2 Materialien

2.1  Kits

↓24

BigDyeTM Terminator Sequencing Kit

Perkin Elmer, Vaterstetten, BRD

cDNA Synthese Kit

GibcoBRL, Eggenstein, BRD

Gene Images Kit

Amersham, Cleveland, Ohio, USA

MessageMakerTM Kit

 

GibcoBRL, Eggenstein, BRD

 

Plasmid Mini Purification Kit

Qiagen, Hilden, BRD

QIAprep 96 Turbo Miniprep Kit

Qiagen, Hilden, BRD

QIAquick Gel Extraction Kit

Qiagen, Hilden, BRD

Thermo Sequenase Sequencing Kit

Amersham, Cleveland, Ohio, USA

Trizol Reagenz

GibcoBRL, Eggenstein, BRD

2.2 Vektoren und Bakterien

↓25

pZErO TM - Vektor

Invitrogen, San Diego, CA, USA

XL1-Blue MRF Bakterien

Stratagene, La Jolla, CA, USA

2.3 Enzyme

DyNAzyme TM

Biometra, Maidstone, UK

Klenow

Pharmacia, Uppsala, Sweden

Restriktionsendonukleasen und Puffer

NEB, Beverly, MA, USA

T4 Ligase und Puffer

GibcoBRL, Eggenstein, BRD

Taq-Polymerase

Perkin Elmer, Vaterstetten, BRD

2.4 Chemikalien und weitere Stoffe

Acrylamid

Serva, Heidelberg, BRD

AG 501 X-8 - Harz

BioRad, Richmond, CA, USA

Agarose

Sigma, St. Louis, MO, USA

Ammoniumacetat

Merck, Darmstadt, BRD

Ampicillin

Sigma, St. Louis, MO, USA

APS (Ammoniumpersulfat)

Serva, Heidelberg, BRD

ß-Mercaptoethanol

Sigma, St. Louis, MO, USA

Bisacrylamid

Roth, Karlsruhe, BRD

Borsäure

Roth, Karlsruhe, BRD

Bromphenolblau

Sigma, St. Louis, MO, USA

BSA (bovines Serumalbumin)

Sigma, St. Louis, MO, USA

Chloroform

Merck, Darmstadt, BRD

Calciumclorid

Sigma, St. Louis, MO, USA

DEPC (Diethylpyrocarbonat)

Sigma, St. Louis, MO, USA

Dinatriumhydrogenphosphat

Sigma, St. Louis, MO, USA

DMSO (Dimethylsulfoxid)

Sigma, St. Louis, MO, USA

DNS Größenstandards (1kb und 100bp)

GibcoBRL, Eggenstein, BRD

Dynabeads

Dynal, Oslo, Norge

Eisessig

Baker, Phillipsburg, NJ, USA

Ethanol

Merck, Darmstadt, BRD

Ethidiumbromid

Sigma, St. Louis, MO, USA

Glucose

Sigma, St. Louis, MO, USA

Glycerin

Merck, Darmstadt, BRD

Glycogen

Böhringer Mannheim, Mannheim, BRD

Glyoxallösung (40%)

BioRad, München, BRD

Isopropylalkohol

Sigma, St. Louis, MO, USA

Harnstoff

Roth, Karlsruhe, BRD

Hefeextrakt

GibcoBRL, Eggenstein, BRD

IPTG

Merck, Darmstadt, BRD

Kaliumchlorid

Merck, Darmstadt, BRD

Kaliumdihydrogenphosphat

Sigma, St. Louis, MO, USA

Lacto Tryptone

GibcoBRL, Eggenstein, BRD

LB-Flüssigmedium (Luria Broth Base)

GibcoBRL, Eggenstein, BRD

Luria Agar

GibcoBRL, Eggenstein, BRD

Magnesiumchlorid

Merck, Darmstadt, BRD

Magnesiumsulfat

Sigma, St. Louis, MO, USA

Maltose

Sigma, St. Louis, MO, USA

Mineralöl

Perkin Elmer, Vaterstetten, BRD

Na2EDTA (Ethylendiamintetraacetat)

Serva, Heidelberg, BRD

Natriumchlorid

Roth, Karlsruhe, BRD

Natriumdihydrogenphosphat

Sigma, St. Louis, MO, USA

Natriumdodecylsulfat (SDS)

Sigma, St. Louis, MO, USA

Natronlauge

Merck, Darmstadt, BRD

Phenol

Invitrogen, San Diego, CA, USA

Phenol:Cloroform:Isoamylalkohol (25:24:1)

