v. Wintzingerode-Knorr, Friedrich Wasmuth Lotar: Untersuchungen zur mikrobiellen Diversität einer anaeroben, Trichlorbenzol-dechlorierenden Mischkultur

15

Kapitel 2. MATERIAL UND METHODEN

2.1. Material

2.1.1. Anaerobes, Trichlorbenzol-dechlorierendes Konsortium

Das im Rahmen dieser Arbeit untersuchte TCB-dechlorierende anaerobe Konsortium wurde in der Arbeitsgruppe von Prof. Hegemann (Technische Universität Berlin, Fachgebiet Siedlungswasserwirtschaft) aus belastetem Sediment der Saale bei Jena (SJ) angereichert und in einem Wirbelschichtreaktor kultiviert (s. Abb. 2.1.1.1). Vorhergehende Untersuchungen hatten gezeigt, daß Anreicherungskulturen dieses Sediments alle Chlorbenzole (MCB bis HCB) reduktiv dechlorieren (Nowak et al., 1996). Die von Herrn Burkhard Selent durchgeführten Versuche zum Betrieb des Wirbelschichtreaktors erstreckten sich über den Zeitraum von August 1994 bis Dezember 1997. Wesentliches Ziel dieser Arbeiten war die kontinuierliche Mineralisierung von Trichlorbenzolen durch Kopplung der anaeroben Dechlorierung im Wirbelschichtreaktor mit dem Abbau der Dechlorierungsprodukte in einem weiteren nachgeschalteten aeroben Bioreaktor. In Tab. 2.1.1.1 sind die Zeitpunkte der Entnahme von Probenmaterial aus dem anaeroben Wirbelschichtreaktor sowie Angaben zur Reaktorführung aufgelistet. Die Kultivierung erfolgte mit RAMM-Mineralsalzmedium (s. 2.1.4.2.2) dem ein Gemisch der isomeren Trichlorbenzole (1,2,3-TCB; 1,2,4-TCB; 1,3,5-TCB je 10 mg/l), Natrium-Acetat und Methanol (je 100 mg/l) zugesetzt wurden. Während des kontinuierlichen Betriebes des anaeroben Wirbelschichtreaktors blieben Redoxpotential und pH-Wert konstant bei Werten von unter -300 mV bzw. bei pH 7. Auch nach kurzzeitigem Sauerstoffeintrag, etwa durch Probennahmen oder gezielte Störungen, sank das Redoxpotential innerhalb weniger Tage auf den ursprünglichen Wert zurück. Das dem Bioreaktor zugeführte Mineralsalzmedium wies dabei Redoxpotentiale zwischen 0 und 50 mV auf. Weiterhin wurde eine kontinuierliche Gasentwicklung beobachtet. Vorhergehende Untersuchungen des TCB-dechlorierenden Konsortiums ließen vermuten, daß es sich bei den gebildeten Gasen um Methan und Kohlendioxid handelte (Nowak et al., 1996). Unabhängig vom Betriebszustand des anaeroben Wirbelschichtreaktors (alleinstehend oder in Kopplung mit einem nachgeschalteten aeroben Festbettreaktor) wurden alle zugesetzten Trichlorbenzole mit Eliminationsraten zwischen 80 und 90% zu DCB und MCB dechloriert. Dabei trat MCB als


16

Hauptdechlorierungsprodukt auf. In einigen Fällen konnte Benzol im Ablauf nachgewiesen werden, was auf eine Dechlorierung von MCB hinwies. Die Zugabe von Nitrat als alternativem Elektronenakzeptor bewirkte ein Ansteigen des Redoxpotentials und eine Verringerung der TCB-Dechlorierung.

Abb. 2.1.1.1 Schematische Darstellung des anaeroben Wirbelschichtreaktors zur kontinuierlichen Kultivierung des TCB-dechlorierenden Konsortiums (B. Selent, Technische Universität Berlin).


17

Tab. 2.1.1.1 Betriebsbedingungen des Wirbelschichtreaktors zum Zeitpunkt der Probennahmen.

Zeitpunkt der Probennahme

Betriebsbedingungen

31.1.95

Keine Kopplung, kontinuierlicher Betrieb seit 6 Monaten

2.12.96

Keine Kopplung, RAMM-Medium ohne Nitrat, kontinuierlicher Betrieb seit 4 Monaten

9.12.96

Keine Kopplung, RAMM-Medium mit Nitrat

16.12.96

Keine Kopplung, RAMM-Medium ohne Nitrat

23.12.96

Keine Kopplung, RAMM-Medium mit Nitrat

27.11.97

Anaerob-aerob Kopplung

2.1.2. Chemikalien

Soweit nicht gesondert angegeben, wurden die in dieser Arbeit verwendeten Feinchemikalien von den Firmen Boehringer, Mannheim, Gibco BRL (Eggenstein), Merck (Darmstadt), Roth (Karlsruhe), Serva (Heidelberg), Fluka (Neu-Ulm), Bio-Rad (München) oder Sigma (Deisenhofen) bezogen.

2.1.2.1. Fotochemikalien

Hyperfilm MP Röntgenfilm

Amersham-Pharmacia,Freiburg

Polaroid-Film Type 665

Polaroid, England

Agfa APX 100 Schwarzweiß-Film

Agfa, Leverkusen

Röntgenfilm Entwickler für Automaten

Fuji, Düsseldorf

Röntgenfilm Fixierer für Automaten

Fuji, Düsseldorf

2.1.2.2. DNA-Marker

DNA-Marker II

Boehringer, Mannheim

DNA-Marker III

Boehringer, Mannheim

DNA-Marker XIV

Boehringer, Mannheim


18

2.1.2.3. Kits

TA-Cloning Kit

Invitrogen, de Schelp

AdvanTAge PCR Cloning Kit

Clontech, Heidelberg

DIG Oligonucleotide 3‘-End Labeling Kit

Boehringer, Mannheim

DIG Luminescent Detection Kit

Boehringer, Mannheim

QiaQuick Gel Extraction Kit

Qiagen, Hilden

Thermo Sequenase Fluorescent

Labelled Primer Cycle Sequencing Kit

Amersham-Pharmacia, Freiburg

Flexi-Prep Kit

Amersham-Pharmacia, Freiburg

2.1.2.4. Oligonukleotide

In Tab. 2.1.2.4.1 sind die Sequenzen der im Rahmen dieser Arbeit verwendeten Oligonukleotide sowie deren Zielregionen aufgeführt. Wenn nicht gesondert vermerkt, wurden alle Oligonukleotide von TIB-MOLBIOL (Berlin) synthetisiert.

Neben den allgemein üblichen Abkürzungen wurden die folgenden Buchstabenkürzel für nicht näher spezifizierte Basenpositionen verwendet: M = C/A; N = A/T/G/C; R = A/G; W = A/T; Y = C/T; K = G/T; I = Inosin. Die nach Aslanidis et al. (1994) für die LIC-Klonierung ( L igation- I ndependent- C loning) notwendigen zusätzlichen 12 Nukleotide am 5‘-Ende der Primer sind kleingeschrieben dargestellt. Die unterstrichenen Nukleotide sind die Sequenzen der universellen Sequenzierprimer M13(21)F und M13(24)R.


19

Tab. 2.1.2.4.1 Sequenzen und Zielregionen der verwendeten Oligonukleotide.

Name*

Sequenz (5‘ rarr 3‘)

Zielregion**

TPU1

AGAGTTTGATCMTGGCTCAG

16S, 8-27

TPU1-M13F ƒ

TGTAAAACGACGGCCAGT AGAGTTTGATCMTGGCTC

16S, 8-25

LIC-TPU1 ƒ

gatggtagtaggAGAGTTTGATCMTGGCTCAG

16S, 8-27

TPU2

CCARACTCCTACGGGAGGCA

16S, 334-53

TPU5

AAACTYAAAKGAATTGACGG

16S, 906-26

RTU2

TGCCTCCCGTAGGAGTYTGG

16S, 334-53

RTU3

GWATTACCGCGGCKGCTG

16S, 519-36

RTU5

CCGTCAATTCMTTTRAGTTT

16S, 906-26

RTU6

ATTGTAGCACGTGTGTMGCCC

16S, 1219-40

RTU8

AAGGAGGTGATCCANCCRCA

16S, 1522-41

RTU8-M13R ƒ

ACAGCTATGACCATG AGGAGGTGATCCANCCRCA

16S, 1522-40

LIC-RTU8 ƒ

gatggtagtaggAAGGAGGTGATCCANCCRCA

16S, 1522-41

10-30Fa#

TCCGGTTGATCCTGCC

16S, 8-23

10-30Fa-M13F ƒ

TGTAAAACGACGGCCAGT TCCGGTTGATCCTGCC

16S, 8-23

357Fa#

ACGGGGCGCAGCAGGC

16S, 344-59

1390Ra#

CGGTGTGTGCAAGGAGC

16S, 1385-1401

MCONC ƒ

GAGTACGCTGGCAACTGT

16S, 1120-35

186+ ƒ

TACCGTCATCCAGCGACT

16S, 469-87

118+ ƒ

TGATGCCAGGGTCATAGG

16S, 182-92

EUB338

GCTGCCTCCCGTAGGAGT

16S, 338-55

Arch915±

GTGCTCCCCCGCCAATTCCT

16S, 915-34

1114F£

GCAACGAGCGCAACCC

16S, 1100-15

1100R£

GGGTTGCGCTCGTTGC

16S, 1100-15

M13(24)R

AACAGCTATGACCATG

universell

M13(40)F

GTTTTCCCAGTCACGAC

universell

M13(21)F

TGTAAAACGACGGCCAGT

universell

M13(20)F

GTAAAACGACGGCCAGT

universell

PDJ8012§

cctactaccatcGGATCCCCGGGT

pUC19

PDJ8112§

cctactaccatcGTCGACCTGCAG

pUC19

19F

GCIWTYTAYGGIAARGGIGG

nifH, 19-38

407R

AAICCRCCRCAIACIACRTC

nifH, 388-407

* TPU: Strangprimer für konservierte Bereiche der 16S rRNA Gene; RTU: Gegenstrangprimer für konservierte Bereiche der 16S rRNA Gene; ƒ diese Arbeit; Ueda et al. (1995); Amann et al. (1990); ± Amann et al. (1990a); § Aslanidis et al. (1994); £ Lane (1991); # F. A. Rainey (persönliche Mitteilung).

