Anhang

I. Primer und Sonden

Primer und Sonde: Sigma-Genosys, Steinheim, Deutschland

Tabelle 1: verwendete Pimer und Sonden

Bezeichung

Lokalisation

Sequenz 5´→ 3´

GAPDH for

Glycerinaldehyd-3-posphatdehydogenase

5´CTCAGTGTAGCCCAGGATGC

60°C

GAPDH rev

5´ACCACCATGGAGAAGGCTGG

hsGAPDH for

humane Glycerinaldehyd-3-posphatdehydogenase

5´GGCGATGCTGGCGCTGAGTAC

60°C

hsGAPDH rev

5´TGGTCCACACCCATGACGA

MART-1 for

Melanona Antigen recognized by T-Cell -1

5´ACTGCTCATCGGCTGTTGGTATTG

58°C

MART-1 rev

5´TTTCAGCATGTCTCAGGTGTCTCG

HERV-H for

HERV-H gag

5´CTTTTATTACCCAATCTGCTCCCGAYAT 1

50°C

HERV-H rev

5´TTTAGTGGTGGACAGTCTCTTTTCCARTG 2

HERV-R for

HERV-R env

5´CCATGGGAAGCAAGGGAACT

50°C

HERV-R rev

5´CTTTCCCCAGCGAGCAATAC

HERV-W for

HERV-W pol

5´GGCCAGGCATCAGCCCAAGACTTG

50°C

HERV-W rev

CTTTAGGGCCTGGAAAGCCACT

rekTM for

HERV-K env (gp36)

5´CTGgAtCcGGAGTTGCATTGCACTCTTCTG 3,4

55°C

rekTM rev

5´GAGAagctT ttaCGTAGTACTTCCAATGGTC 3,5,6

np9-G

HERV-K np9aus Armbrüster 2004

5´cgcgcggatccATGAACCCATCGGAGATGCAA 3,4

58°C

np9-H

5´cgcgcggatccACAGAATCTCAAGGCAGAAG 3,4

P1

HERV-K LTR (U5)

5´GAGGCTGGCGGGATCCTC

60°C

P2

HERV-K LTR (leader)

5´GAAGGTACGCTCGAGCGTAATCATTGAG

P3

HERV-K gag

5´GAGCCATTACCGGCTCTGCTACATATTCG

P4

HERV-K pol

5´GTACCACTCCTCAGATGCAACTTAATCTAGC

P5

HERV-K env (SU)

5´GTGACATCCCGCTTACCATGTGATAAGTG

P6

HERV-K env (gp36)

5´CGTCTAACCATGTCCCAGTGATGC

P7

HERV-K env (gp36)

5´ACAAAGCTTCCTACGTCATCATGGCCCG

np9 for

HERV-K np9aus Armbrüster 2004

5´ATGAACCCATCGGAGATGCAA

58°C

np9 rev

5´ACAGAATCTCAAGGCAGAAG

HERV-K Sonde

HERV-K

FAM-5´AGGTACGCTCG
AGCGTGGTCATTGAGG

67°C

Pfor

HERV-K LTR (leader)

5´CCAACGTGGAGGCTTTTCTCTAG

54°C

PrevVL

HERV-K VL

5´CCTGCTTGTTTTAGTTTCCTTACCA

PrevENV

HERV-K env

5´AGGGAGACTTACCACCATTGATAC

PrevREC

HERV-K rec

5´GGGTATACCTGCAGACACCATTG

PrevNP9

HERV-K np9

5´GTACACCTGCAGTCTCCGTCTCC

1 Y=Pyrimidin Base: C oder T , 2 R=Purin Base: G oder A, 3 a,c,g oder t nicht komplementäre Basen, 4 BamHI Schnittstelle ist fett dargestellt, 5 HindIII Schnittstelle ist fett dargestellt, 6 Stop Codon ist doppelt unterstrichen

