[Seite 32↓]

3  Material und Methoden

3.1 Populationen

3.1.1 Multizentrische Allergie Studie (MAS-90)

Die deutsche Multizentrische Allergiestudie (MAS-90) wurde initiiert, um den Voraussagewert verschiedener klinischer und immunologischer Parameter sowie den Einfluss von Umweltfaktoren auf die Entwicklung von atopischen Krankheiten in früher Kindheit zu untersuchen.

Fünf deutsche Städte (Berlin, Düsseldorf, Freiburg, Mainz und München) waren das Einzugsgebiet für die Rekrutierung von Neugeborenen für diese prospektive Studie. 1314 von 7609 Neugeborenen, die im Zeitraum zwischen dem 1.1.1990 und dem 31.12.1990 geboren wurden, wurden in die Geburtskohorte aufgenommen. 499 Kinder (38%) wurden als Patienten mit einem hohen Risiko für Atopie eingestuft. Sie hatten mindestens zweiatopische Familienmitglieder und/oder wiesen eine IgE-Konzentration im Nabelschnurblut größer als 0,9 kU/l auf. Die Kinder der Kontrollgruppe (815 Kinder = 62%) wurden unter den verbliebenen Neugeborenen zufällig ausgewählt. Sie hatten entweder einen oder keinen Atopiker in der nahen Verwandtschaft und einen Nabelschnurblut-IgE-Wert kleiner als 0,9 kU/l. Eltern wurden als Atopiker definiert, wenn sie über eines der folgenden Symptome beziehungsweise eine der folgenden Krankheiten berichteten: Atopisches Ekzem, allergische Rhinitis, Asthma, Nahrungsmittelunverträglichkeit, Pollen-, Hausstaubmilben-, Katzenhaar-, Hundehaar- oder Schimmelpilzallergie.


[Seite 33↓]

Abb. 10: Studiendesign und Auswahl der Neugeborenen in der Multizentrischen Allergie Studie.

Die Kinder der Kohorte kamen regelmäßig mit ihren Eltern zu Nachuntersuchungen jeweils im Lebensalter von einem Monat, drei Monaten, sechs Monaten, 12 Monaten, 18 Monaten, 24 Monaten und anschließend einmal jährlich. Die Untersuchungen beinhalteten:

Fragebogen und Interview: Die Eltern füllten einen Fragenkatalog aus und antworteten auf gezielte Fragen zu Atopie-spezifischen Symptomen und Erkrankungen seit der letzten Untersuchung. Außerdem wurden Fragen zur Ernährung, Entwicklung des Kindes, zu Umweltfaktoren (Zigarettenrauch, Haustiere), zur häuslichen Situation und zu psychologischen Problemen gestellt. Die MAS-Fragebögen und Interviews wurden auf der Grundlage der ISAAC (International Study on Asthma and Atopy in Childhood)-Fragebögen entwickelt [71].

Körperliche Untersuchung: Bei jedem Termin wurde eine standardisierte körperliche Untersuchung durchgeführt. Dabei war ein Schwerpunkt die standardisierte Dokumentation von Hautläsionen.


[Seite 34↓]

Blutentnahme: Im Serum der Kinder wurden im Alter von 1, 2, 3, 5, 7 und 10 Jahren Gesamt-IgE- und spezifische IgE-Antikörperkonzentrationen gegen neun gängige Nahrungsmittel- und Inhalationallergene bestimmt. Die spezifischen IgE-Antikörper gegen Hühnerei, Kuhmilch, Sojabohnen, Weizen, Hausstaubmilben, Katzenhaare, Gräsergemisch und Birkenpollen wurden mit einem Radioallergosorbent Fluorenscence Immunoassay (CAP-RAST-FEIA, Pharmacia and Upjohn, Freiburg) bestimmt. Die IgE-Werte wurden für die statistischen Analysen log-transformiert, um eine Gauss’sche Verteilung zu erreichen.