** 16S: E. coli 16S rRNA Position gemäß der Nummerierung nach Brosius et al. (1981); nifH: Azotobacter vinelandii nifH Gen Position (EMBL-Accession number: M20568); universell: Universeller Sequenzier- und Amplifikations Primer.


20

2.1.3. Puffer und Lösungen

TE-Puffer

0.01 M Tris-HCl

0.001 M EDTA

PBS-Puffer

8 g NaCl

0.2 g KCl

1.44 g Na2HPO4

0.24 g KH2PO4

ad 1000 ml a. dest.; pH 7.4

10x TBE-Puffer (für Agarose Gele)

108 g Tris-Base

55 g Borsäure

6.42 g EDTA

ad 1000 ml a. dest.; pH 8.0

10x TBE-Puffer (für DNA-Sequenzierung)

162 g Tris-Base

27.5 g Borsäure

7.3 g EDTA

ad 1000 ml a. dest.

20x SSC-Lösung

175.3 g NaCl

88.2 g Natriumcitratdihydrat

ad 1000 ml a. dest.; pH 7.0

Phosphat-Puffer

23.14 g KH2PO4

164.38 g K2HPO4

ad 1000 ml a. dest.

2.1.4. Nährmedien

2.1.4.1. Nährmedien zur Anzucht von Referenzstämmen

Als Referenzen genutzte Bakterien- und Archaeastämme wurden gemäß der Angaben der Stammsammlungen kultiviert oder als Aktivkultur geliefert. Die Herstellung fester Nährmedien erfolgte durch Zugabe von 15 g/l Agar (Fluka, Neu-Ulm) vor dem Autoklavieren (20 min bei 121 °C).

2.1.4.2. Nährmedien zur Anreicherung und Isolierung von Bakterien

Die im folgenden aufgeführten Angaben beziehen sich auf die Herstellung von Flüssigmedien.


21

2.1.4.2.1. Aerob-Medien

OL-Medium (modifiziert nach Oldenhuis et al., 1989)

 

5.4 g

Na2HPO4

 

1.4 g

KH2PO4

 

0.5 g

(NH4) 2 SO4

 

0.2 g

MgSO4

 

0.001 g

Hefeextrakt

 

5 mL

Spurenelementlösung

 

ad 1000 ml

a. dest.

Spurenelementlösung:

700 mg

CaCl2

 

200 mg

FeSO4

 

10 mg

ZnSO4

 

10 mg

Borsäure

 

10 mg

CoCl2

 

3 mg

MnSO4

 

0.3 mg

Na2MoO4

 

2 mg

NiCl2

 

ad 1000 ml

a. dest.

OLA-Medium:

Wie OL-Medium, jedoch mit zusätzlich 1.7 mM Kalium-Acetat.

OLB-Medium:

Wie OL-Medium, jedoch mit 5 mM Natrium-Benzoat anstelle von Kalium-Acetat.

2.1.4.2.2. Anaerob-Medien

RAMM-Medium (Shelton und Tiedje, 1984):

Lösung 1:

5.3 g

NH4Cl

 

0.75 g

CaCl2 x 2 H2O

 

1 g

MgCl2 x 6 H2O

 

0.2 g

FeCl2

 

ad 1000 ml

a. dest.

Lösung 2:

10.8 g

KH2PO4

 

14 g

K2HPO4

 

ad 1000 ml

a. dest.

Lösung 3:

50 mg

MnCl2 x 4 H2O

 

5 mg

Borsäure

 

5 mg

ZnCl2

 

1 mg

CuCl2

 

1 mg

Na2MoO4 x 2 H2O

 

50 mg

CoCl2 x 6 H2O

 

1 mg

NiCl2

 

5 mg

Na2SeO3

 

ad 1000 ml

a. dest.

Zur Herstellung des Mediums wurden 100 ml Lösung 1, 25 ml Lösung 2 und 10 ml Lösung 3 vereinigt mit a. dest. auf 1000 ml aufgefüllt und anschließend autoklaviert.

RNA-Medium: Wie RAMM-Medium, jedoch mit zusätzlich 1.7 oder 3.4 mM Kalium-Acetat und 7 mM Kalium-Nitrat.


22

Se-Medium (modifziert nach Macy et al., 1989):

2.2 g

NaCl

0.3 g

KCl

0.3 g

NH4Cl

0.2 g

KH2PO4

0.15 g

CaCl2 x 2 H2O

0.4 g

MgCl2 x 6 H2O

0.6 g

NaHCO3

3.78 g

Na2SeO4

10 ml

SL8-Lösung

Dieser Ansatz wurde in 900 ml a. dest. gelöst und autoklaviert. Anschließend wurden folgende Lösungen hinzugegeben:

10 ml

Vitaminlösung DSM 603 (sterilfiltriert)

800 µl

Methanol

5 ml

Kalium-Acetat (1M, sterilfiltriert)

ad 1000 ml

a. dest. (autoklaviert)

SL8-Lösung: 5.2 g

EDTA-Na2

1.5 g

FeCl2 x 4 H2O

70 mg

ZnCl2

100 mg

MnCl2 x 4 H2O

62 mg

H3BO4

190 mg

CoCl2 x 6 H2O

17 mg

CuCl2 x 2 H2O

24 mg

NiCl2 x 6 H2O

36 mg

Na2MoO4 x 2 H2O

ad 1000 ml

a. dest

Vitaminlösung DSM 603

(modifiziert nach DSMZ Katalog 1998):

0.1 mg

Vitamin B12

2.0 mg

Biotin

5.0 mg

Thiamine-HCl x 2 H2O

5.0 mg

Calcium-Pantothenat

2.0 mg

Folsäure

5.0 mg

Riboflavin

5.0 mg

Nicotinamid

SN-Medium: Wie Se-Medium, jedoch mit zusätzlich 20 mM Kalium-Nitrat.

SNS-Medium: Wie SN-Medium, jedoch mit 1.2 g/l NaCl und zusätzlich 0.3 g/l Natriumsulfat.

SNS0.4-Medium: Wie SNS-Medium, jedoch mit zusätzlich 4 g/l Hefeextrakt.

SS0.1-Medium: Wie Se-Medium, jedoch mit 1.2 g/l NaCl, 0.3 g/l Natriumsulfat sowie 1 g/l Hefeextrakt.

SS0.4-Medium: Wie SS0.1-Medium, jedoch mit 4 g/l Hefeextrakt.

S40S0.4-Medium: Wie SS0.4-Medium, jedoch mit 7.56 g/l Natrium-Selenat (40 mM).

SSGY0.4-Medium: Wie SS0.4-Medium, jedoch mit 4 g/l Natrium-Gluconat anstelle von Kalium-Acetat.


23

2.1.4.3. Medien für rekombinante E. coli Stämme

Die im folgenden aufgeführten Angaben beziehen sich auf die Herstellung von Flüssigmedien.

TB-Medium:

12 g

Bacto-Trypton

24 g

Hefeextrakt

4 ml

Glycerin (87%)

ad 900 ml

a. dest.

nach dem Autoklavieren wurden 100 ml autoklavierter Phosphat-Puffer zugesetzt

TAXI-Medium:

wie TB-Medium, jedoch werden nach dem Autoklavieren zusätzlich zugegeben:

250 µl

Ampicilin (200 mg/ml)

200 µl

X-Gal (5-chloro-4-bromo-3-indolyl-beta-D-galactopyranosid, 200 mg/ml in DMF)

50 µl

IPTG (Isopropyl-beta-D-thiogalactosid, 1 M)

SOC-Medium:

20g

Bacto-Trypton

5 g

Hefeextrakt

0.5 g

NaCl

10 ml

KCl (250 mM)

ad 980 ml

a. dest., pH 7.0

nach dem Autoklavieren werden folgende Lösungen zugesetzt:

10 ml

MgCl2 (1 M, autoklaviert)

10 ml

Glucose (2 M, sterilfiltriert)

2.2. Methoden

2.2.1. Anreicherung und Isolierung von Bakterien aus Bioreaktormaterial

2.2.1.1. Entnahme von Bioreaktormaterial zur Anreicherung und Isolierung von Bakterien

Über einen seitlichen Auslasshahn wurden am 27.11.97 drei sterile Schottflaschen mit Reaktorflüssigkeit gefüllt. Anschließend wurden mit einer zuvor abgeflammten Pinzette acht bewachsene Polyurethanschaumkörper aus dem geöffneten Reaktor entnommen und auf die drei Probengefäße verteilt. Für den etwa 30 minütigen Transport diente ein vorgewärmter Thermobehälter. Der Inhalt eines Probengefäßes wurde unmittelbar für aerobe Anreicherungsversuche weiterverarbeitet, während die beiden anderen Probengefäße anaerob bei 30 °C gelagert wurden.


