2 x mit Ethanol gefällt. Das trockene RNA-Pellet wurde in 10 µl H20 resuspendiert. Die spezifische Aktivität der antisense-Sonden lag bei 2 - 3 x 108 cpm/µg DNA.

3.1.15. Slot Blot Analyse

Zur Slot Blot Analyse wurden ca. 1 µg der zu analysierenden DNA-Proben mit einer Slot Blot Apparatur von Schleicher und Schüll auf eine Nylonmembran transferiert. Die DNA wurde durch Inkubation der Membran in 1,5 M NaCl, 0,5 M NaOH für 2 Min denaturiert und in 1,5 M NaCl, 0,5 M Tris-HCl, pH8,0 für 5 Min neutralisiert. Die Membran wurde halbiert und je eine Hälfte mit einer radioaktiv markierten cDNA-Sonde von unstimulierten BL60-2 Zellen, bzw. mit einer cDNA-Sonde von stimulierten BL60-2 Zellen oder einer subtrahierten Probe hybridisiert.

3.1.16. Polymerase-Kettenreaktion (PCR)

Die Polymerase Kettenreaktion (PCR) ermöglicht die Amplifikation von spezifischen DNA-Fragmenten (99). In sich wiederholenden Zyklen der Denaturierung der DNA, der Hybridisierung sequenzspezifischer Oligonukleotid-Primer und der Synthese der DNA, wird der zwischen den Primern liegende Bereich amplifiziert. Die DNA-Synthese wurde durch die hitzestabile DNA-Polymerase aus dem Bakterium Thermus aquaticus ermöglicht und erfolgte bei 72 0C. Eine Standard-PCR Reaktion wurde für 25 bis 35 Zyklen in einem automatischen Thermocycler durchgeführt:

ca. 100 ng Erststrang-cDNA; 1 ng Plasmid DNA

1 x PCR Puffer

0,2 mM je Desoxynukleosidtriphosphat (dATP, dCTP, dTTP, dGTP)

0,2 mM pro Oligonukleotid-Primer

5 U Taq DNA-Polymerase

auf 100 µl mit H20


36

Die Reaktion erfolgte nach folgenden Bedingungen:

5 min Denaturierung bei 95 0C

dann 25-35 Zyklen:

1 min

Denaturierung bei 95 0C

1 min

Hybridisierung bei 50-60 0C

1 min

DNA-Synthese bei 72 0C

anschließend erfolgte ein 5-minütiger Polymerisierungsschritt bei 72 _C. Die Amplifikations-produkte wurden auf einem EtBr-haltigen Agarosegel elektrophoretisch getrennt, wobei 1/10 V des Reaktionsansatzes für ein analytisches Gel und der gesamte Ansatz für ein präparatives Gel aufgetragen wurde. Die DNA-Fragmente wurden unter UV-Licht sichtbar gemacht.

3.1.17. Sequenzanalyse von DNA-Fragmenten

Die Anwendung von thermostabilen Polymerasen ermöglicht in der DNA-Sequenzanalyse analog zur PCR die gleichzeitige Amplifikation und DNA-Sequenzierung. Dieses Verfahren wird Cycle Sequencing genannt. Dabei wird allerdings nur ein Primer eingesetzt. In einer Mixtur aus DNA-Plasmid, Primer, DNA-Polymerase, dNTP/ddNTP-Gemisch wird ein thermisches Profil, bestehend aus Denaturierung, Primerhybridisierung und DNA-Synthese ca. 30-mal durchlaufen. Sequenzreaktionen wurden mit dem Taq Cycle Sequencing Kit von Perkin Elmer vollzogen. Dabei wurden fluoreszenzmarkierte Didesoxynukleotide in die DNA eingebaut. Die Sequenz wurde nach gelelektrophoretischer Trennung und Analyse auf einem Sequenzer der Firma Perkin Elmer erhalten.