GibcoBRL, Eggenstein, BRD

RNS Größenstandard

GibcoBRL, Eggenstein, BRD

Salzsäure

Baker, Phillipsburg, NJ, USA

Sucarose

Sigma, St. Louis, MO, USA

SYBR Green I

Molecular Probes Inc.,Eugene, OR, USA

TEMED (N, N, N‘, N‘-Tetramethylethylendiamin)

Serva, Heidelberg, BRD

Tetrazyklin

Sigma, St. Louis, MO, USA

Thiamin-HCl

Sigma, St. Louis, MO, USA

Trinatriumcitrat-Dihydrat

Merck, Darmstadt, BRD

Tris Base

Roth, Karlsruhe, BRD

Tris HCl

Roth, Karlsruhe, BRD

Tween 20

Sigma, St. Louis, MO, USA

Zeozin

Invitrogen, San Diego, CA, USA

2.5 Puffer, Lösungen und Medien

↓26

Die verwendeten Puffer, Lösungen und Medien und ihre Herstellung sind in Tabelle 3 dokumentiert.

Tabelle 3. Puffer und Lösungen.

Lösung

Herstellung

2 x B&W Puffer

10 mM TrisHCl (pH 7,5), 1 mM EDTA und 2 M NaCl in Aqua bidest. lösen und bei Raumtemperatur lagern.

DEPC - Wasser

0,1% Diethylpyrocarbonat in Aqua bidest für 24 Stunden inkubieren und anschließend autoklavieren.

DNS-Probenpuffer

0,25% Bromphenolblau und 40% Sucrose in Wasser, Lagerung bei 4°C.

Ethidiumbromid

10 mg/ml Stocklösung, Lagerung bei 4°C.

Glyoxal

40%ige Glyoxallösung (6M) mit AG 501 X-8 (Biorad, Richmond, CA, USA) deionisieren bis der pH größer als 5 ist Lagerung der Aliquots bei -20°C.

LB-Agar-Platten mit geringer

Salzkonzentration und Zeocin™

10g Trypton, 5g Hefeextrakt und 5g NaCl in 950ml Aqua bidest. lösen. Den pH-Wert mit 5M NaOH auf 7,5 einstellen, 15g Agar zugeben und das Volumen auf 1 l ergänzen. Nach Autoklavierung den Agar auf 50°C abkühlen lassen und 500µl Zeocin™ (Stockkonzentration: 100mg/ml) sowie IPTG (Endkonzentration: 1 mM) zugeben.

LB (Luria - Bertani) - Medium

1 x LB-Lösung vor Gebrauch ansetzen (25 g auf 1 l H2O) und sofort autoklavieren.

LoTE

3 mM TrisHCl (pH 7,5) und 0,2 mM EDTA (pH 7,5) in Aqua bidest. lösen und bei 4°C lagern.

Luria Agar - Platten

37 g Agar in 1 l H2O lösen und sofort autoklavieren. Sobald der Agar auf circa 50°C abgekühlt ist, unter der Sterilbank das Antibiotikum hinzugeben und die Platten gießen. Den Agar aushärten lassen und die Platten umgekehrt bei 4°C lagern.

M9 - Medium

6g Na2HPO4, 3g KH2PO4, 1g NH4Cl und 0,5g NaCl mit Wasser auf 1l ergänzen, autoklavieren und auf 50°C abkühlen lassen. 200ml dieses konzentrierten Ansatzes mit sterilem deionisiertem Wasser auf 1l ergänzen. Zugabe von 10ml der Filter-strilisierten Mischung von 2ml MgSO4 (1M), 2g Glucose, 0,1ml CaCl2 (1M) und 1ml Thiamin-HCl (1M) in Wasser.

M9 Agar - Platten

Vor Zugabe der der Filter-sterilisierten Lösung zu den M9 Salzen zu diesen 15g Agar zugeben und autoklavieren. Später den M9-Agar aushärten lassen und die Platten umgekehrt bei 4°C lagern.

0,1 M Natriumphosphatpuffer (Northern - Blot)

4,23 ml 1M NaH2PO4 und 5,77 ml 1M Na2HPO4 mit Aqua bidest. auf 100 ml auffüllen, den pH kontrollieren und autoklavieren.

PC8

480 ml Phenol (65°C warm), 320 ml 0,5M Tris-HCl (pH 8) und 640 ml Chloroform ansetzen und schütteln. Für 2 bis 3 Stunden bei 4°C kühlen. Erneut schütteln und nochmals für 2 bis 3 Stunden bei 4°C kühlen. Wässrige Phase entfernen. Aliquotieren und bei -20°C lagern.