Tabelle 1: verwendete Pimer und Sonden

kommerzielle Primer für die Sequenzierung

malE

MBP-Region in pMAL

5´GGTCGTCAGACTGTCGATGAAGCC

60°C

T7 Promotor

T7-Promotor pCALn

5´TAATACGACTCACTATAGGG

50°C

T7 Terminator

T7-Terminator pCALn

5´GCTAGTTATTGCTCAGCGG

50°C

M13 reverse

M13 reverse priming site in pCR4-TOPO

5´CAGGAAACAGCTATGAC

55°C

M13 forward

M13 forward priming site in pCR4-TOPO

5´GTAAAACGACGGCCAG

55°C

T3

T3 priming site in
pCR4-TOPO

5´ATTAACCCTCACTAAAGGGA

55°C

T7

T7 priming site in
pCR4-TOPO

5´TAATACGACTCACTATAGGG

55°C

II. Melanomgewebe und -zellen

Tabelle 2: Expression in Melanomgeweben und -zellen

Gewebe

DNA

MART-1

Expression von HERV-K

Expression HERVs

klinische Daten

VL

env

rec

np9

H

R

W

Alter1

Geschlecht

Tumor-dicke2

Stadium3

Typ4

1

VH

-

+

+

-

-

+

+

+

-

81

m

n.b

n.b

l

2

OL

-

+

+

-

-

-

+

+

-

41

m

n.b

n.b

n.b

3

WR

-

+

+

-

-

-

+

+

-

72

m

n.b

IV

k

4

BC5

5

PV

-

+

+

-

-

-

+

+

-

81

w

n.b

III

k

6

SV5

7

SE

-

+

+

+

+

-

86

w

n.b

IV

k

8

KLM

-

+

+

+

+

+

+

+

-

50

m

n.b

III

l

9

LG

-

+

+

-

-

-

+

+

-

75

m

n.b

III

l

10

HK

-

+

+

-

-

-

+

+

-

42

w

n.b

IV

k

11

SC

-

+

+

+

+ (hel)

-

+

+

-

64

m

n.b

III

l

12

SR

-

+

+

-

-

+

+

+

-

60

m

n.b

n.b

l

13

LH7

-

+

+

-

-

-

+

+

-

71

w

n.b

n.b

n.b

14

KH

-

+

+

-

-

-

+

+

-

64

w

n.b

III

k

15

LA

-

+

+

-

-

-

+

+

-

44

m

n.b

IV

k

16

JA

-

+

+

+/-

-

+

+

+

-

 

17

HÖK5

 

 

 

 

18

HI

-

+

+

-

+

-

67

w

n.b

IV

brain

19

SG5

 

 

20

WD

-

+

+

-

-

-

+

+

-

59

m

n.b

IV

l

21

TB

-

+

+

+

+ (hel)

+

+

+

-

58

w

n.b

IV

l

22

FM

-

+

+

+

+

+/-

+

+

-

28

w

n.b

IV

lung

23

KOH5

 

 

 

 

24

BN

-

+

+

-

-

-

+

+

-

44

m

n.b

III

l

25

SD5

 

 

 

 

26

GW

-

+

+/-

-

-

-

+

+

-

 

27

LU

-

+

+

-

-

-

+

+

-

69

w

n.b

III

k

28

MA

-

+

+

+

+ (hel)

-

+

+

-

58

w

n.b

IV

l

29

FE

-

+

+

+

+ (hel)

/-

+

+

-

80

w

n.b

III

l

30

LAN

-

+

+

-

+/-

-

+

+

-

65

m

n.b

III

l

31

GB

-

+/-

+

-

-

-

+

+

-

42

w

n.b

IV

lung

32

AA

-

+

+

+

+

+

-

+

-

62

m

n.b

IV

l

33

AB

-

+

+

+/-

+/-

-

-

+

-

68

m

1,1

IV

k

34

AC

-

+

+

+

+/-

-

+

+

+/-

69

w

n.b

IV

k

35

AD

-

+

+

-

-

-

-

+

-

55

w

n.b

III

l

36

AE

-

+

+

-

-

-

+

+

-

56

w

n.b

IV

k

37

AF

-

+

+

+/-

+ (hel)

-

-

+/-

-

39

m

1

IV

n.b

38

AG

-

+

+

-

+

-

-

+/-

-

80

w

0,64

IV

k

39

AH

-

+

+

+

+

-

-

+

-

44

w

n.b

IV

k

40

AI

-

+

+

-

-

-

-

+

+

47

m

n.b

IV

l

41

AJ

-

+

+

-

-

-

+

+

+/-

46

m

10

IV

k

42

AK

-

+

+

-

-

-

+/-

+

-

63

m

5

IV

l

43

AL

-

+

+

-

-

+

+

+

+

 

44

AM

-

+

+

-

-

-

+

+

+

 

45

AN

-

+

+

-

-

+

+

+

-

 