37

3.2. Proteinchemische Methoden

3.2.1. Subtraktive Proteinanalyse

Für den subtraktiven Vergleich der Proteinmuster wurden Proteine der BL60-2 Zellen vor und nach anti-IgM Stimulation und magnetischer Depletion bzw. Separation mittels der zweidimensionalen-Gelelektrophorese aufgetrennt. Die differentiellen Proteinspots wurden isoliert, im Gel tryptisch verdaut, über die Reversed-Phase-HPLC aufgereinigt und über Edman Abbau oder MALDI-MS identifiziert.

3.2.1.1. Präparation der Protein-Proben

Probenpuffer:

20 mM

Tris-HCl, pH 7,1

1 mM

KCl

1 mM

EDTA

1 mM

PMSF

1,4 µM

Pepstatin

1 mM

Benzamidin

2,1 µM

Leupeptin

BL60-2 Zellen wurden nach anti-IgM Stimulation und magnetischer Depletion bzw. Separation (3.3.6) in flüssigem Stickstoff schockgefroren. Diese Zellpellets apoptotischer und nicht apoptotischer Zellen wurden auf Eis aufgetaut und direkt in einen Protease-Inhibitor-haltigen Puffer gemäß Klose und Kobalz (100) resuspendiert.

Anschließend wurden 9 M Urea, 70 mM DTT und Trägerampholyte (2 %) (Servalyt pH 2-4) hinzugegeben. Die Proteinkonzentration wurde mit einer Aminosäureanalyse bestimmt und betrug ca. 30-35 mg/ml. 60 µg dieser Proben wurden für ein analytisches Gel verwendet, 900 µg für ein präparatives Gel (101).

3.2.1.2. Zweidimensionale-Gelelektrophorese

Die Proteinproben wurden nach der zweidimensionalen-Gelelektophorese in Anlehnung an Klose und Kobalz aufgetrennt (100). Die Gelkammer, sowie die Gellösungen wurden von der Firma WITA (Teltow, Deutschland) bezogen. In der ersten Dimension wurden isoelektrisch fokussierende Rundgele (Länge 20 cm, Durchmesser der analytischen Gele: 0,09 cm, präparative Gele: 0,25 cm) verwandt. In der zweiten Dimension der Gelelektophorese wurden 30-cm Gele eingesetzt. Die analytischen Gele wurden silbergefärbt (100), die präparativen Gele Coomassie-Blau (102). Die Proteinmuster der silbergefärbten Gele von unstimulierten BL60-2 Zellen, sowie stimulierten BL60-2 Zellen wurden verglichen. Differentielle Spots wurden dem Coomassie gefärbten, präparativen Gel zugeordnet und ausgeschnitten.


38

3.2.1.3. Enzymatische Im-Gel-Spaltung

Für die mikropräparativen Untersuchungen der differentiellen Proteinspots wurden isolierte Spots von bis zu 10 Coomassie gefärbten Gelen vereint und im Gel tryptisch gespalten. Die Peptide wurden aus dem Gel eluiert und entsalzt (103).

3.2.1.4. Reversed-Phase-HPLC und Edman Sequenzierung

Die Peptide wurden nach der tryptischen Spaltung auf einer µRPC C2/C18 SC2, 1/10 Säule (innerer Durchmesser: 2,1 mm; Länge: 10 cm ; Pharmacia-Biotech) auf einem SmartTM-System getrennt. Die Trennung erfogt durch einen Acetonitril Gradienten in 0,1 % v/v TFA und einer Durchflußrate von 100 µl/min bei RT. Die Peptide wurden auf einem Polybren beschichteten Glassfilter sequenziert. (Perkin Elmer/Applied Biosystems).

3.2.1.5. MALDI-MS

Die Massenspektrometrie ermöglicht die Bestimmung der Molekülmasse freier Ionen im Hochvakuum. Die zu analysierenden Peptide wurden mit der Matrix (gesättigte Lösung alpha-Cyano-4-Hydroxyzimtsäure in 50 % Acetonitril und 0,1 % TFA) auf einem Probenteller kokristallisiert, mit einem Laser ionisiert und in einem Massenanalysator gemäß ihres Masse/Ladungs Quotienten aufgetrennt und detektiert. Die benötigte Proteinmenge lag im Pikomol Bereich. Die Massenspektrometrie wurde auf einem VG Tof Spec (Fisons) bei 24 KV und einem Nitrogen Laser (337 nM, Puls Dauer 4 ns) durchgeführt.