24

2.2.1.2. Isolierung fakultativ aerober Bakterien

Insgesamt vier Flüssigkulturen sowie zwei Agarplatten (Platten 1 und 2) mit OLA- bzw. OLB-Medium wurden mit bewachsenen Polyurethanschaumkörpern bzw. Reaktorflüssigkeit angeimpft. Die Inkubation erfolgte üN bei 30 °C im Dunkeln. Flüssigkulturen wurden mit 110 rpm in einem Rotationsschüttler (Infors, Schweiz) bewegt. Ausgehend von zwei OLA- bzw. OLB-Flüssigkulturen wurden in PBS Verdünnungsreihen bis zu einer Verdünnung von 10-7 angelegt und sowohl auf OLA- als auch auf OLB-Platten ausplatiert. Von der OLB-Flüssigkultur wurde zusätzlich nach 8 h Inkubation ein Aliquot auf einer OLB-Platte ausplatiert. Von dieser Platte sowie von Platte 1 ausgehend wurden Einzelkolonien mit unterschiedlicher Morphologie ausgewählt und durch fraktionierten Ausstrich Reinkulturen gewonnen.

2.2.1.3. Isolierung anaerober Bakterien

Die Anreicherung und Isolierung anaerober Bakterien erfolgte aus Probenmaterial, das für mindestens 12 Tage bei 30 °C anaerob gelagert wurde. Alle Inkubationen erfolgten bei 30 °C im Dunkeln in Anaerobiertöpfen von Oxoid (Wesel) oder Mart (Bocholt). Ein anaerobes Milieu wurde entweder durch Zugabe von Ascorbinsäuregranulat (Anaerogen; Oxoid) oder die Begasung mit technisch reinem Stickstoff oder einem Stickstoff-Kohlendioxid-Wasserstoff-Gemisch und die Zugabe eines Platinkatalysators (Mart, Bocholt) erreicht. Bei allen Verfahren wurde das anaerobe Milieu durch Sauerstoffindikatoren von Merck (Darmstadt) oder Oxoid (Wesel) überprüft.

2.2.1.3.1. Isolierung nitratreduzierender Bakterien

Insgesamt drei Flüssigkulturen mit RNA-Medium wurden mit bewachsenen Polyurethanschaumkörpern angeimpft. Nach etwa zweiwöchiger Inkubation nach Anaerob-Methode II erfolgte eine erste Passagierung in RNA-Flüssigmedium (10% Inokulum). Aliquots dieser Flüssigkulturen wurden auf RNA-Platten ausplatiert und durch mehrfaches Ausstreichen von Kolonien, die aufgrund ihrer unterschiedlichen Morphologie ausgewählt wurden, Reinkulturen erhalten. Nach etwa zwei Monaten Inkubation wurden alle Flüssigkulturen auf die Anwesenheit von Nitrat getestet (Nitrat-Teststäbchen; Merck, Darmstadt).


25

2.2.1.3.2. Isolierung selenatreduzierender Bakterien

Die Arbeiten zur Isolierung selenatreduzierender Bakterien erfolgten in Zusammenarbeit mit Herrn Dr. R. Siddiqui (Arbeitsgruppe Prof. B. Friedrich, Institut für Biologie, Humboldt Universität zu Berlin).

Insgesamt vier 50 ml Flüssigkulturen mit Se-Medium bzw. SN-Medium wurden mit je einem bewachsenen Polyurethanschaumkörpern bzw. mit 10 ml Reaktorflüssigkeit angeimpft und anaerob inkubiert. Nach fünf Tagen zeigten alle Flüssigkulturen einen rötlichen Niederschlag, der als Inokulum für weitere Flüssigkulturen mit Se-, SN- und SNS-Medium diente. Von diesen Kulturen wurden Aliquots auf Se-, SN-, SNS-, SS0.1- oder SS0.4-Platten ausgestrichen. Rot gefärbte Kolonien wurden abgeimpft und durch wiederholtes Ausstreichen auf SS0.1-, SS0.4-, S40S0.4- oder SSGY0.4-Platten Reinkulturen gewonnen. Die Wahl des Mediums richtete sich dabei nach dem Grad der Rotfärbung und dem Zellwachstum.

2.2.1.3.2.1 Nachweis der Reduktion von Selenat zu elementarem Selen

Der quantitative Selen-Nachweis erfolgte mittels A tom- A bsorptions- S pektroskopie (AAS) durch Herrn Dr. Rösick (Hahn-Meitner-Institut, Berlin). Dazu wurden drei SNS0.4-Flüssigkulturen (192 ml) angesetzt anaerob inkubiert. Nach 9.5 h, 25.25 h bzw. 48.25 h wurden jeweils 10 ml der Kultur entnommen und mit 1 ml einer wässrigen 37% Formalin-Lösung (Merck, Darmstadt) versetzt. Von diesen Aliquots ausgehend wurde die OD der Kulturen bei 600 nm bestimmt (Pharmacia Photometer Ultrospec III, Freiburg). Die verbleibenden 182 ml Flüssigkultur wurden 20 min bei 2500 x g und 4 °C zentrifugiert, das überstehende Medium abgenommen und bei 4 °C gelagert. Die resultierenden Zellpellets wurden mit je 40 ml PBS gewaschen (15 min Zentrifugation bei 2500 x g, 4 °C). Nach Abgießen des ÜS wurden die Zellpellets wieder in je 8 ml PBS aufgenommen und in Polyethylen-Aufschlußröhrchen 10 min lang bei 2000 x g und 4 °C zentrifugiert. Nach erneutem Abgießen des ÜS wurden die bräunlichen Zellpellets bis zur AAS-Probenaufarbeitung bei -20 °C gelagert.

2.2.2. Stammhaltung

Die Anzucht der Referenzstämme und Isolate erfolgte in Flüssigkultur oder auf Agarplatten. Für kurzfristige Lagerung wurden Platten bei 4 °C aufbewahrt. Als Dauerkulturen wurden entweder Glycerinkonserven mit mindestens 25% Glycerin oder Mikrobankkulturen (Pro-Lab, Kanada) angelegt und bei -70 °C gelagert.


26

2.2.3. Präparation von Nukleinsäuren

2.2.3.1. Entnahme von Bioreaktormaterial zur DNA-Präparation

Aus dem geöffneten Bioreaktor wurden mit einer sterilen Pinzette bewachsene Polyurethanschaumkörper entnommen, in 50 ml Falcon-Röhrchen überführt und sofort in einem mit Trocken- oder Wassereis gefüllten Thermobehälter eingefroren. Nach dem etwa 30 minütigen Transport wurden die Proben bis zur Weiterverarbeitung bei -20 °C gelagert. Wurden Proben nicht innerhalb einiger Tage bearbeitet, erfolgte eine Lagerung bei -70 °C.

2.2.3.2. Präparation von DNA aus Bioreaktormaterial

Zur Lyse der auf den Polyurethanschaumkörpern immobilisierten Mikroorganismen und der anschließenden Präparation der Gesamt-DNA wurde die Methode von Tsai und Olson (1991) in modifizierter Form eingesetzt.

Lysozym-Lösung

3 mg/ml

Lysozym

 

0.15 M

NaCl

 

0.01 M

EDTA

TNS-Lösung, pH 8.0

0.5 M

Tris-HCl

 

0.1 M

NaCl

 

10%

SDS

Ein Polyurethanschaumkörper wurde in 6 ml Lysozym-Lösung bei 37 °C über 3 h inkubiert und alle 15 min leicht geschüttelt. Danach wurden die Zellen durch Zugabe von 6 ml TNS-Lösung und sechsfachem Einfrieren auf Trockeneis, Auftauen für 15 min bei 65 °C und kurzem vortex-schütteln aufgebrochen. Nach Zugabe von 160 µl Proteinase K-Lösung (20 mg/ml) wurden die Proben bei 50 °C inkubiert. In dieser Zeit wurden Aliquots der Flüssigphase lichtmikroskopisch untersucht, um die Lysiseffizienz abzuschätzen. Nachdem keine typischen Zellmorphologien mehr zu erkennen waren, wurde die Flüssigphase abgezogen und jeweils einmal mit Phenol, Phenol/Chloroform (1:1) und Chloroform extrahiert. Die in der wässrigen Phase enthaltene DNA wurde durch Zugabe von 1 VT 96% Ethanol und 1/10 VT Natriumacetat-Lösung (3 M, pH 4.9) bei -20 °C üN gefällt. Die gefällte DNA wurde in 2 ml Eppendorf-Gefäßen abzentrifugiert (13800 x g, 1 h, 4 °C), einmal mit 70% Ethanol gewaschen und die Pellets dann in 100 µl TE-Puffer gelöst. Um mitgefällte PCR-Inhibitoren und niedermolekulare DNA zu entfernen, wurde ein Aliquot der DNA-Präparation zusammen mit DNA-Marker II und einer Negativkontrolle (nur


27

Agarosegel-Probenpuffer [s. 1.2.4.1]) auf ein 1%iges Agarose-Gel geladen und elektrophoretisch aufgetrennt. DNA-Banden mit einer Größe von mehr als 9 kb bzw. der korrespondierende Bereich der Negativkontrolle wurden mit einem sterilen Skalpell unter UV-Licht (356 nm) aus dem Gel ausgeschnitten und die Agaroseblöckchen sofort in ein steriles Eppendorf-Gefäß überführt. Um eine Kontamination der DNA-Präparation mit Fremd-DNA zu vermeiden, wurden alle für die Agarose-Gelelektrophorese erforderlichen Lösungen und Puffer frisch angesetzt und autoklaviert bzw. sterilfiltriert. Zusätzlich wurden alle Elektrophorese-Kunststoffteile mit a. dest. gespült und für mindestens 10 min UV-bestrahlt. Die Weiterbehandlung aller Agaroseblöckchen (inkl. Negativkontrolle) zur Eluierung der DNA erfolgte mit dem QiaQuick Gel Extraction Kit von Qiagen (Hilden) nach Anleitung des Herstellers.