46

AO

-

+

+

+

+

+

+

+

+

 

47

AP

-

+

+

-

-

-

+

+

+

 

48

AQ

-

+

+

+

+

+

+

+

-

 

49

AR

-

+

+

-

-

-

+

+

+

 

50

AS

-

+

+

+

+/-

-

+

+

+/-

 

51

AT

-

+

+

+

+

+

+

+

-

 

52

AU

-

+

+

-

-

+

+

+

+

 

53

AV

-

+

+

-

-

-

+

+

+

 

54

AW

-

+

+

-

-

-

-

+/-

-

 

55

AX

-

+

+

-

-

-

+

+

-

 

Zelllinien

DNA

MART-1

Expression HERV-K

Expression HERVs

klinische Daten

VL

env

rec

np9

H

R

W

Alter1

Geschlecht

Tumor-dicke2

Stadium3

Typ4

1

BA

-

+

+

+

+ (hel)

-

-

+

+

41

w

4

III

k

2

GL

-

+

+

-

-

-

-

+

+

 

3

KU

-

+

+

-

-

-

+

+

+

61

m

5

IV

k

4

LAU

-

+

+

+

+ (hel)

-

-

+

+

52

m

n.b

III

k

5

MA6

-

+

+

-

-

-

-

+

+

59

w

n.b

n.b

n.b

6

POS

-

+

+

-

-

-

-

+

+

 

7

RA

-

+

+

-

-

-

-

+

+

84

w

3,7

IV

k

8

SCHM

-

+

+

+

+

+

-

+

+

55

w

2

IV

k

9

SCHW

-

+

+

+

+

+

-

+

+

42

w

4

IV

k

10

SO

-

+

+

-

-

-

-

+

+

59

m

5

IV

l

11

TR

-

+

+

+

+

 

69

w

n.b

IV

l

12

ZD

-

+

+

-

-

-

-

+

+

55

m

5

IV

k

13

ZO

-

+

+

+

+ (hel)

-

-

+

+

64

w

2,55

III

k

32

AA

-

+

+

+

+

-

-

-

-

62

m

n.b

IV

l

33

AB

-

+

+

-

-

-

-

+/-

-

68

m

1,1

IV

k

34

AC

-

+

+

+

+

-

+

+

+

69

w

n.b

IV

k

35

AD

-

+

+

-

-

-

+

+

-

55

w

n.b

III

l

36

AE

-

+

+

-

-

-

+

+

+/-

56

w

n.b

IV

k

37

AF

-

+/-

+

-

-

-

+

+

+/-

39

m

1

IV

n.b

38

AG

-

+

+

-

-

-

+/-

+

+/-

80

w

0,64

IV

k

39

AH

-

+

+

+

+

-

+

+

-

44

w

n.b

IV

k

40

AI

-

+/-

+

-

-

-

+/-

+

-

47

m

n.b

IV

l

41

AJ

-

+

+

-

-

-

+

+

+

46

m

10

IV

k

42

AK

-

+/-

+

-

-

-

+

+

+

63

m

5

IV

l

43

AL

-

+

+

-

-

-

+/-

+

-

 

44

AM

-

+

+

-

-

-

+/-

+

+

 

45

AN

-

+

+

+

+

+

+

+

+

 

46

AO

-

+

+

+

+

-

+

+

+

 

47

AP

-

+

+

+

+

+

+

+

+

 

48

AQ

-

+

+

-

-

-

+

+

+/-

 

49

AR

-

+

+

-

-

-

+

+

-

 

50

AS

-

+

+

-

+/-

+

+

+

+

 

51

AT

-

+

+

+

+

+

+

+

+

 

52

AU

-

+

+

-

-

-

+

+

-

 

53

AV

-

+

+

-

-

-

+

+

+

 

54

AW

-

-

+

-

-

-

+

+

+

 

55

AX

-

+

+

-

-

-

+

+

+

 

+ Expression, +/- schwache Expression, - keine Expression, n.b. nicht bestimmt,
1 Alter bei der ersten Tumordiagnose, 2 Tumordicke in mm, 3 Stadium nach American Joint Committee on Cancer 2001 (siehe Einleitung Seite 18), 4 k – kutane Metastase l - Lymphknotenmetastase, 5 PCR ist durch Melanin inhibiert, 6 Brustkarzinom, 7 Merkelzellkarzinom, hel 1,5kB Fragment zusätzlich zu rec vorhanden