3.2.2. Protein Identifizierung mittels Datenbankvergleich

Die in der MALDI-Massenspektometrie erhaltenen Peptid-Massen wurden mit den Daten der Swiss Prot- und EMBL-Datenbank verglichen. Dabei wurden die Peptid-Muster mit den Mustern bekannter Proteine, die sich nach hypothetischem Trypsin Verdau ergeben, verglichen. Dieser Vergleich ermöglicht die Identifizierung isolierter Proteinspots.

3.2.3. Western Blot Analyse

Western Blot-Puffer:

50 mM

Tris-HCl , pH 7,5

150 mM

NaCl

1 %

Triton X-100

1 %

Trockenmilchpulver


39

Lysepuffer:

20 mM

Tris-Acetat, pH 7,0

10 mM

Natriumglycerophosphat

50 mM

Natriumfluorid

5 mM

Natriumpyrophosphat

1%

Triton X-100

0,1 mM

EDTA

1 mM

EGTA

0,2 mM

PMSF

0,27 mM

Sucrose

2 µg/ml

Leupeptin

BL60-2 Zellen wurden nach unterschiedlichen Inkubationszeiträumen mit anti-IgM pelletiert (250 g, 10 Min, 4 0C), und in 1 x PBS gewaschen. Die Zellpellets wurden in Lysepuffer resuspendiert und für 40 Min bei 4 0C inkubiert. Die Proteine (30 µg pro Spur) wurden auf einem SDS-Polyacrylamidgel elektrophoretisch aufgetrennt. Nach dem Transfer auf eine Nitrozellulosemembran wurden die Membranen in Western Blot-Puffer für 30 Min bei RT geblockt und in demselben Puffer mit dem entsprechenden Antikörper (1:1000 Santa Cruz; 1: 500 hnRNP A1) für 1 h bei RT inkubiert. Danach wurden die Membranen 2 x 15 Min in Western Blot-Puffer gewaschen und für 1 h mit einem HRP-konjugierten Zweitantikörper inkubiert (1:15000, Santa Cruz). Nach erneutem Waschen wurden die Membranen mit dem ECL System von (Amersham) entwickelt, und die Signale nach Autoradiographie detektiert.

3.2.4. Expression rekombinanter Proteine durch IPTG-Induktion

Die cDNA Sequenzen wurden zunächst in den entsprechenden pQE Expressionsvektor von QIAGEN kloniert. Diese Vektoren ermöglichen die Expression eines Fusionsproteins mit sechs aufeinander folgenden Histidinen. Die Klonierung erfolgte gemäß der Anleitung des Herstellers, wobei die Restriktionsspaltungen und Ligationen nach den Standard Protokollen von Sambrook et al. erfolgten (96).

Die Plasmide wurden in den E.coli Bakterienstamm M15 transformiert und konnten auf Ampicillin/Kanamycin-Platten selektioniert werden. Die Induktion großer Proteinmengen erfolgte in 400 ml LB Medium (+ 100 µg/ml Ampicillin), das mit 0,4 ml einer Übernachtkultur angeimpft, und bei 37 0C bis zu einer OD600 von 0,5 kultiviert wurde. Durch die Zugabe von IPTG wurde die Proteinexpression induziert (1 mM IPTG, 4 h bei 37 0C). Die induzierten Bakterien wurden abzentrifugiert, in Harnstoff-haltigem Lysepuffer resuspendiert und durch Ultraschallbehandlung aufgeschlossen. Durch die Fusion der sechs Histidine konnten die Proteine nun unter denaturierenden Bedingungen auf einer Nickelchelatsäule isoliert werden. Dabei wurden die positiv geladenen Histidine der Fusionsproteine an Nickel beladene Agarose gebunden und konnten so von den restlichen Proteinen isoliert werden.