2.2.3.3. Präparation von DNA aus mikrobiellen Reinkulturen

Die Präparation genomischer DNA aus Bakterien- und Archaeakulturen für spätere PCR-Amplifikationen erfolgte mittels einer Schnellmethode. Etwa eine Impföse Zellmaterial wurde in 100 µl TE-Puffer suspendiert, kurz gevortext und dann für 10 min bei 95 °C inkubiert. Nach kurzem Abzentrifugieren der Zelltrümmer wurden zwischen 1 und 3 µl des ÜS direkt für die PCR eingesetzt. Die Lagerung der so präparierten DNA erfolgte bei -20 °C.

2.2.3.4. Präparation von Plasmid-DNA aus rekombinanten E. coli-Zellen (Mini-Prep)

Die Isolierung von Plasmid-DNA aus E. coli erfolgte mittels alkalischer Lyse (Birnboim und Doly, 1979) nach dem bei Sambrook et al. (1989) aufgeführten Protokoll. Entgegen den Protokollangaben wurden alle Zentrifugationsschritte bei RT ausgeführt und auf ein Waschen des Plasmid-Pellets mit 70% Ethanol verzichtet. Alternativ zur RNase-Behandlung wurde kontaminierende E. coli RNA durch Fällung mit MgCl2 entfernt (Yamamoto und Horikoshi, 1995). Dazu wurde das Plasmid-Pellet in 20 µl TE-Puffer gelöst, 2 µl einer 1 M MgCl2-Lösung hinzugegeben und der Ansatz 10 min auf Eis inkubiert. Die RNA wurde durch Zentrifugation bei 4 °C (10 min, 13800 x g) abgetrennt und der ÜS in ein neues Gefäß überführt. Bei der so präparierten Plasmid-DNA konnte auf eine nachfolgende Phenol-Extraktion verzichtet werden. Sollte Plasmid-DNA mit einem für die Sequenzierung ausreichenden


28

Reinheitsgrad gewonnen werden, wurden die Plasmid-Präparationen mit Ethanol gefällt, die Plasmid-DNA mit 70%igem Ethanol gewaschen und anschließend in TE-Puffer suspendiert. Alternativ dazu wurde Plasmid-DNA mit dem Flexiprep-Kit (Amersham-Pharmacia, Freiburg) nach Angaben des Herstellers isoliert. Die nach dem letzten Präparationsschritt im Eluat verbleibenden Matrix-Partikel wurden durch Zentrifugationsfilter von Bio-101 (über Dianova, Hamburg) entfernt.

2.2.3.5. Präparation von Nukleinsäuren aus rekombinanten E. coli-Zellen für die Slot-Blot Hybridisierung (Colony Slot-Blot)

Für die Slot-Blot Hybridisierung wurden rekombinante E. coli-Zellen mittels alkalischer Lyse aufgebrochen, die Zelllysate verdünnt und dann aufgetragen. Dazu wurden rekombinante E. coli-Zellen in 96-Loch Mikrotiterplatten (Nunc, Dänemark) in je 200 µl TB-Medium (mit 50 µg/ml Ampicilin) üN bei 37 °C kultiviert. Anschließend wurden die Mikrotiterplatten 15 min bei 4 °C mit 80 x g zentrifugiert, das überstehende Medium abgenommen und die Zellpellets mit je 60 µl vorgewärmter (37 °C) Denaturierungs-Lösung (0.5 N NaOH, 1.5 M NaCl, 0.1 % SDS) versetzt. Nach mehrmaligem Durchmischen wurden je 25 µl des Lysates in eine neue 96-Loch Mikrotiterplatte mit je 200 µl Denaturierungs-Lösung überführt. Nach erneutem Mischen wurden 60 µl dieses Ansatzes für die Slot-Blot Hybridisierung eingesetzt.

2.2.4. Gelelektrophorese von Nukleinsäuren

2.2.4.1. Agarosegele

Die Analyse von DNA-Fragmenten erfolgte elektrophoretisch in horizontalen Agarosegelen. In der Regel wurden Agarosekonzentrationen zwischen 1 und 2%, je nach Größe des aufzutrennenden Fragmentbereiches, verwendet. Zur Anfärbung der Nukleinsäuren wurden 100 ml Agarose-Lösung vor dem Erstarren 1µl einer Ethidiumbromidlösung (10 mg/ml, Merck) zugegeben.

Zusammensetzung des Agarosegel-Probenpuffers:

1.5 g

Ficoll

25 mg

Bromphenolblau

25 mg

Xylencyanol FF

ad 10 ml

a. dest.


29

Die Proben wurden mit 0.6-1 VT Agarosegel-Probenpuffer gemischt und in die Taschen des Agarosegels überführt. Als Längenmarker wurden je nach aufzutrennendem Fragmentbereich DNA-Marker II (Fragmente über 6 kb), DNA-Marker III (Fragmente zwischen 3 und 1 kb) und DNA-Marker XIV (Fragmente zwischen 1 kb und 300 bp) mit aufgetragen. Die Elektrophorese erfolgte bei Spannungen zwischen 7.5-10V/cm in 1x TBE-Puffer. Anschließend wurden die Gele mittels eines UV-Transilluminators (Chromato VUE Model ST-20) ausgewertet und mit einer Polaroidkamera fotografiert. Als Filmaterial diente Polaroidfilm Type 665. Alternativ wurden die Gele mit dem Eagle Eye Videodokumentationssystem der Firma Stratagene (Heidelberg) ausgewertet.

2.2.4.2. Polyacrylamidgele

Zur Auftrennung der DNA-Fragmente von Sequenzierreaktionen wurden 0.25 mm starke, senkrechte Polyacrylamidgele verwendet.

Zusammensetzung der Gellösungen und des Probenpuffers:

Polyacrylamidgel 4%, 66 cm:

 

5 ml

Rapid Gel XL 40% Solution (Amersham-Pharmacia, Freiburg)

21 g

Harnstoff

6 ml

10x TBE (für Sequenzierung)

0.5 ml

DMSO

ad 50 ml

a. dest.

Polyacrylamidgel 6%, 45 cm:

 

Wie oben jedoch mit 6 ml Long Ranger Gel 50% Solution (Biozym, Hess.- Oldendorf)

PAA-Probenpuffer:

 

9.5 ml

Formamid

0.4 ml

500 mM EDTA-Lösung

5 mg

Bromphenolblau

5 mg

Xylencyanol FF

0.1 ml

a. dest.

Nach dem Lösen der Komponenten wurden die Gellösungen filtriert (0.45 µm Porenweite) und unmittelbar vor dem Gießen mit TEMED und APS-Lösung (10%) versetzt:

Polyacrylamidgel 6%, 30 ml für 45 cm:

24 µl TEMED und 240 µl 10%iges APS

Polyacrylamidgel 4%, 50 ml für 66 cm:

30 µl TEMED und 292 µl 10%iges APS


30

2.2.5. Quantitative Analyse von Nukleinsäuren

Die Quantifizierung von DNA erfolgte durch visuellen Abgleich einer Verdünnungsreihe mit einer definierten Menge DNA-Standard auf einem Ethidiumbromid-gefärbten Agarosegel.

2.2.6. In-vitro Amplifizierung von DNA mittels Polymerase-Kettenreaktion (PCR)

Die in-vitro Amplifikation von DNA erfolgte mit Hilfe der Polymerase-Kettenreaktion (PCR) entweder mit dem Omni-Cycler von Hybaid (über MWG-Biotech, Ebersberg) oder mit dem Trioblock von Biometra (Göttingen).

Zusammensetzung der Puffer und PCR-Reaktionsansätze:

10x Tricin-Puffer, pH 8.4 (Barns et al., 1994):

300 mM

Tricin

500 mM

KCl

PCR-Ansatz:

 

5 µl

10x PCR-Puffer (Gibco, Eggenstein) oder 10x Tricin-Puffer

1 µl (je 200 µM)*

dNTP-Mix (Boehringer Mannheim)

0.5 µl (2.5 U)

AmpliTaq DNA-Polymerase (Perkin-Elmer, Weiterstadt)

1.5-4 µl (1.5-4 mM)

MgCl2-Lösung (Gibco, Eggenstein)

1 µl (0.3-0.5 µM)

Strang-Primer

1 µl (0.3-0.5 µM)

Gegenstrang-Primer

5 µl (5%)

Acetamid-Lösung (nur bei Tricin-Puffer)

1-10 µl

Template DANN

ad 50 µl

Ampuwa-Wasser (Fresenius, Bad Homburg)

*

In Klammern angegeben ist die jeweilige Konzentration im PCR-Reaktionsansatz (Endkonzentration).

In der Regel wurde ein sog. ”Hot-Start“ durchgeführt, d. h. alle Reagenzien bis auf die AmpliTaqDNA-Polymerase wurden zusammengegeben, mit 50 µl Mineralöl (Sigma) überschichtet, kurz abzentrifugiert und die PCR gestartet. Nach der initialen Denaturierungsphase wurde die AmpliTaqDNA-Polymerase durch die Ölschicht zum Reaktionsgemisch gegeben. Bei jedem PCR-Ansatz wurde als Negativkontrolle ein Reaktionsansatz ohne Template-DNA mitgeführt. Eine qualitative Kontrolle der PCR erfolgte durch Agarosegelelektrophorese eines Aliquots (5 µl) des Ansatzes.