10 x PCR Puffer

166 mM (NH4)2SO4, 670 mM Tris (pH 8,8), 67 mM MgCl2 und 100 mM B-Mercaptoethanol ansetzen. In 0,5 ml Portionen aliquotieren und bei -20°C lagern.

20 x SSC

175,3 g NaCl (entspricht 3 M) und 88,2 g Na3Citrat.H2O (entspricht 0,3 M) in 800 ml Aqua bidest lösen, den pH auf 7,0 einstellen und auf 1000 ml auffüllen.

SOB - Medium

20 g Trypton, 5 g Hefeextrakt und 0,5 g NaCl in 950 ml Aqua bidest. lösen. 10 ml einer 250 mM KCL Stock-Lösung (1,86 g KCL in 100 ml Wasser) zugeben. pH Einstellung mit 5 M NaOH auf 7,5 und Ergänzung des Volumens auf 1 l. Autoklavieren, auf circa 55 °C abkühlen lassen und 10 ml sterile 1 M MgCl2 zugeben. Falls erforderlich, ein Antibiotikum (zum Beispiel Zeocin einer Endkonzentration von 50 µg/ml oder Tetrazyklin einer Endkonzentration von 12,5µg/ml) zugeben. Bei 4°C lagern.

SOC - Medium

Zum 1l SOB Medium (ohne Antibiotikum) 7,2ml 50% Gluose hinzugeben.

50 x TAE Puffer

242g Tris Base, 57,1ml Eisessig und 100ml 0,5 M EDTA (pH 8) mit Aqua bidest auf 1l ergänzen und autoklavieren.

5 x TBE Puffer

54g Tris base, 27,5g Borsäure und 20ml 0,5M EDTA (pH 8) mit Aqua bidest auf 1l ergänzen und autoklavieren.

TE - Puffer (pH 8)

10mM Tris (pH 8) und 1mM EDTA (pH 8) und autoklavieren.

1 M Tris HCl

121,g Tris Base auf 1 l H2O vor dem Auffüllen mit konzentrierter HCl den pH einstellen: für einen pH von 7,4 mit 70ml HCl, für

einen pH von 7,6 mit 60ml HCl und für einen pH von 8 mit 42ml HCl.

YT - Medium mit Zeocin™

Um 1l dieses Mediums herzustellen, wurden 8g Trypton, 5g Hefeextrakt und 2,5g NaCl in 900ml Aqua bidest. gelöst. Nach Einstellung des pHs auf 7,5 mit 5M NaOH wurden 15g Agar zugegeben und das Volumen auf 1l ergänzt. Nach der Autoklavierung den Agar auf 50°C abkühlen lassen und 500µl Zeocin™ (Stockkonzentration: 100mg/ml) zugeben.

2.6 Nukleotide, Linker und Primer

Die verwendeten (Oligo)Nukleotide sind in Tabelle 4 dokumentiert.

↓27

Tabelle 4. Nukleotide, Linker und Primer.

Nukleotid

Sequenz (5' - 3')

Position

Literatur

Firma

dNTP (beziehungs-weise dATP, dCTP, dGTP, dTTP)

Einzelnukleotide

-

-

Amersham, Cleveland, Ohio, USA

7-deaza-dGTP

-

-

-

Boehringer Mannheim, Mannheim, BRD

Fluoreszein-12-dUTP

-

-

-

DuPont NEN, Bad Homburg, BRD

Linker 1 A

TTTGGATTTGCTGGTGCAGTACCACTAGGCTTAATAGGGACATG

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Pharmacia, Uppsala, Sweden

Linker 1 B

TCCCTATTAAGCCTAGTTGTACTGCACCAGCAAATCC [mit Aminomodifikation des C7]

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Pharmacia, Uppsala, Sweden

Linker 2 A

TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Pharmacia, Uppsala, Sweden

Linker 2 B

TCCCCGTACATCGTTAGAAGCTTGAATTCGAGCAG [mit Aminomodifikation des C7]

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Pharmacia, Uppsala, Sweden

Primer 1

GGATTTGCTGGTGCAGTACA

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Eurogentec, Seraing,
Belgium

Primer 2

CTGCTCGAATTCAAGCTTCT

keine

Velculescu et al. SAGE - Detailed Protocol 1.0c

Eurogentec, Seraing,
Belgium

M13 Forward Primer (F)