40

3.2.5. In vitro Spaltung durch rekombinante Caspase

2 x Reaktionspuffer:

0,2 %

CHAPS

100 mM

HEPES, pH 7,5

2 mM

PMSF

100 mM

Leupeptin

40 µg

Aprotinin

10 mM

DTT

Die in vitro Spaltung rekombinanter Proteine wurde in 20 µl Reaktionsvolumen angesetzt. 60 ng rekombinante Caspase 1, 3, 6 oder 7 wurden mit 1 µl rekombinantem SP1 Protein (1 footprint unit, Promega), bzw. 1 µg hnRNP A1 Protein in 1 x Reaktionspuffer bei 37 0C für 2 h mit oder ohne Caspase-Inhibitor, 200 µM z-DEVD-fmk oder ac-YVAD-cmk (Calbiochem) inkubiert. Die Reaktionen wurden auf einem Polyacrylamidgel elektrophoretisch getrennt.

Für die Kontrollreaktionen der Caspase 1 wurden 5 µl eines in vitro Translationsansatzes (3.2.7), wie oben beschrieben, in die Spaltreaktion eingesetzt. Die Proben wurden auf einem 15-% igen SDS-Polyacrylamidgel aufgetrennt. Das Gel wurde zur Signalverstärkung 10 Min in einer Amplifyer-Lösung (Amersham) inkubiert. Die 35S-markierten Proteine wurden nach Autoradiographie detektiert.

3.2.6. In vitro Translation im TNT Retikulozyten Lysat

Pro-IL1ß in pGEM11 wurde im TNT Retikulozyten Lysat nach dem Protokoll von Promega transkribiert und translatiert. Die Transkription erfolgte mit der SP6 Polymerase unter Zugabe von 35S-Methionin (1000 µCi/ml) in einem 20 µl Reaktionsansatz bei 30 0C für 1 Stunde.

3.2.7. EMSA (elektro mobility shift assay)

Der EMSA dient dem Nachweis von DNA-Protein-Wechselwirkungen. Das Prinzip beruht darauf, daß Protein-DNA-Komplexe in einer elektrophoretischen Auftrennung langsamer laufen als freie DNA. Da die eingesetzten DNA-Bindungssequenzen zuvor radioaktiv markiert wurden, können diese Komplexe nach Autoradiographie detektiert werden.

2 x DNA- Bindungspuffer:

40 mM

HEPES, pH 7,9

120 mM

KCl

8 %

Ficoll G400

2 µg

poly(dIdC)

4 mM

DTT

4 µg

BSA


41

5 %-iges Gel zur DNA-Protein-Komplex Analyse:

20 %

Acrylamid/Bisacrylamid (29:1)

50 mM

Tris-HCl, pH 7,5

50 mM

Borsäure

0,1 mM

EDTA

Kernextrakte von BL60-2 Zellen wurden mit anti-IgM über verschiedene Zeiträume stimuliert, und nach dem Protokoll von Schreiber et al. präpariert (104). 5 µg dieser Kernextrakte wurden mit Oligonukleotiden inkubiert, die eine SP1 Erkennungssequenz, eine mutierte SP1 Erkennungssequenz oder eine Oct-2 Erkennungssequenz darstellen. Diese Oligonukleotide waren zuvor mit der T4-Polynukeotidkinase und alpha32P-dATP radioaktiv markiert worden (3.1.13). Sie wurden mit einer Aktivität von 5000 cpm pro Reaktion eingesetzt. Die DNA Bindungsreaktion wurde in 20 µl Reaktionsvolumen in 1 x DNA-Bindungspuffer angesetzt und für 30 Min bei 30 0C inkubiert. In einer Supershift Analyse wurde 15 Min nach Inkubation 0,5 µg eines SP1 spezifischen Antikörpers (Santa Cruz) zu dem Reaktionsansatz gegeben. In der Kontrollreaktion wurde die Supershift Analyse mit einem Peptid kompetiert (0,1 µg PEP2 Santa Cruz), das 30 Min mit dem Antikörper vorinkubiert wurde. DNA-Protein-Komplexe wurden auf einem 4 %-igen Polyacrylamidgel aufgetrennt, und nach Autoradiographie detektiert.

