| ↓9 |
All chemicals and materials used in the present study are listed in table 1.
| ↓10 |
Table 1. Chemicals and materials used in the present study
|
Manufacturer |
Product |
|
Amersham |
[γ- 32P]ATP, Plus One Tris-Base, Plus One EDTA, Plus One boric acid |
|
Pharmacia |
Ready to Go DNA labelled Beads |
|
BD |
Difco medium 3 |
|
Biorad |
Blotting grade blotter non-fat dry milk |
|
Bioron |
Taq polymerase |
|
Fermentas |
DNA markers, dNTPs, prestained protein ladder, RevertAid M-MuLV reverse transcriptase (200U/μl), restriction endonucleases, RiboLock ribonuclease inhibitor (40U/ μl), T4 DNA ligase, T4 kinase, T4Polynucleotide kinase |
|
Fluka |
CaCl2, EDTA |
|
Macherey-Nagel |
Nitrocellulose membrane porablot NCL, Nucleo Spin ® Extract II, Nucleo Spin RNA L, Porablot NY plus, Protino® Ni-1000 kit |
|
Merck |
Meat extract |
|
MP |
Biomedicals Urea pure |
|
Promega |
BCIP (50 mg/ml), NBT (50 mg/ml), pGEM-T® Vector systems |
|
Qiagen |
QIAEX II gel extraction kit, QIAprep Spin mini prep kit, Qiaquick PCR purification kit |
|
Roche |
Anti-DIG AP, Ampicillin, blocking reagent, DIG-dUTP, kanamycin |
|
Roth |
Agarose, chloramphenicol, citric acid, CuSO4, DEPC, FeCl2, FeCl2, Fe2(SO2)3, formaldehyde, L-glutamic acid, glycerol, HEPES, IPTG, KCl, K2HPO4, H2KPO4, maleic acid, MgSO4, MnCl2, MnSO4, Na-acetate, Nacitrate, Na2CO3, NaCl, NaOH, (NH4)2SO2, peptone, SDS, Proteinase K, Rotiphorese Gel 40 (19:1), Rotiphorese Gel 40 (29:1), TEMED, Tris, Triton-X 100, Tween 20, XGal, yeast extract, ZnCl2 |
|
Serva |
Agar, APS, boric acid, casamino acids, DTT, EGTA, Erythromycin, glucose, N-Lauroylsarcosine-sodium, lincomycin/HCl, MgCl2, MOPS, NaN3, Na2SO4, ONPG, L-tryptophan |
|
Sigma |
Oligonucleotides, Anti-rabbit IgG AP |
The plasmids, bacterial strains and primers used in this study are listed in tables 2, 3, 4
respectively.
| ↓11 |
Table 2. Plasmids used in the present study
|
Plasmid/reference |
Description |
|
pMarA/Le Breton et al. 2006 |
pUC19 carrying TnYLB-1 transposon, mariner-Himar1 transposase and promoter σA, Kanr Ampr Ermr |
|
pMarB/Le Breton et al. 2006 |
pUC19 carrying TnYLB-1 transposon, mariner-Himar1 transposase and promoter σB, Kanr Ampr Ermr |
|
pMarC/Le Breton et al. 2006 |
pUC19 carrying TnYLB-1 transposon, Kanr Ampr Ermr |
|
pUC18/Fermentas |
Cloning vector Ampr, lacZ’ |
|
pVBF |
pUC18 carrying fragment of amyE |
|
pAB1 |