31

2.2.6.1. PCR-Amplifizierung der 16S-rDNA aus Bakterien-Reinkulturen

Die PCR-Amplifizierung der nahezu vollständigen 16S-rDNA aus präparierter Bakterien-DNA erfolgte mit den Primerkombinationen TPU1/RTU8 oder TPU1-M13F/RTU8-M13R. Die Reaktionen enthielten 1x PCR-Puffer (Gibco, Eggenstein) und MgCl2-Konzentrationen von 1.5 oder 2 mM. Folgendes Reaktionsprofil wurde verwendet:

1 Zyklus

Initiale Denaturierung

98 °C

30 s

 

Denaturierung

93 °C

3 min

28 Zyklen

Denaturierung

93 °C

1 min

 

Primer-Hybridisierung

53 °C

1 min

 

Primer-Elongation

72 °C

2 min

1 Zyklus

Primer-Elongation

72 °C

7 min

2.2.6.2. PCR-Amplifizierung der 16S-rDNA aus Archaea-Reinkulturen

Die PCR-Amplifizierung der nahezu vollständigen 16S-rDNA aus präparierter Archaea-DNA erfolgte mit der Primerkombination 10-30Fa-M13F/RTU8-M13R. Die Reaktionen enthielten 1x Tricin-Puffer mit 5% Acetamid (Barns et al., 1994) und 1.5 oder 2 mM MgCl2. Folgendes Reaktionsprofil wurde verwendet:

1 Zyklus

Initiale Denaturierung

94 °C

6 min

26 Zyklen

Denaturierung

92 °C

1 min

 

Primer-Hybridisierung

50 °C

1 min

 

Primer-Elongation

72 °C

2 min

1 Zyklus

Primer-Elongation

72 °C

7 min

2.2.6.3. PCR-Amplifizierung von 16S-rDNA aus Konsortiums-DNA

Für die Anlage von rDNA Genbibliotheken aus Bioreaktormaterial erfolgte die PCR-Amplifizierung nahezu vollständiger bakterieller 16S-rDNA sowie partieller Euryarchaeota-16S-rDNA aus präparierter Gesamt-DNA. Insgesamt wurden je nach


32

verwendeter Primerkombination und Reaktionsprofil vier verschiedene PCR-Ansätze gewählt, die in Tabelle II.2.6.3.1 aufgelistet sind. Die Ansätze A und B enthielten 1x PCR-Puffer (Gibco, Eggenstein) und 2 mM MgCl2, wohingegen die Ansätze C und D 1x Tricin-Puffer, 5% Acetamid und 1.5 mM MgCl2 enthielten. Für alle PCR-Ansätze wurde die Template-DNA austitriert, um die für maximale Produktbildung notwendige Konzentration zu bestimmen. Um eine DNA-Kontamination während der Gelpräparation (s. 2.2.3.2) zu überprüfen, wurden bei den PCR-Ansätzen A und C neben der üblichen Negativkontrolle (ohne Template DNA) auch Reaktionen mitgeführt, die ein Aliquot des Eluats der Gel-Negativkontrolle enthielten.

Tab. 2.2.6.3.1 Primerkombinationen und Reaktionsprofile unterschiedlicher PCR-Typen für die Amplifizierung von 16S-rDNA aus Konsortiums-DNA.

PCR-Typ

Primerpaar

Spezifität

Reaktionsprofil

A

TPU1

RTU8

Bakterien

98 °C, 3 min

93 °C, 3 min

28x (93 °C, 1 min; 53 °C, 1 min; 72 °C, 3 min)

72 °C, 7 min

B

LIC-TPU1

LIC-RTU8

Bakterien

98 °C, 2 min

93 °C, 1 min

28x (93 °C, 1 min; 53 °C, 1 min; 72 °C, 5 min)

72 °C, 7 min

C

10-30Fa

1390Ra

Euryarchaeota

94 °C, 6 min

30x (92 °C, 1.5 min; 50 °C, 1.5 min; 72 °C, 2 min)

72 °C, 7 min

D

357Fa

1390Ra

Euryarchaeota

94 °C, 6 min

27x (92 °C, 1.5 min; 50 °C, 1.5 min; 72 °C, 4 min)

72 °C, 7 min

2.2.6.4. PCR-Amplifizierung von nifH-Genfragmenten aus Konsortiums-DNA

Für die Anlage von nifH Genbibliotheken aus Bioreaktormaterial erfolgte die PCR-Amplifizierung etwa 390 bp langer, partieller nifH-Sequenzen aus präparierter Gesamt-DNA. Die PCR wurde mit der Primerkombination 19F/407R, 1x PCR-Puffer (Gibco, Eggenstein) und 4 mM MgCl2 nach folgendem Reaktionsprofil durchgeführt:


33

1 Zyklus

Initiale Denaturierung

98 °C

3 min

 

Denaturierung

93 °C

3 min

25 Zyklen

Denaturierung

93 °C

1 min

 

Primer-Hybridisierung

50 °C

2 min

 

Primer-Elongation

72 °C

2 min

1 Zyklus

Primer-Elongation

72 °C

10 min

Für alle PCR-Reaktionen wurde die Template-DNA austitriert, um die für maximale Produktbildung notwendige Konzentration zu bestimmen. Aliquots der PCR-Reaktionen (25 µl) wurden auf einem 1%igen Agarosegel elektrophoretisch aufgetrennt, DNA-Banden von etwa 390 bp Länge mit einem sterilen Skalpell unter UV-Bestrahlung ausgeschnitten und in ein steriles Gefäß überführt. Die Weiterbehandlung der Agaroseblöckchen zur Eluierung der DNA erfolgte mit dem QiaQuick Gel Extraction Kit von Qiagen (Hilden) nach Anleitung des Herstellers.

2.2.6.5. PCR-Amplifizierung klonierter DNA

Um die Insertlänge rekombinanter Plasmide zu ermitteln, sowie zur weiteren Analyse klonierter 16S-rDNA (Hybridisierung und Sequenzierung) wurden Inserts mit den an flankierende Plasmidbereiche bindenden Primern M13(40)F und M13(24)R aus dem entsprechenden Plasmid-Vektor amplifiziert. Die PCR-Reaktionen erfolgten mit 1x PCR-Puffer (Gibco, Eggenstein), 1.5 oder 2 mM MgCl2 ohne ”Hot-Start“ nach folgendem Reaktionsprofil:

1 Zyklus

Initiale Denaturierung

95 °C

5 min

29 Zyklen

Denaturierung

92 °C

1 min

 

Primer-Hybridisierung

53 °C

1 min

 

Primer-Elongation

72 °C

1-2 min*

1 Zyklus

Primer-Elongation

72 °C

5 min

* Die Primer-Elongationszeit wurde je nach der Länge des erwarteten Inserts variiert.


34

Als Template-DNA diente 1µl einer 1:100 in TE-Puffer verdünnten Plasmid-Präparation. Alternativ wurden rekombinante E. coli-Zellen direkt mit einem sterilen Zahnstocher in den PCR-Reaktionsansatz gegeben. Bei der nachfolgenden Kontrolle der Reaktionen mittels Agarosegelelektrophorese wurde berücksichtigt, daß die PCR-Produkte aufgrund der mitamplifizierten flankierenden Plasmidbereiche eine größere Länge gegenüber der ürsprünglich eingesetzten DNA aufwiesen.

2.2.6.6. PCR-Amplifizierung und DIG-Markierung von 16S-rDNA-Fragmenten

Die Herstellung Digoxigenin(DIG)-markierter 16S-rDNA-Polynukleotidsonden erfolgte in zwei aufeinander folgenden PCR-Reaktionen mit verschachtelten Primerkombinationen, einer sog. ”nested-PCR“, um eine Ko-Amplifikation kontaminierender E. coli-16S-rDNA zu vermeiden. In der ersten PCR wurde klonierte 16S-rDNA wie unter 2.2.6.5 beschrieben aus dem Plasmid-Vektor amplifiziert. Ein Aliquot dieser PCR-Reaktion (1µl) wurde 1:1000 in TE-Puffer verdünnt und als Template-DNA für eine zweite PCR mit den 16S-rDNA spezifischen Primern TPU1 und RTU2 eingesetzt. In diesem Ansatz wurde der dNTP-Mix (Boehringer Mannheim) gegen ein Gemisch der vier Nukleotide ausgetauscht, das zusätzlich DIG-11-dUTP enthielt (DIG-PCR-Mix).

Zusammensetzung des DIG-PCR-Mix:

12.5 µl (10 µM)*

alkalistabiles DIG-11-dUTP (200 µM, Boehringer Mannheim)

47.5 µl (190 µM)

dTTP (1 mM)

je 5 µl (je 200 µM)

dATP, dCTP, dGTP (je 10 mM)

*

In Klammern angegeben ist die jeweilige Konzentration im Reaktionsansatz (Endkonzentration).

Die Amplifikation erfolgte in einem Volumen von 25 µl mit 1x PCR-Puffer (Gibco, Eggenstein), 7.5 µl DIG-PCR-Mix und 2 mM MgCl2 nach folgendem Reaktionsprofil:


35

1 Zyklus

Initiale Denaturierung

95 °C

5 min

28 Zyklen

Denaturierung

92 °C

1 min

 

Primer-Hybridisierung

60 °C

1 min

 

Primer-Elongation

72 °C

1 min

1 Zyklus

Primer-Elongation

72 °C

5 min

Ein Aliquot des Reaktionsansatzes (3.5 µl) wurde ohne weitere Aufreinigung für die Hybridisierung eingesetzt .

2.2.6.7. Direkte Aufreinigung PCR-amplifizierter DNA

Die direkte Aufreinigung von PCR-Produkten erfolgte mit einer auf Silika als DNA-bindender Matrix basierenden Methode (Boyle und Lew, 1995).

Zusammensetzung der Lösungen:

 

Silika-Suspension:

2.5 g

Silika (Sigma, 2 mal in 25 ml PBS-Puffer gewaschen)

 

25 ml

NaI (3 M)

 

 

 

Waschpuffer:

50 mM

NaCl

 

10 mM

Tris, pH 7.5

 

2.5 mM

EDTA

in 25 ml a. dest. lösen und 25 ml Ethanol zugeben

Der PCR-Reaktionsansatz wurde vom Mineralöl getrennt, mit 2 VT einer 6 M NaI-Lösung versetzt und 12 µl der Silika-Suspension zugegeben. Nach kurzem vortex-schütteln wurden die Ansätze 10 min bei RT inkubiert, dann kurz zentrifugiert und der ÜS abgegossen. Das Silika-Pellet wurde anschließend zweimal in jeweils mindestens 200 µl Waschpuffer gewaschen und in einer dem ursprünglichen PCR-Reaktionsansatz entsprechenden Menge TE-Puffer für 10 min bei 37 oder 55 °C eluiert. Nach kurzer Zentrifugation wurde das Eluat abgenommen und verbleibende Silikapartikel mit einem Zentrifugationsfilter von Bio-101 (über Dianova, Hamburg) abgetrennt. Die Lagerung der so aufgereinigten PCR-Produkte erfolgte bei -20 °C.