3.2.8. Caspase 3 Aktivitätsmessung

1 x 106 Zellen der Burkitt Lymphom Zellinie BL60-2 wurden über verschiedene Zeitintervalle mit anti-IgM F(ab)2-Fragmenten stimuliert. Die Zellen wurden pelletiert, in 1 x PBS gewaschen und gemäß dem Apo AlertTM CPP32 Assay Kit von Clontech lysiert. Die Zellysate wurden mit dem Substrat DEVD-p-Nitroanilid (DEVD-pNA) für 50 Min bei 37 0C inkubiert. Die Spaltung von DEVD-pNA führt zur Freisetzung des Chromophor pNA und konnte bei einer OD400 im Spektrophotometer gemessen werden.


42

3.3. Methoden der Zellkultur

3.3.1. Kulturbedingungen für die Burkitt Lymphom Zellinie

Medium zur Kultivierung der BL41, BL60-Zellen:

500 ml

RPMI 1640

10 %

FCS

2 mM

Glutamin

10 mM

HEPES pH 7,4

1 mM

Natrium-Pyruvat

20 nM

Bathocuproindisulfonsäure (BCS)

50 µM

alpha-thioglycerol

100 µg/ml

Ampicillin/Streptamycin

Die Zellen wurden bei 37 0C in einer 5 %-igen CO2 Atmosphäre kultiviert. Die optimale Dichte betrug 0,2-1 x 106 Zellen pro Milliliter Kulturmedium.

3.3.2. Subklonierung der BL60 Zellen

Um einen Klon der BL60 Zellen zu erhalten, der nach anti-IgM Inkubation Apoptose sensitiv ist, wurden die Zellen subkloniert. Dazu wurden die Zellen auf 1 Zelle pro Milliliter Kulturmedium eingestellt und in einer 96-well Flachbodenplatte ausgesät. In jedes well wurden 100 µl der verdünnten Zellsuspension gegeben, so daß statistisch in jedem 10-ten well eine Zelle vorhanden ist. Die 96-well Platten wurden für 2-3 Wochen im Brutschrank inkubiert und die herangewachsenen Klone in eine 24-well Platte transferiert und expandiert. Die einzelnen Klone wurden auf ihre Sensitivität gegenüber anti-IgM getestet.

3.3.3. Induktion der B-Zell Apoptose mit anti-IgM F(ab)2-Fragmenten

Zur Apoptose-Induktion wurden die BL60-2 Zellen auf eine Zelldichte von 2 x 105 Zellen pro Milliliter Kulturmedium eingestellt. Anschließend wurden die Zellen mit 1,3 µg/ml anti-IgM F(ab)2-Fragmenten versetzt und für die gewünschte Zeitdauer bei 37 0C im Brutschrank inkubiert.

3.3.4. Inkubation der BL60 Zellen mit Caspase-Inhibitoren

BL60 Zellen wurden mit den zellpermeablen, irreversiblen Caspase-Inhibitoren z-DEVD-fmk oder ac-YVAD-cmk inkubiert, bevor die Zellen mit anti-IgM F(ab)2-Fragmenten stimuliert wurden. Die Inhibitoren wurden in 100 % DMSO gelöst (Stocklsg. 10 mM) und in einer Endkonzentration von 0,1 bis 200 µM zur Zellsuspension gegeben. Dabei durfte die DMSO-Konzentration die Endkonzentration von 1 % in der Zellkultur nicht übersteigen. Die Inhibitoren wurde 30 Min vor Zugabe der anti-IgM F(ab)2-Fragmente zur Zellkultur gegeben.


43

3.3.5. Zellmarkierung mit Annexin-V/FITC

Phosphatidylserin (PS) ist ein Phospholipid, daß Bestandteil der inneren Zellmembran ist. Nach Apoptose Induktion wird PS in die äußere Membranschicht transloziert. Diese Translokation des PS ist ein frühes Merkmal für den Prozeß der Apoptose. Annexin-V bindet spezifisch an PS, so daß apoptotische Zellen mittels FITC gekoppeltem Annexin-V im fluorescence activated cell sorter (FACS) von nicht apoptotischen unterschieden werden können.