pVBF carrying fragment of pabB |
|
pAB2 |
pVBF carrying fragment of yusV |
|
pAB3 |
pVBF carrying fragment of degU |
|
pAB6 |
pVBF carrying fragment of nfrA |
|
pAB7 |
pVBF carrying fragment of RBAM_017410 |
|
pAB8 |
pVBF carrying fragment of abrB |
Table 3. Bacterial strains used in the present study
|
Strain |
Genotype |
Reference |
|
B. amyloliquefaciens FZB42 |
Wild type |
FZB Berlin |
|
B. subtilis 168 |
trpC2 |
Laboratory stock |
|
E. coli DH5α |
supE44 ΔlacU169(Φ 80 lacZ Δ M15) hsdR17 recA1 gyrA96 thi-1 relA1 |
Labor atory stock |
|
CH5 |
FZB42 sfp::ermAM yczE::cm |
X.-H.Chen, 2009 |
|
AB101 |
FZB42 pabB::TnYLB-1 |
This Study |
|
AB102 |
FZB42 yusV::TnYLB-1 |
This Study |
|
AB103 |
FZB42 degU::TnYLB-1 |
This Study |
|
AB106 |
FZB42 nfrA::TnYLB-1 |
This Study |
|
AB107 |
FZB42 RBAM_017410::TnYLB-1 |
This Study |
|
AB108 |
FZB42 abrB::TnYLB-1 |
This Study |
|
AB110 |
CH5:: TnYLB-1 |
This Study |
Table 4. Primers used in this study
|
Primer (restriction site) |
Sequence (5' to 3' end) |
Source or reference |
|
oIPCR1 oIPCR2 oIPCR3 |
GCTTGTAAATTCTATCATAATTG AGGGAATCATTTGAAGGTTGG GCATTTAATACTAGCGACGCC |
Le Breton et al. 2006 |
|
yusV-dw-Eco91I yusV-up- SacII |
CTCCCTTTGGAATTTGGACAGCCGCTATGAC AGCCCGCGGTCCGTGTATTTCTCAAGCAGG |
This work |
|
nfrA-dw- Eco88l nfrA-up- ClaI |
AATCCCGAGATCGAATCGTTTCATTCCTCG TTATAGCTATTCACACCTTCCAGAACATCG |
This work |
|
410-up- sacII 410-dw- eco91I |
AACCCGCGGATTGCATTGAACGGCGGTCT GCACCATTGGATCCCTTTGGTATCCCTCAG |
This work |
|
degU-dw-ClaI degU-up- Eco88I |
AATATCGATTCACCGAAAACCACTTGGAG ATACCCGAGTAGGATAAGGAGGCGTAGCG |
This work |
|
pabB-dw- Eco91I pabB-up- SacII |
TTTGGTTACCTGAATAGAGACATACACACGGC AATCCGCGGATTCCGTCTGACGATCAGTTC |
This work |
|
abrB-dw-SacII abrB-up- Eco91I |
TTTCCGCGGAAGAGCATGTGGAGCATTAC GGCCCATTGGAACCTCCCATTCAGAATGTC |
This work |
|
amyBack-1 amyBack-2 |
AGCGAAATTACCTGACGGCAG AGCTCAAGTTCCGTCACACCTG |
Ben et al. 2011 |
|
amyFront(aatII)-1 amyFront-2 |
AGTTTGACGTC TCTCCGATTTCGCCGACAACAC TCGATTTGTTTGCAGTTTCAGCG |
Ben et al. 2011 |
| ↓12 |
All media used in this work were prepared and sterilized according to Sambrook et al. 1989 and Cutting and Horn 1990. Supplements with different antibiotics and compounds are listed in table 5. For screening biofilm formation, bacteria were grown in MSgg medium (Branda et al. 2004). Cultivation of L. minor was done in Steinberg medium (Idris et al. 2007).