36

2.2.7. Klonierung PCR-amplifizierter DNA

2.2.7.1. TA-Klonierung

Die TA-Klonierung basiert auf dem sequenzunabhängigen Anhang eines Adenosins am 3’-Ende der synthetisierten DNA durch thermostabile DNA-Polymerasen ohne 3’rarr5’ Exonukleaseaktivität (z. B. AmpliTaqDNA-Polymerase). Dies erlaubt die Ligation mit einem linearisierten Vektor-Plasmid das einen einfachen Tyrosin-Überhang aufweist.

Für diese Klonierungen wurde der TA-Cloning Kit von Invitrogen (de Schelp, Niederlande) mit den Plasmid-Vektoren pCRII oder pCR2.1 verwendet. Beide Vektoren unterscheiden sich lediglich durch eine 42 bp lange Sp6-Promoter Bindungstelle. Alternativ wurde der mit dem pCR2.1 Vektor identische pT-Adv Vektor des AdvanTAge PCR Cloning Kit von Clontech (Heidelberg) eingesetzt. Nach Empfehlung der Hersteller wurden frische (max. 24 h), nicht aufgereinigte PCR-Produke für die Ligation eingesetzt. Bei der Ligation PCR-amplifizierter nifH-Genfragmenten führte dieses Vorgehen zunächst zur Klonierung kürzerer, unspezifischer Fragmente, so daß in diesem Fall ausschließlich gelaufgereingte PCR-Produkte zur Verwendung kamen (s. 2.2.6.4). Alle weiteren Arbeitsschritte sowohl der Ligation als auch der nachfolgenden Transformation von E. coli-Zellen (INValphaF´ oder TOP10F´) wurden entsprechend den Angaben der Hersteller durchgeführt.

2.2.7.2. LIC-Klonierung

Die LIC-Klonierung ( L igation- I ndependent- C loning) basiert auf komplementären, einzelsträngigen Überhängen am 3’-Ende des PCR-Produktes und des linearisierten Vektors (z.B. pUC19), die durch eine spezifische T4-DNA-Polymerase Behandlung generiert werden. Bei ausreichender Länge dieser Einzelstränge bildet sich ohne Ligation eine stabile Verbindung zwischen PCR-Produkt und Vektor aus, die für eine Transformation von E. coli-Zellen geeignet ist (Aslanidis und de Jong, 1990; Aslanidis et al., 1994).

2.2.7.2.1. Präparation des PCR-Produktes

Für die LIC-Klonierung wurde mit der Primerkombination LIC-TPU1/LIC-RTU8 amplifizierte 16S-rDNA eingesetzt (Tab. II.2.7.3.1, PCR-Ansatz B). Eine Aufreinigung


37

eines Aliquots der PCR-Reaktion (20 µl) erfolgte mit der beschriebenen Silika-Methode. Dabei erfolgte die Inkubation mit der Silika-Matrix für 10 min bei 4 °C und das Silika-Pellet wurde dreimal mit je 100 µl Waschpuffer gewaschen. Nach der Elution wurden verbleibende Silika-Partikel jedoch nicht durch einen Zentrifugationsfilter abgetrennt.

2.2.7.2.2. Präparation des Plasmid-Vektors

Um die für die LIC-Klonierung notwendigen Nukleotidsequenzen in pUC19 Plasmid-DNA einzuführen, wurde XbaI geschnittene pUC19 DNA mit den Primern PDJ8012 und PDJ8112 PCR-amplifiziert.

2.2.7.2.2.1 Restriktionsverdau von pUC19 mit XbaI

Der Restriktionsverdau erfolgte für 30 min bei 37 °C in einem Volumen von 20 µl mit 100 ng pUC19, 15 Units XbaI (Boehringer Mannheim) und 1x XbaI-Restriktionspuffer (Boehringer Mannheim). Zum Abstoppen der Reaktion wurden 80 µl a. dest. hinzugefügt und der Ansatz 10 min bei 95 °C inkubiert.

2.2.7.2.2.2 PCR-Amplifizierung linearisierter pUC19-DNA

Linearisierte, XbaI-geschnittene pUC19-DNA (1 ng) wurde mit den Primern PDJ8012 und PDJ8112 in einem PCR-Ansatz mit 1x PCR-Puffer (Gibco, Eggendorf) und 1.5 mM MgCl2 nach folgendem Reaktionsprofil amplifiziert:

1 Zyklus

Initiale Denaturierung

94 °C

5 min

28 Zyklen

Denaturierung

93 °C

1 min

 

Primer-Hybridisierung

60.8 °C

1 min

 

Primer-Elongation

72 °C

3 min

1 Zyklus

Primer-Elongation

72 °C

5 min

Die Aufreinigung des halben PCR-Ansatzes (25 µl) erfolgte nach der Silika-Methode.

2.2.7.2.3. T4-DNA-Polymerase Behandlung

Für die Generierung einzelsträngiger DNA-Überhänge an PCR-amplifizierter 16S-rDNA (16S-rDNA-PCR) bzw. Vektor (pUC19-PCR) erfolgte eine T4-DNA-Polymerase Behandlung in Gegenwart von dGTP bzw. dCTP. Die 50 µl-Ansätze enthielten


38

jeweils 16 µl aufgereinigter 16S-rDNA-PCR bzw. 23 µl pUC19-PCR, 2 Units T4-DNA-Polymerase (Boehringer Mannheim), 1x T4-DNA-Polymerase Reaktionspuffer (Boehringer Mannheim), 500 µM dGTP (bei 16S-rDNA PCR-Produkt) bzw. dCTP (bei pUC19-PCR). Nach 20 min Inkubation bei 37 °C wurden die Ansätze für 10 min auf 65 °C erhitzt, erneut mit Silika aufgereinigt und in TE-Puffer eluiert.

2.2.7.2.4. Klonierung und Transformation

In einem Volumen von 20 µl (TE-Puffer) wurde 10 ng T4-DNA-Polymerase behandelte pUC19-DNA mit 80 ng T4-DNA-Polymerase behandelter PCR-amplifizierter 16S-rDNA (molares Verhältnis 1:13) vermischt und 25 min bei RT inkubiert. Aliquots dieses Ansatz wurden direkt zur Transformation kompetenter E. coli-Zellen (Epicurian Coli SURE competent cells, Stratagene, Heidelberg) entsprechend den Angaben des Herstellers verwendet. Jeweils 1 bzw. 10 µl des Klonierungsansatzes wurden zu je 100 µl vorbehandelten (25 mM Mercaptoethanol, 10 min auf Eis), kompetenten E. coli-Zellen gegeben, für 30 min auf Eis inkubiert und die Ansätze einem Hitzeimpuls von 42 °C für exakt 45 s ausgesetzt. Nach erneuter Inkubation auf Eis (2 min) wurden jeweils 900 µl auf 37 °C vorgewärmtes SOC-Medium zu den Zellen gegeben und die Ansätze für 1 h bei 37 °C im Schüttelinkubator (225 rpm) bewegt. Aliquots der Zellsuspension wurden anschließend auf Agarplatten mit TAXI-Medium ausplatiert und mindestens 16 h bei 37 °C inkubiert. Nach 2-3 h Lagerung der Platten bei 4 °C wurden weiße Kolonien mit sterilen Zahnstochern auf neue Agarplatten mit TAXI-Medium überimpft.

2.2.7.3. Anlage von 16S-rDNA Genbibliotheken aus Konsortiums-DNA

Insgesamt wurden acht verschiedene 16S-rDNA Genbibliotheken aus Konsortiums-DNA angelegt. Diese Genbibliotheken unterschieden sich in den PCR-Ansätzen, der für die PCR eingesetzten Template-DNA und der Klonierungsmethode.


39

Tab. 2.2.7.3.1 PCR-Ansätze, Template-DNA und Klonierungsmethoden der 16S-rDNA Genbibliotheken.

PCR-Ansatz/16S-rDNA Genbibliothek*

PCR-Typ**

Template-DNA für PCR***

Klonierungsmethode****

A

A

31.1.95

TA, pCRII

B

B

31.1.95

LIC, pUC19

C

C

31.1.95

TA, pCRII

D

D

31.1.95

TA, pCR2.1

E

A

2.12.96

TA, pT-Adv

F

A

9.12.96

TA, pT-Adv

G

A

16.12.96

TA, pT-Adv

H

A

23.12.96

TA, pT-Adv

*

Bei Genbibliothek G mußte das PCR-Produkt durch Ethanolfällung und Suspension in 5 µl TE-Puffer um den Faktor 10 konzentriert werden.

**

Zur Beschreibung des PCR-Typs s. Tab. II.2.6.3.1.

***

Angegeben ist das Datum der Probennahme für die DNA-Extraktion. Alle Präparationen erfolgten wie unter II.2.3.2 angegeben.

****

Neben der Klonierungsmethode ist der jeweilige Plasmid-Vektor angegeben.

2.2.7.4. Anlage von nifH-Genbibliotheken aus Konsortiums-DNA

Insgesamt wurden ausgehend von drei verschiedenen DNA-Präparationen drei nifH-Genbibliotheken aus Konsortiums-DNA angelegt (X, Y, Z). Alle nifH-Genbibliotheken wurden nach PCR-Amplifizierung von nifH-Genfragmenten aus präparierter Konsortiums-DNA und anschließender TA-Klonierung mit dem Vektor pCR2.1 angelegt.