3.3.6. Magnetische Zellseparation und Depletion

Phosphatidylserin (PS) positive, apoptotische Zellen, die zuvor mit Annexin-V/FITC markiert wurden (s. 3.3.5) können in einem zweiten Schritt an anti-FITC magnetische beads gebunden werden und in einer magnetischen Separation bzw. Depletion von nicht apoptotischen Zellen getrennt werden.

Annexin-V/FITC Puffer:

10 mM

Hepes, pH 7,4

150 mM

NaCl

5 mM

KCl

1 mM

MgCl2

1 mM

CaCl2

3.3.6.1. Magnetische Depletion

Bei der Kultivierung der BL60 Zellen sterben ca. 5 % der Zellen spontan durch Apoptose. Diese apoptotischen Zellen wurden durch magnetische Trennung von den restlichen, nicht apoptotischen Zellen abgetrennt.

Dazu wurden 2 x 108 Zellen BL60-2 Zellen für 10 Min bei 1200 rpm (400 g), bei 4 0C pelletiert, in 10 ml Annexin-V/FITC-Puffer gewaschen und erneut pelletiert. Das Zellpellet wurde in 2 ml FITC-Puffer resuspendiert und mit 20 µl Annexin-V/FITC für 30 Min auf Eis inkubiert. Die Zellen wurden in 50 ml Annexin-V/FITC-Puffer gewaschen, wodurch freies Annexin-V/FITC entfernt wurde. Das Zellpellet wurde erneut in 2 ml FITC-Puffer aufgenommen und mit 100 µl anti-FITC microbeads für 15 Min bei 4ºC inkubiert. Die Separationssäule (Miltenyi, BS-Säule) wurde in 30 ml Annexin-V/FITC-Puffer äquilibriert, und mit weiteren mit 30 ml Annexin-V/FITC-Puffer gewaschen. Die Zellsuspension wurde auf die Säule gegeben und mit 2 x 3 ml Annexin-V/FITC-Puffer wurden die depletierten Zellen aus der Säule eluiert. Die Zellen wurden pelletiert (400 g, 10 Min, RT) und in 1 x PBS gewaschen. Die trockenen Zellpellets wurden in flüssigem Stickstoff schockgefroren und bei -80ºC gelagert.


44

3.3.6.2. Magnetische Separation

Nach anti-IgM Induktion der BL60-2 Zellen sterben ca. 40-60 % durch Apoptose. Diese Zellen wurden durch Annexin-V/FITC Markierung und Inkubation mit anti-FITC beads in der magnetisierten Säule zurückgehalten und von den nicht bindenden, nicht apoptotischen Zellen getrennt.

108 Zellen wurden, wie unter 3.3.6.1 beschrieben, mit Annexin-V/FITC und anti-FITC-beads inkubiert. Die Separationssäule (Miltenyi, VS+ -Säule) wurde zuvor 3 mal mit 3 ml entgastem Annexin-V/FITC-Puffer äquilibriert, und die Zellsuspension auf die Säule aufgetragen. Die Säule wurde mit 10 ml Puffer gespült. Die nicht apoptotischen Zellen wurden so eluiert, während die apoptotischen Zellen in der Säule zurückgehalten wurden. Die Säule wurde aus dem Magneten entfernt und die apoptotischen Zellen mit 6 ml Annexin-V/FITC-Puffer eluiert. Die Zellen wurden pelletiert (400g, 10 Min, RT) und in 2 ml 1 x PBS, 2 mM EDTA gewaschen, wodurch das gebundene Annexin-V/FITC entfernt wurde. Die trockenen Zellpellets wurden in flüssigem Stickstoff tiefgefroren.

3.3.7. Acridinorange Färbung

Acridinorange (3,6-Bis-(dimethyl-amino)-Acridin) ist ein Farbstoff, der unspezifisch in DNA-Moleküle interkaliert. Diese Färbung kann unter UV-Licht visualisiert werden und diente der Quantifizierung apoptotischer Zellen, die durch ihre charakteristische Kernfragmentierung von nicht apoptotischen Zellen unterschieden wurden (Abb. 5).