· LB (Luria-Broth) medium
|
1 % w/v |
peptone |
|
0,5 % w/v |
yeast extract |
|
0,5 % w/v |
NaCl |
| ↓13 |
· MSgg medim
|
5 mM |
K2HPO4 [pH 7] |
1 μM |
ZnCl2 |
|
2mM |
MgCl2 |
700 μM |
MnCl2 |
|
50 μM |
FeCl2 |
2 μM |
thiamine |
|
0.5% |
glycerol |
0.5% |
glutamate |
|
50 μg/ml |
tryptophan |
50 μg/ml |
phenylalanine |
|
100 mM |
morpholinepropane sulfonic acid [pH 7] |
||
· Steinberg medium
| ↓14 |
|
3.46 mM |
KNO3 |
1.25 mM |
Ca(NO3)2 |
|
0.66 mM |
KH2PO4 |
0.072 mM |
K2HPO4 |
|
0.41 mM |
MgSO4 |
1.94 μM |
H3BO3 |
|
0.63 μM |
ZnSO4 |
0.18 μM |
Na2MoO4 |
|
0.91 μM |
MnCl2 |
2.81 μM |
FeCl3 |
|
4.03 μM |
EDTA |
|
Supplement |
Final concentration |
|
Agar |
1,5 % w/v, 0,75 % w/v (swarming agar plates) |
|
Amplicillin |
100 μg/ml |
|
Chloramphenicol |
20 μg/ml (for E. coli), 5 μg/ml (for Bacilli) |
|
Erythromycin |
1 μg/ml (for Bacilli) |
|
IPTG |
1 mM |
|
Kanamycin |
20 μg/ml (for E. coli), 5 μg/ml (for Bacilli) |
|
Lincomycin |
25 μg/ml (for Bacilli) |
|
XGal |
40 μg/ml |
DNA manipulation, such as digestion with restriction endonucleases and ligation, was performed according to the instructions supplied by the manufacturer. Agarose-gel electrophoresis, fluorescent visualization of DNA with ethidium bromide, spectrophotometric quantitation of DNA as well as preparation of CaCl2-competent E. coli cells followed by transformation of plasmid DNA were carried out with standard procedures described by Sambrook et al. 1989. Bacterial chromosomal DNA from Bacilli was prepared as described by Cutting and Horn 1990b. Polymerase chain reaction (PCR) was done using the GeneAmp PCR system 2700 (Applied Biosciences) according to Dieffenbach and Dveksler 1995, under the appropriate conditions in each case. Ligation of PCR products to pGEM-T vector was carried out following the instructions of the manufacturer (Promega). Plasmid DNA isolation and recovery of DNA from agarose gels were performed with QIAprep Spin mini prep kit and QIAEX II gel extraction kit, respectively.
| ↓15 |
2.4.2 Transformation in B. amyloliquefaciens
Competent cells of Bacillus amyloliquefaciens were obtained by modifying the two-step protocol published by Kunst and Rapoport 1995. Cells were grown overnight in LB medium at 28°C (170 rpm). The next day, they were diluted in glucose-casein hydrolysate-potassium phosphate (GCHE) buffer to an OD600 of 0,3. The cell culture was then incubated at 37°C under vigorous shaking (200 rpm) until the middle of exponential growth (OD600 ~1,4). Dilution with an equal volume of GC medium followed and the cells were further incubated under the same conditions for 1 hour. Further on, the culture was divided in 2 ml Eppendorf tubes and cells were harvested by centrifugation at 6000 rpm for 5 minutes (room temperature). The pellets were resuspended in 200 μl of the supernatant and the desired DNA (1 μg) with 2 ml transformation buffer was added to them. After incubation at 37°C under shaking at 75 rpm for 20 minutes, 1 ml LB medium containing sublethal concentration (0,1 μg/ml) of the appropriate antibiotic was added. The cells were grown under vigorous shaking for 90 minutes and platted on selective agar plates.
Buffers
| ↓16 |
|
●GCHE buffer |
●GC buffer |
|
1 x PC buffer |
1 x PC buffer |
|
0,1 M glucose |
0,1 M glucose |
|
0,005% w/v tryptophan |
0,005% w/v tryptophan |
|
0,04 M FeCl3 / Na-citrate |
0,04 M FeCl3 / Na-citrate |
|
0,25% w/v potassium glutamate |
3 mM MgSO4 |
|
3 mM MgSO4 | |
|
0,1% w/v casein hydrolysate |
|
●10 x PC buffer |
●Transformation buffer |
|
0,8 M K2HPO4 |
1 x SMM buffer |
|
0,45 M H2KPO4 |
1 mM EGTA |
|
0,028 M Na-citrate |
0,025 M glucose |
|
0,02 M MgCl2 |
The mariner based transposon TnYLB-1 plasmid was used to generate a transposon library according to Haldenwang (Le Breton et al. 2006). In brief, plasmid pMarA, pMarB and pMarC were transformed into B. amyloliquefaciens FZB42 selecting for Kanr at 30°C. Transformant colonies were screened for plasmid-associated properties, i.e. Kanr and Ermr at permissive temperature for plasmid replication (30°C) and Kanr and Erms at the restrictive temperature (48°C). Plasmid DNA was then extracted from the transformants and subjected to restriction endonuclease analysis to verify that these transformants contained the original intact plasmid. Then representative plasmid-containing colonies were incubated overnight in LB medium at 37°C. Samples were then plated on LB agar containing Kan and incubated at 48°C to select for transposants.