GTAAAACGACGGCCAGT

M13

Velculescu et al. SAGE - Detailed Protocol 1.0c

ABI Perkin Elmer, Vaterstetten, BRD

M13 Reverse Primer (R)

GGAAACAGCTATGACCATG

M13

Velculescu et al. SAGE - Detailed Protocol 1.0c

ABI Perkin Elmer, Vaterstetten, BRD

AKAP B5IAT7 Rev

TTGTGTTGTAGCTGTCTACCCACTG

Akap149 (2828 - 2804)

EMBL Database

Acc. No. X97335

MWG Biotech, Ebersberg, BRD

AKAP IIB5EF

CTGAACCTCACCAATATCTACGCTC

Akap149 (2156 - 2180)

EMBL Database

Acc.No. X97335 (Trendelen-burg et al. (1996)

MWG Biotech,

Ebersberg, BRD

2.7 Geräte und Hilfsmaterial

• 3MM

Papier Whatman, Maidstone, UK

 

• ABI 373A Sequenzierautomat

Perkin Elmer, Vaterstetten, BRD

ALFexpress Sequenzierautomat

Pharmacia, Uppsala, Sweden

• Autoklav Varioklav

H + P Labortechnik, Oberschleißheim, BRD

• Brutschrank B5060 EC-CO2

Haereus, München, BRD

• Elektroporationsapparat E.coli Pulser

BioRad, Richmond, CA, USA

• Fotopapier Color Video Print Typ S

Hitachi, Tokyo, Japan

• Gelelektrophoreseapparatur horizonal

BioRad, Richmond, CA, USA

• Gelelektrophoreseapparatur vertikal PSD9S

PEQLABS, Erlangen, BRD

• Gewebshomogenisator

Falcon, Heidelberg, BRD

• Inkubator 60°C-200°C U 40

Memmert, Schwabach, BRD

• Inkubator Plus II

Gallenkamp, Loughborough, UK

• Küvetten für E.coli Pulser

BioRad, Richmond, CA, USA

• Medienflaschen

Falcon, Heidelberg, BRD

• Mikrowelle

Bosch, BRD

• Nylonmembran

Böhringer Mannheim, Mannheim, BRD

• PCR Theromcycler (Trio-Thermoblock)

Biometra, Maidstone, UK

• Petrischalen

Falcon, Heidelberg, BRD

• Pipetten

Labsystems, Helsiniki, Finland

• Photoapparatur / Kamera CU-5/75mm

Polaroid, Hertfordshire, UK

• Reaktionsgefäße 1.5, 2, 15ml

Eppendorf, Hamburg, BRD

• Reaktionsgefäßschüttler 5432

Eppendorf, Hamburg, BRD

• Röntgenfilme

Kodak, Stuttgart, BRD

• Schüttler REAX 2000

Heidolph, Schwabach, BRD

• Schüttelwasserbad Polytest 20

Bioblock Scientific, Illkirch Cedex, France

• Spektralphotometer PM 4

Zeiss, Jena, BRD

• Sterilbank Bio48

Faster, Berlin, BRD

• SYBR Green Filter

Molecular Probes Inc., Eugene, OR, USA

• Tischzentrifuge Typ 1 - 13

Sigma, St. Louis, MO, USA

• Ultrazentrifuge Centricon T2050

Kontron, Zürich, CH

• UV-Bildschirm

Bioblock Scientific, Illkirch Cedex, France

• Waage

Eppendorf, Hamburg, BRD

• Zentrifugationssäulen (SpinX)

Costar Inc., Cambridge, MA, USA

• Zentrifuge 5804 R

Eppendorf, Hamburg, BRD

2.8 Computer und Software

Zur Erstellung der vorliegenden Arbeit wurde ein PC (Network) mit Intel Pentium II Prozessor (300MHz) verwendet.

↓28

Folgende Programme wurden eingesetzt:

MS Office 1997 / 2000 Professional Edition

Microsoft, Redmond, USA

SPSS Version 10.0

SPSS GmbH, München, BRD

S-Plus Version 6.0

Insightful, Seattle, WA, USA

SAGE 300 Version 3.01

Baltimore, MD, USA (Zhang et al. 1997)

SAGEstat

Amsterdam, Niederlande (Kal et al. 1999)

Primer 1.01

Scientific & Educational Software, Durham, NC, USA

Mathematica 4.1

Wolfram Research Europe, Oxfordshire, UK


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
23.08.2006