3.3.8. Proliferationsassay

Durch den Einbau von Tritium-markiertem Thymidin in die neusynthetisierte DNA kann die Proliferation von Zellen bestimmt werden. Die Proliferation der BL60-2 Zellen wurde in Abhängigkeit vom anti-IgM Stimulus untersucht. Je 4 x 104 Zellen wurden in 200 µl Kulturmedium in eine 96-well Flachbodenplatte gegeben und mit steigenden Konzentrationen (0 - 5,0 µgml) Kulturmedium anti-IgM für 24 Stunden in einem Brutschrank bei 37 0C und 5%-iger CO2 Atmosphäre inkubiert. Dabei wurden alle Proben als Triplikate angesetzt. Nach 24 Stunden wurden 0,5 µCi 3H-Thymidin zugegeben und die Zellen für weitere 18 Stunden im Brutschrank inkubiert. Anschließend wurden die Zellen auf 96-well Filterplatten gesaugt, wobei freies 3H-Thymidin, das nicht in die DNA inkorporiert wurde, ausgewaschen wurde. Nach Zugabe von 50 µl Szintillationsflüssigkeit wurde die Menge des eingebauten 3H-Thymidin in einem Szintillationszähler (Top count, Canberra Packard) gemessen.


45

3.3.9. FACS (fluorescence activated cell sorting)

Antikörper Verdünnungs (AKV)-Medium:

10 %

Venimun

0,1 %

NaN3

1 x

PBS

Die Analyse von Zellen in einem Durchflußzytometer bietet die Möglichkeit die Oberflächenmoleküle einzelner Zellen zu analysieren. Dazu werden Zellen mit spezifischen, fluoreszenzmarkierten Antikörpern markiert und durch Licht zur Fluoreszenz angeregt. Die Fluoreszenzemission und Lichtstreuung wird registriert und daraus die Größe und Gestalt der Zelle errechnet. Da einzelne Zellen detektiert werden, können Zellpopulationen quantifiziert werden. Zur Charakterisierung der Oberflächenmoleküle der BL60-2 Zellen wurden 1 x 106 Zellen abzentrifugiert (400 g, 10 Min, 4 0C) und in 1 x PBS gewaschen. Das Pellet wurde in 200 µl AKV-Medium resuspendiert und auf eine Zellzahl von 5 x 106 Zellen pro ml eingestellt. Die Zellen wurden in eine 96-well Platte pipettiert, 30 Min bei 4 0C inkubiert und 5 Min bei 400 g abzentrifugiert. Sie wurden erneut in 50 µl AKV-Medium aufgenommen, mit Primärantikörper versetzt (20 µg/ml) und für 20 Min bei 4 0C inkubiert. Jedes well wurde 2 x mit 150 µl 1 x PBS gewaschen. Danach wurden 50 µl FITC-, oder PE-gekoppelter Zweitantikörper (1:100 in AKV-Medium) in jedes well zugegeben und bei 4 0C für 20 Min inkubiert. Die Platte wurde erneut 2 x mit 1 x PBS gewaschen, und die resuspendierten Zellen in einem FACS-Scan (Becton Dickinson) analysiert.

Apoptotische Zellen wurden durch Annexin-V/FITC Färbung markiert und konnten so von nicht apoptotischen Zellen im FACS unterschieden werden. Ca. 106 Zellen wurden in 200 µl Annexin-V/FITC Puffer aufgenommen, mit 2 µl Annexin-V/FITC für 30 Min auf Eis inkubiert, erneut in Puffer gewaschen, und im Durchflußzytometer gemessen.

3.3.10. Elektronenmikroskopie

Die elektronenmikroskopischen Aufnahmen der BL60-2 Zellen vor und nach anti-IgM induzierter Apoptose wurden von Dr. F. Vogel am MDC, Berlin erstellt.


[Titelseite] [1] [2] [3] [4] [5] [6] [7] [Bibliographie] [Anhang] [Abkürzungsverzeichnis] [Selbständigkeitserklärung] [Lebenslauf] [Danksagung] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiDi DTD Version 1.1
a subset from ETD-ML Version 1.1
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Nov 26 14:02:57 1999