Tab. 2.2.7.4.1 Aus Konsortiums-DNA angelegte nifH-Genbibliotheken.

nifH-Genbibliothek

Template-DNA*

X

2.12.96

Y

9.12.96

Z

23.12.96

*

Angegeben ist das Datum der Probennahme für die DNA-Extraktion. Alle Präparationen erfolgten wie unter II.2.3.2 angegeben.


40

2.2.8. DIG-Markierung von Oligonukleotiden

Die enzymatische Markierung von Oligonukleotiden mit Digoxigenin (DIG) erfolgte mit dem ”DIG Oligonucleotide 3‘-End Labeling Kit“ (Boehringer, Mannheim) nach Angaben des Herstellers. Die Oligonukleotide wurden dabei durch das Enzym Terminale Transferase am 3‘-Ende durch Einbau eines DIG-gekoppelten ddUTP (DIG-ddUTP) markiert. Für jede Reaktion wurden je 100 pmol Oligonukleotid eingesetzt. Zur Überprüfung der Markierungsausbeute wurden Verdünnungsreihen des Reaktionsproduktes und eines DIG-markierten Standardoligonukleotids (Boehringer Mannheim) verglichen. Dies erfolgte durch Erstellen einer Dot-Blot Membran und den nachfolgenden Nachweis der DIG-markierten DNA mittels Chemolumineszenz .

2.2.9. Sequenzierung von DNA

Als DNA-Sequenzierungsmethode wurde die zyklische- oder PCR-Sequenzierung mit fluoreszenzmarkierten Primern eingesetzt. Neben den universellen Sequenzierprimern M13(20)F, M13(21)F und M13(24)R wurden für die Sequenzierung von 16S-rDNA die spezifischen Strangprimer TPU1, TPU2, TPU5 und 1114F sowie die Gegenstrangprimer RTU2, RTU3, RTU5, RTU6, Arch915 und 1100R eingesetzt. Die Synthese der Oligonukleotide und Markierung mit den Fluoreszenzfarbstoffen erfolgte durch MWG-Biotech (Ebersberg). Alle Reaktionen wurden mit dem Thermosequenase Fluorescent Labelled Primer Cycle Sequencing Kit (Amersham-Pharmacia, Freiburg) durchgeführt. Als Template dienten sowohl mit dem Flexi-Prep Kit (Amersham-Pharmacia, Freiburg) aufgereinigte Plasmid-DNA als auch mit Silika aufgereinigte PCR-Produkte. Ein Reaktionsansatz (8 µl) enthielt 2 µl A, T, G oder C-Reagenz, 4 pmol fluoreszenzmarkierten Primer, 0.2-1 µg Template-DNA und 1-1.5% DMSO. Nachdem die Ansätze mit einem Tropfen Mineralöl überschichtet worden waren erfolgte die Sequenzierreaktion entweder mit dem Omni-Cycler von Hybaid (über MWG-Biotech, Ebersberg) oder mit dem Trioblock (Biometra, Göttingen) nach folgendem Reaktionsprofil:

1 Zyklus

Initiale Denaturierung

95 °C

5 min

30 Zyklen

Denaturierung

95 °C

30 s

 

Primer-Hybridisierung

55 °C

30 s

 

Primer-Elongation

70 °C

1 min


41

Entgegen den Angaben des Herstellers wurden die Sequenzieransätze ohne weitere Aufreinigung unmittelbar nach dem Ablauf der Reaktion mit 6 µl PAA-Probenpuffer versetzt und ein Aliquot (1.4 oder 2 µl) auf ein 6 oder 4%iges Polyacrylamidgel aufgetragen. Die Analyse der Sequenzierprodukte erfolgte mit dem automatischen LI-COR 4000 oder 4000L DNA-Sequenzierer (MWG-Biotech, Ebersberg).

2.2.10. Vergleichende 16S-rDNA Sequenzanalyse

Die Bearbeitung der ermittelten 16S-rDNA Sequenzen und das Alignment mit bekannten 16S rRNA Sequenzen erfolgte mit dem ARB_EDIT-Sequenzeditor des ARB Programm Pakets (http://isar.mpi-bremen.de/arb/arb.html), das auf einem Sparc 5 UNIX Computer installiert wurde. Vollständige 16S-rDNA Sequenzen (etwa 1550 bp) wurden mit dem BlastN-Programm der WWW-Version des HUSAR-Programm Pakets (http://genius.embnet.dkfz-heidelberg.de:8080/menu) mit den in den öffentlichen Datenbanken hinterlegten Sequenzen (Stand März 1998) verglichen, um ihre ungefähre phylogenetische Zuordnung zu bestimmen. Phylogenetisch verwandte Sequenzen, die nicht in der ARB-Datenbank mit ihren etwa 8000 vollständigen oder partiellen 16S rRNA Sequenzen enthalten waren, wurden mit dem ARB_PARSIMONY-Programm ohne Veränderung des Verzweigungsmusters in einen phylogenetischen Baum eingefügt, der auf 5106 16S rRNA Sequenzen mit mindestens 1400 bp Länge basierte. Davon ausgehend wurden mit dem ARB-Programm phylogenetische Bäume nach der “Neighbor-joining“ Methode (Saitou und Nei, 1987) und der Korrekturformel nach Jukes und Cantor (1969) errechnet, denen ein verringerter Datensatz zu Grunde lag.

Die Zuverlässigkeit des Verzweigungsmusters wurde mit der “Bootstrap“ Analyse (Felsenstein, 1985) bestimmt. Um mögliche Sequenzchimären unter den Klonen nachzuweisen, wurden ausgehend von jeweils überlappenden Sequenzen von etwa 400 bp Länge phylogenetische Bäume verglichen. Zusätzlich wurden alle in dieser Arbeit ermittelten vollständigen 16S-rDNA Sequenzen, die weniger als 96% Homolgie zu den 16S rRNA Sequenzen bekannter Mikroorganismen aufwiesen mit dem CHECK_CHIMERA-Programm des “Ribosomal Database Projektes“ (Larsen et al., 1993) auf eine mögliche chimäre Struktur untersucht.


42

2.2.11. Vergleichende Sequenzanalyse abgeleiteter nifH-Genprodukte (NifH-Sequenzen)

Ausgehend von den ermittelten Sequenzen partieller nifH-Gene wurde mit dem Programm Translate der WWW-Version des HUSAR-Programm Pakets (http://genius.embnet.dkfz-heidelberg.de:8080/menu) die Aminosäuresequenz des kodierten NifH-Proteins abgeleitet und diese dann mit dem BlastP-Programm (HUSAR-Paket) mit den in den öffentlichen Datenbanken hinterlegten Aminosäuresequenzen verglichen. Das Alignment mit verwandten Proteinsequenzen erfolgte manuell mit dem ARB_EDIT-Sequenzeditor des ARB-Programm Pakets (http://isar.mpi-bremen.de/arb/arb.html). Ausgehend von diesem Alignment wurde mit dem ARB-Programm und der Dayhoff PAM Matrix Option eine evolutionäre Unähnlichkeitsmatrix errechnet aus der dann widerum mit der “Neighbor-joining“ Methode (Saitou und Nei, 1987) ein phylogenetischer Baum abgeleitet wurde. Mit dem Programm PROTPARS des PHYLIP-Programm Pakets (http://evolution.genetics.washington.edu/phylip.html) wurde ein phylogenetischer Baum nach der Parsimony-Methode (Felsenstein, 1978) ermittelt. Für alle phylogenetischen Dendrogramme wurde die Zuverlässigkeit des Verzweigungsmusters mittels ”Bootstrap“-Analyse ermittelt (Felsenstein, 1985).

2.2.12. Filter-Hybridisierungen

2.2.12.1. Dot-Blot

Der DNA-Transfer auf das Trägermaterial (Hybond N Nylonmembran; Amersham-Pharmacia, Freiburg) fand beim Dot-Blot durch einfaches ”Aufpipettieren“ statt. Vor dem Auftragen wurden die DNA-Proben (1 µl Plasmid-DNA oder PCR-Produkt) durch 3 min Inkubation bei 95 °C denaturiert und rasch auf Eis abgekühlt. Nach dem Auftragen der Proben wurden die Membranen von beiden Seiten je 2 min auf einem ”UV-crosslinker“ (312 nm) von MWG-Biotech (Ebersberg) bestrahlt und die Nukleinsäuren so durch UV-Quervernetzung fixiert.

2.2.12.2. Slot-Blot (Colony-Slot-Blot)

Beim Slot-Blot wurden die DNA-Proben nicht punktförmig sondern mit Hilfe einer speziellen Vakuumapparatur, dem sog. Slot-Blotter, schlitzförmig aufgetragen. In dieser Arbeit wurde der Minifold II Apparat der Firma Schleicher und Schuell (Dassel)


43

verwendet, der das Auftragen von 72 Proben auf das Trägermaterial (Hybond N+ Nylonmembran; Amersham-Pharmacia, Freiburg) erlaubt. Nach dem Durchsaugen der Proben wurden je 200 µl 2x SSC-Lösung in die Probenvertiefungen gegeben und ebenfalls durchgesaugt. Die aufgetragenen Nukleinsäuren wurden durch UV-Quervernetzung (2 mal je 3 min) auf der Membran fixiert. Durch anschließendes Waschen in 0.1x SSC-Lösung (2 mal je 30 min bei 68 °C) wurden auf der Membran verbleibende Zelltrümmer, die bei der nachfolgenden Hybridisierung zu unspezifischen Signalen hätten führen können, entfernt.