| ↓17 |
Five micrograms of genomic DNA isolated from the respective transposants was digested with Taq I and then circularised in a ligation reaction using ‘Rapid Ligation’ kit (Fermentas, Germany) at a DNA concentration of 5 ng/μl. Inverse PCR was performed on 100 ng of ligated DNA using oIPCR1 and oIPCR2, which face outward from the transposon sequence. IPCR products were purified using PCR purification kit (Amersham, UK) and sequenced using the primer oIPCR3 (Le Breton et al. 2006).
Southern blot is a way of permanently immobilizing DNA (that has been separated by agarose gel electrophoresis) to a solid support. It is designed to locate a particular sequence of DNA within a complex mixture, such as an entire genome. Hybridization and detection occurs by “anealling” with a complementary labelled DNA probe.
For each Southern hybridization, an appropriate probe was labelled with Digoxigenin-11-dUTP (DIG-dUTP), according to the Ready-to-Go kit from Roche. The desired DNA region was amplified by PCR and purified, prior to labelling. 100 ng of the PCR fragment were denaturated by heating at 100°C for 10 minutes and then mixed with 5 μl dCTP (10 mM), 2,5 μl DIG-dUTP (1mM) to a final volume of 50 μl. The mixture was incubated at 37°C for 1,5 hours and was stored at -20°C until use.
| ↓18 |
1-2 μg of the chromosomal DNA in question were digested overnight with a suitable restriction endonuclease. Samples were initially separated on a 0,8 % agarose gel in 1 x TAE buffer at 70 Volt. The gel was washed twice for 20 minutes, initially with denaturation buffer and subsequently with neutralization buffer. Transfer on a nylon membrane was performed using the Biorad vacuum blotter (model 785). The DNA was fixed permanently on the membrane by cross-linking using UV radiation.
Buffers
|
●Denaturation buffer |
●Neutralization buffer |
|
1,5 M NaCl |
1,5 M NaCl |
|
0,5 M NaOH |
1 M Tris-HCl pH=8.0 |
| ↓19 |
The membrane was initially incubated for 1 hour at 65°C with 40 ml hybridization buffer and was hybridized overnight at 55°C with 5-10 ml hybridization buffer containing 5-25 ng/ml of denaturated DIG-labelled probe. The membrane was washed twice for 15 minutes, first with 2 x SSC/0,1 % SDS at room temperature and then with 0,5 x SSC/0,1 % SDS at 55°C. Detection was achieved by a colorimetric approach. The membrane was first equilibrated with P1-DIG buffer and was then incubated for 30 minutes with P1-DIG buffer containing 3,75 units of the antibody Anti-Digoxigenin-Alkaline-Phosphatase. Unbound antibody was removed after a fifteen minute washing step. Addition of 10 ml Ap buffer containing 2,25 mg nitroblue tetrazolium salt (NBT) and 1,75 mg 5-bromo-4-chloro-3 – indolyl phosphate (BCIP) to the membrane and incubation in the dark allowed visualization of the hybridized DNA with our labelled probe.