Kontrollzellen

DNA

MART-1

Expression von HERV-K

Expression HERVs

VL

env

rec

np9

H

R

W

56

Jurkat

-

-

+

-

-

-

+

+

+

57

A 27/80

-

-

+

-

-

-

+

+

+/-

58

HL60

-

-

+

-

-

-

+

+

+

59

U 87

-

-

+

-

-

-

+

+

-

60

SW 620

-

-

+

-

-

-

+

+

+

61

7774

-

-

+

-

-

-

+

+

+/-

62

SW 480

-

-

+

-

-

-

+

+

+/-

63

Hacat

-

-

+

-

-

-

+

+

+

64

120/87

-

-

+

+/-

-

-

+

+

+

65

257/85

-

-

+

-

-

-

+

+

+

66

K 562

-

-

+

-

-

-

+

+

+

67

Namalwa

-

-

+

-

-

-

+

+

+

68

SK70V3

-

-

+

+/-

-

-

+

+

+/-

69

D 181/80

-

-

+

-

-

-

+

+

+/-

70

EA 14

-

-

+

-

-

-

+

+

+/-

71

A 431

-

-

+

-

-

-

-

+

+

III. verwendete Seren und Antikörper

Tabelle 3: verwendete Antikörper

Bezeichnung

spezifisch für

Verdünnung

Herkunft

Ziege 7

HERV-K TM

1:500

Ziege 26

HERV-K TM

1:500

Kaninchen 3

HERV-K Rec

1:100

Dr. Löwer

Kaninchen 4

HERV-K Rec

1:450

Dr. Löwer

Ziege 29

HERV-K Np9

1:100

GAPDH

humanes GAPDH

1:100

abcam

β-Aktin

β-Aktin

1:100

Sigma

HMB45

humanes gp100

1:50

DAKO

Tyrosinase

humane Tyrosinase

1:50

Novocastra

α- Ziege

Ziegen IgGs

1:2000

DAKO

α- Kaninchen

Kaninchen IgGs

1:2000

DAKO

α- Maus

Maus IgGs

1:2000

DAKO

LSAB-Kit

Kaninchen, Ziege und Maus Ig´s

1:500

DAKO

α- Human

humane IgGs, IgA, IgM

1:2000

Sigma

α- Ziege IF

Ziegen IgGs

1:200

Sigma

Tabelle 4: verwendete Patientenseren

Patient

HERV-K TM Antikörper

HERV-K Np9 Antikörper

Klinische Daten

Alter1

Geschlecht

Tumordicke2

Stadium3

1

+

-

72

w

2,7

III

2

+

-

36

w

19

IV

3

+

-

65

m

4,5

I

4

+

-

51

w

2

IV

5

+

-

31

m

n.b.

IV

6

+

-

82

w

6,5

III

7

+

-

70

m

1,24

III

8

+

-

60

m

3

I

9

+

-

39

w

1,1

I

10

+

-

79

m

13

II

11

+

-

59

m

2

II

12

+

-

40

w

n.b.

III

13

+

-

80

w

1,35

III

14

+/-

-

20

m

1,8

II

15

+/-

-

68

m

1,1

III

16

+/-

-

29

w

1,3

III

17

+/-

-

77

w

1,45

II

18

+/-

-

55

m

2,16

III

19

+/-

-

53

m

1,51

III

20

+/-

-

80

m

0,22

I

21

+/-

-

69

m

1,38

I

22

+/-

-

83

w

n.b.

I

23

-

-

62

w

2,5

II

24

-

-

71

m

1

I

25

-

-

49

w

3,2

III

26

-

-

65

m

0,26

III

27

-

-

40

m

1,2

III

28

-

-

52

m

0,95

I

29

-

-

47

m

n.b.

IV

30

-

-

52

m

0,99

III

31

-

-

40

m

0,96

III

32

-

-

62

m

2,4

I

33

-

-

62

w

2,86

II

34

-

-

90

w

0,65

II

35

-

-

49

w

3,2

IV

36

-

-

64

m

n.b.

IV

37

-

-

61

m

n.b.

IV

38

-

-

16

m

n.b.

III

39

-

-

67

m

3,5

III

40

-

-

68

m

1,8

IV

41

-

-

43

m

n.b.

IV

42

-

-

38

m

1,25

II

43

-

-

43

w

1,84

III

44

-

-

44

w

n.b.