2.2.12.3. Hybridisierung mit DIG-markierten DNA-Sonden

Für die Analyse rekombinanter E. coli-Klone wurden die mittels Dot-Blot oder Slot-Blot Verfahren auf Nylon-Membranen gebrachten DNA-Proben mit DIG-markierten Oligo- oder Polynukleotidsonden hybridisiert.

Zusammensetzung der Puffer und Lösungen:

Standard-Hybridisierungs-Puffer:

5x

SSC

0.1%

Natrium-Lauroylsarkosin

0.02%

SDS

1%

Blockierungsreagenz (Boehringer Mannheim) in Puffer 1 (s. u.) gelöst

Standard-Hybridisierungs-Puffer mit 50% Formamid (SHF-50 Puffer):

5x

SSC

0.1%

Natrium-Lauroylsarkosin

0.02%

SDS

2%

Blockierungsreagenz (Boehringer Mannheim) in Puffer 1 (s. u.) gelöst

50%

deionisiertes Formamid (Biometra, Göttingen)

Waschlösung 1:

0.1x

SSC

0.1%

SDS

Waschlösung 2:

6x

SSC

0.1%

SDS

Alle Schritte erfolgten in Hybridisierungsröhren von MWG-Biotech (Ebersberg) mit einem Ofen der gleichen Firma. Zunächst wurden die Membranen (max. 150 cm2/Röhre) für 30 min bei der jeweiligen Hybridisierungtemperatur mit etwa 25 ml Standard-Hybridisierungs-Puffer prähybridisiert. Für die Hybridisierung mit DIG-markierten 16S-rDNA-Fragmenten wurde anstelle des Standard-Hybridisierungs-Puffer 20 ml SHF-50 Puffer verwendet (20 ml mit 3.5 µl einer 25 µl-DIG-PCR-Reaktion). Zur Denaturierung der rDNA-Fragmente wurde der Hybridisierungsansatz


44

zuvor für 10 min bei 68 °C inkubiert. Die Hybridisierung erfolgte anschließend für 4 h bei Temperaturen zwischen 59 und 62 °C. Nach Abgießen des SHF-50 Puffers wurden die Membranen zweimal mit je 40 ml Waschlösung 1 bei 68 °C für je 25 min gewaschen.

Für die Hybridisierung mit DIG-markierten Oligonukleotiden wurde der Standard-Hybridisierungs-Puffer nach der Prähybridisierung gegen Standard-Hybridisierungs-Puffer mit 10 pmol DIG-markiertem Oligonukleotid ausgetauscht. Die Hybridisierung erfolgte bei 37 °C für mindestens 1.5 h. Anschließend wurden die Membranen zweimal für je 15 min bei Temperaturen zwischen 52 und 54 °C mit etwa 25 ml Waschlösung 2 gewaschen.

Der Nachweis gebundener DIG-markierter DNA erfolgte über einen Enzym-Immunoassay mit Chemolumineszenz (DIG Luminescent Detection Kit; Boehringer Mannheim). Alle Arbeitsschritte wurden bei 37 °C durchgeführt.

Zusammensetzung der Detektionspuffer und Lösungen:

Puffer 1, pH 7.5:

0.1 M

Maleinsäure

0.15 M

NaCl

Puffer 2:

1%

Blockierungsreagenz in Puffer 1 gelöst

Puffer 3, pH 9.5:

0.1 M

Tris-HCl

0.1 M

NaCl

Substratlösung:

20-40 µl

CSPD auf 10 ml Puffer 3

Stripping-Lösung A:

0.2 N

NaOH

0.1%

SDS

Stripping-Lösung B:

50%

Formamid (deionisiert)

10 mM

NaH2PO4, pH 6.5

Die Membranen wurden nach dem letzten Waschschritt 30 min mit 20 ml Puffer 2 inkubiert. Nach Verdünnung des Antikörpers (Anti-DIG-AP-Konjugat; 2µl auf 25 ml Puffer 2) wurden die Membranen 30 min lang mit dieser Lösung inkubiert. Nach Abgießen der Antikörperlösung wurden die Membranen zweimal je 15 min mit je 25 ml Puffer 1 gewaschen, kurz mit 5 ml Puffer 3 äquilibriert und dann für 15 min mit Substratlösung inkubiert. Nach kurzem Abtropfen wurden die Membranen in Haushalts-Frischhaltefolie eingeschlagen und in einer Röntgenfilmkassette (MS-


45

Laborgeräte, Heidelberg) auf einen Röntgenfilm gelegt. Nach etwa 2 h Belichtung bei 37 °C oder üN bei 10 °C wurde der Röntgenfilm entwickelt (Hyperprozessor; Amersham-Pharmacia, Freiburg).

Um eine erneute Hybridisierung der Membranen zu ermöglichen, wurden gebundene Oligonukleotide durch Waschen mit Stripping-Lösung A (2 mal je 15 min, 37 °C) entfernt. Für das Entfernen gebundener 16S-rDNA-Fragmente wurde die Waschzeit auf jeweils 25 min erhöht. Bei der Colony-Slot-Blot-Hybridisierung wurde neben Stripping-Lösung A auch Stripping Lösung B eingesetzt (2 mal je 35 min, 68 °C).

2.2.13. In-situ-Hybridisierung mit fluoreszenzmarkierten Oligonukleotiden

2.2.13.1. Fixierung von Zellmaterial

Für die Fixierung von Zellmaterial aus Reinkulturen kamen je nach Zelltyp zwei verschiedene Methoden zur Anwendung. Gram-negative Bakterien wurden als Flüssigkultur angezogen, das Zellmaterial eines Aliquots (1 ml) bei 2000 x g für 5 min abzentrifugiert, das überstehende Medium abgenommen und das Pellet in 1 ml PBS suspendiert. Durch Zugabe von 100 µl einer 37%igen Formalinlösung (Merck, Darmstadt) und kurzem Durchmischen erfolgte die Zellfixierung. Bei Gram-positiven Bakterien und Archaea wurde das resultierende Zellpellet lediglich in 500 µl PBS suspendiert und die Fixierung erfolgte durch Zugabe von 500 µl absolutem Ethanol. Die Lagerung fixierter Reinkulturen erfolgte bei -20 °C. Aus dem Bioreaktor entnommene Polyurethanschaumkörper wurden zur Fixierung des aufgewachsenen Zellmaterials in Fixierlösung überführt und anschließend bei -70 °C gelagert :

Fixierlösung:

25 ml PBS + 2.5 ml Formalinlösung (37%) + 30 ml Ethanol (absolut)

Die auf den Polyurethanschaumkörpern haftenden, fixierten Zellen wurden entweder durch direktes Absaugen mit einer Pipette oder durch vorheriges Vortex-Mischen abgetrennt.

2.2.13.2. Hybridisierung

Die in situ Hybridisierung wurde, abgesehen von geringen Abweichungen, nach der von Amann et al. (1990a) beschriebenen Methode durchgeführt.


46

Zusammensetzung des Hybridisierungspuffers:

0.9 M

NaCl

0.02 M

Tris-HCl, pH 7.2

0.01 %

SDS

Die Stringenz der Hybridisierung wurde durch Zugabe von Formamid (0-23%) variiert.

Je nach Zelldichte wurde 10-20 µl fixiertes Zellmaterial auf ein Feld eines 6-Feld Objektträgers (Marienfeld KG) aufgebracht, gleichmäßig verteilt und durch Lufttrocknung bei 37 °C immobilisiert. Anschließend wurden die Zellen in einer aufsteigenden Ethanolreihe (50 %, 80 %, 96 % je 3 min) entwässert und danach erneut luftgetrocknet. Auf jedes Feld des auf 46 °C erwärmten Objektträgers wurden 10 µl ebenfalls auf 46 °C vorgewärmte Hybridisierungslösung (9 µl Hybridisierungpuffer und 1 µl fluoreszenzmarkiertes Oligonukleotid [50 ng/µl]) gegeben und die Objektträger bei 46 °C für mindestens 2 h in einer feuchten Kammer inkubiert.

Anschließend wurde die Hybridisierunglösung mit a. dest. abgespült und die Objektträger bei 37 °C im Dunkeln luftgetrocknet. Neben der in situ Hybridisierung wurde eine Zellfärbung mit dem DNA-bindenden Fluoreszenzfarbstoff DAPI (Sigma, Deisenhofen) durchgeführt. Dazu wurden je Feld 10 µl einer DAPI-Lösung (10 µg/ml) gegeben, 5 min im Dunkeln bei 37 °C inkubiert und der Objektträger danach mit a. dest. gespült und luftgetrocknet. Um ein rasches Ausbleichen der Fluoreszejnzfarbstoffe zu verhindern, wurden die Objektträger mit Citifluor (Citifluor Ltd., London, Großbritannien) eingedeckt und unter dem Epifluoreszenz-Mikroskop betrachtet.

2.2.13.3. Nachweis fluoreszenzmarkierter Zellen

Der Nachweis fluoreszenzmarkierter Zellen erfolgte mittels Epifluoreszenzmikroskopie mit einem Axioscop Fluoreszenzmikroskop (Zeiss, Jena) und der HQ Filter-kombination F41-001 (Anregung 480/40 nm, Emission 535/50 nm) und F41-007 (Anregung 535/50 nm, Emission 610/75 nm) von AHF Analysentechnik (Tübingen).

Bei 1000-facher Vergrößerung wurde jeweils das Phasenkontrastbild mit dem dazugehörigen Epifluoreszenzbild verglichen. Die Dokumentation der Ergebnisse erfolgte fotografisch mit Hilfe einer automatischen Kamera (Zeiss, Jena) und Kodak Ektachrome HC400-Film.


[Titelseite] [Danksagung] [Abkürzungsverzeichnis] [1] [2] [3] [4] [Bibliographie] [Anhang] [Selbständigkeitserklärung] [Lebenslauf]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiDi DTD Version 1.1
a subset from ETD-ML Version 1.1
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Fri Nov 5 18:12:08 1999