Buffers
|
●Hybridization buffer |
●20 x SSC |
|
5 x SSC |
3 M NaCl |
|
1 % w/v blocking reagent |
0,3 M Na-citrate |
|
0,1 % v/ N-lauroylsarcosine-sodium | |
|
0,02 % w/v SDS |
| ↓20 |
|
●P1-DIG buffer |
●Wash buffer |
●Ap buffer |
|
0,1 M maleic acid |
0,1 M maleic acid |
0,1 M Tris-HCl pH=9.5 |
|
0,15 M NaCl |
0,15 M NaCl |
0,1 M NaCl |
|
1 % w/v blocking reagent |
0,3 % v/v Tween-20 |
0,05 M MgCl2 |
L. minor ST was propagated in Steinberg medium. Four plants with two or three budding-pouches (fronds) were incubated in 200 ml of medium in a 500 ml flask. The flasks were kept at 22°C with continuous light until sufficient numbers of homogenous Lemna plant were obtained. The growth medium was changed every week. To prove the biostimulation effect of FZB42 a 48-well microtiter plate was used. Each well was filled with 1.25 ml of Steinberg medium. Lemna plants with two fronds were transferred aseptically into the microtiter plates. Culture transposon mutant in appropriate dilutions were added directly. The microtiter plates were kept at 22°C and 24 h light for 10 days, Plants were harvested and growth was determined by dried weight. The result of each trial was repeated four times (Idris et al. 2007).
Arabidopsis seeds (Arabidopsis thaliana var. Columbia) were transferred to an Eppendorf tube and added with 1 ml of 10% sodium hypochlorite. The tube was then shaken for 3 minutes. After pipetting off the sodium hypochlorite solution, 1 ml of sterile distilled water was added to remove residual sodium hypochlorite from the seeds. The tube was inverted 5 times to ensure thorough washing of the seeds. The water was removed with a pipette and repeated the sterile water wash 4 times. The majority of the water was removed, leaving a small volume in the base of the tube to facilitate plating of seeds.
| ↓21 |
Surface sterilized seeds were pre-germinated on petri dishes containing medium consisting of half-strength Murashige and Skoog 0.6% agar and 3% sucrose and allowed to germinate for 7 days at 22°C. The roots of seven-days-old Arabidopsis seedlings were dipped into the bacterial suspension (1x105 CFU/ml) for 5 min and four seedlings were transferred into square petri dish containing half-strength Murashige and Skoog medium with 1% agar. The square petri dishes were placed in a growth chamber at 22°C with 14-h photoperiod. Fresh weight of the plants was measured at 21 days after transplanting.
Transposon mutants of B. amyloliquefaciens were inoculated in 140 μl of LB medium containing kanamycin within a 96-well microtiter plate. The microtiter plates were shaken at low speed (160 rpm) at 37°C for 16 h. Then, 5 μl of every culture were transferred into 1 ml MSgg medium containing kanamycin within a 48-well microtiter plate. The microtiter plates were incubated without shaking at 30°C for 60 h and development of biofilms was analyzed by visual inspection (Branda et al. 2004).
Transposon mutants of B. amyloliquefaciens were inoculated, 25 at a time, into LB plus kanamycin solidified with 0.9% agar and incubated at 30°C overnight. Putative swarming mutants were indentified as small colonies and picked into individual 30 mm diameter plates containing 5 ml of swarm agar (LB solidified with 0.7% agar) supplemented with kanamycin and incubated at 30°C overnight. The mutants that remained unable to completely colonize the mini plates were then verified under the standard conditions for swarming motility by inoculating on LB swarm agar containing kanamycin and incubated 24 h at 37°C (Kearns et al. 2004).
| ↓22 |
Transposon mutants of B. amyloliquefaciens were inoculated in 2 ml LB medium and incubated until OD 1 was reached. At the same time, B. subtilis HB0042 was incubated in 10 ml LB medium until OD 0.6 was reached. The culture of B. subtilis HB0042 was then poured in LB agar handwarm (1:40 dilution). The mixture was poured in plate and let to dry. Two ul of transposon mutant was inoculated on the plate and incubate overnight at 37°C.
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 4.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML-Version erstellt am: 13.10.2011 |