II

45

-

-

45

m

0,5

III

46

-

-

51

m

2,79

IV

47

-

-

74

m

7

III

48

-

-

76

m

4

III

49

-

-

49

m

0,64

I

50

-

-

60

m

1,25

I

51

-

-

73

w

0,59

I

20

-

-

60

w

1,25

II

53

-

-

62

m

0,9

III

54

-

-

56

w

0,43

III

55

-

-

40

m

2,1

III

56

-

-

84

w

3,7

III

57

-

-

56

w

0,8

IV

58

-

-

63

m

0,62

I

59

-

-

60

m

4,22

III

60

-

-

83

w

n.b.

III

61

-

-

62

-

-

63

-

-

64

-

-

65

-

-

66

-

-

67

-

-

68

-

-

69

-

-

70

-

-

71

-

-

72

-

-

73

-

-

74

-

-

75

-

-

76

-

-

78

-

-

79

-

-

80 bis 100

negativ Kontrollen, Allopeziepatienten

101

AA

-

-

62

m

n.b

IV

102

AB

+

-

68

m

1,1

IV

103

AC

-

-

69

w

n.b

IV

104

AD

-

-

55

w

n.b

III

105

AF

-

-

56

w

n.b

IV

106

AG

-

-

39

m

1

IV

107

AH

-

-

80

w

0,64

IV

108

AI

-

-

44

w

n.b

IV

109

AJ

-

-

47

m

n.b

IV

110

AK

+

-

46

m

10

IV

111

AL

+

-

63

m

5

IV

112

AM

-

-

113

AN

-

-

114

AO

-

-

116

AQ

+

-

117

AR

-

-

118

AS

-

-

119

AT

-

-

120

AU

-

-

121

AV

-

-

122

AW

-

-

123

AX

-

-

25 Seren normaler Blurspender

negativ Kontrollen

+ positive Reaktion, +/- schwache Reaktion, - keine Reaktion, n.b. nicht bestimmt,

1 Alter bei der ersten Tumordiagnose, 2 Tumordicke in mm, 3 Stadium nach AJCC 2001 (siehe Einleitung Seite 18)

IV. Alignment der sequenzierten PCR-Transkripte von HERV-K

A Volllängen Transkripte

Verwendete HERV-K aus der NCBI DatenBank: HERV-K 101, 103, 113 und 115 (Accrnrs. AF164609, AF164611, AY037928 und AY037929), HERV-K HML2.HOM (Accnr. AF074086), HERKLTGAG (Accnr. Y08032) und HERV-K C7 (Accnrs. Y17832).

B Env Transkripte

Verwendete HERV-K env-mRNA aus der NCBI DatenBank: HERV-K 113 env (Accrnr. AY037928), HERV-K MERV env (Accnr. DQ058015) und HERV-K env (Accnr. M14123)

V. Plasmidkarten

pMAL HERV-K TM/gp36

Aminosäuresequenz des translatierten Fusionsproteins:
NH2MKIKTGARILALSALTTMMFSASALAKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGIEGRISEFGSTSNGRQCAGIRLGSGVALHSSVQSVNFVNDWQKNSTRLWNSQSSIDQKLANQINDLRQTVIWMGDRLMSLEHRFQLQCDWNTSDFCITPQIYNESEHHWDMVRHHLQGREDNLTLDISNLKEQIFEASKPILNLVPGTEAIAGVADGLANLNPVTWVKTIGSTT-COOH

* bezogen auf HERV-K HML2.HOM; Accnr.Q69384
Die Klonierung erfolgte mit den Primern rekTM-forward und rekTM-reverse; Seite I
pMAL c2X: New England Biolabs

pCALn HERV-K/Np9

Aminosäuresequenz des translatierten Fusionsproteins:
NH2MKRRWKKNFIAVSAANRFKKISSSGALLVPRGSMNPSEMQRKGPPRRCLQVYPTAPKRQRPSRTGHDDDGGFVEKKRGKCGEKQERSDCYCVCVERSRHRRLHFVMC-COOH

* bezogen auf HERV-K; Armbrüster et al. (2002)
Die Klonierung erfolgte mit den Primern np9-G und np9-H; Seite I
pCALn: Stratagene

pHygEGFP (BD Bioscience, Palo Alto, CA, USA)

pCR4®-TOPO® (Invitogen)


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
01.12.2006