Aus EDTA-Blut wurde die genomische DNA extrahiert. Insgesamt steht die genomische DNA von 888 Kindern sowie 1231 Eltern zur Verfügung. Insgesamt ergaben sich 382 komplette Trios (Mutter, Vater, Kind).

Lungenfunktionsuntersuchung: Lungenfunktionstests bei den Kindern wurden an allen deutschen Zentren mit dem gleichen Ganzkörperplethysmographen (Master-Lab, E Jäger, Würzburg) durchgeführt. Bestimmt wurden das forcierte expiratorische Volumen der ersten Sekunde (FEV1) und die forcierte Vitalkapazität (FVC).

Ein pharmakologischer Provokationstest wurde mit Histamin-dihydrochlorid in aufsteigenden Dosen durchgeführt. Die Ausgangsdosis betrug 0,125 g/l Histamindihydrochlorid, anschließend wurden immer höhere Dosen (0,5 g/l; 2,0 g/l; 8,0 g/l) verabreicht, bis der Patient dies nicht mehr tolerierte oder die FEV1 um mehr als 20% absank. Die Histaminkonzentration, die einen Abfall der FEV1 von 20% bewirkte (PC20FEV1), wurde durch lineare Interpolation der beiden letzten Messwerte berechnet. Wurde schon nach der Anfangskonzentration ein Abfall von mindestens 20% verzeichnet, wie es bei 5% der Studienteilnehmer der Fall war, so wurde der Nullwert als erster Datenpunkt verwendet. Wenn die Maximaldosis von 8,0 g/l nicht ausreichte, um einen 20% Abfall zu bewirken, wurde diese Dosis für die Berechnung verwendet.


[Seite 35↓]

Staubanalysen: Teppichstaubproben der häuslichen Umgebung wurden im Alter von 6 und 18 Monaten, 3 Jahren, 4 Jahren, 5 Jahren auf die wichtigsten Innenraumallergene überprüft: Hausstaubmilben, Katzen- und Hundehaar.

Abb. 11: Untersuchungen von Geburt bis zum siebten Lebensjahr bei den Kindern der MAS-Kohorte.

Bei der Untersuchung am siebten Geburtstag (± sechs Wochen), nahmen noch 939 (71,5%) der Kinder teil. Die Phänotypen der allergischen Erkrankungen wurden wie folgt definiert:

Als Asthmatikergalt ein Kind bei mindestens zwei aufgetretenen Episoden von pfeifender Atmung mit Luftnot.

Das atopisches Ekzem wurde bei einer Kombination von mindestens drei typischen Hautveränderungen an drei typischen Körperstellen diagnostiziert.

Allergische Rhinitis im Alter von 7 Jahren wurde definiert als Auftreten von [Seite 36↓]Niesattacken und/oder einer laufenden, verstopften, juckenden Nase ohne Erkältung während der letzten 12 Monate. Zusätzlich mussten spezifische IgE-Antikörper (≥0,7 kU/l) gegen Gras- und/oder Birken-Pollen vorliegen.

Ein Kind galt als sensibilisiert, wenn der spezifische IgE-Wert bei mindestens einem von neun Hauptallergenen (Milbe, Hund, Katze, Kuhmilch, Ei, Soja, Weizen, Birke, Gras) ≥0,7 kU/l betrug.

Mütterliches Rauchen wurde als Tabakrauchexposition des Kindes gewertet, da Mutter und Kind sich normalerweise in enger räumlicher Nähe zueinander befinden. Pränatale Exposition wurde als mütterliches Rauchen während der Schwangerschaft definiert und von postnataler Exposition ausgegangen, wenn die Mutter bei ≥ 2 der ersten drei Nachfolgetermine angab zu rauchen oder zu ≥ 4 Zeitpunkten der insgesamt 7 Untersuchungen. Uneindeutige Angaben wurden als fehlend definiert.

3.1.2 Barbados-Population

K. Barnes rekrutierte zwischen 1993 bis 2002 783 Individuen auf Barbados (Karibische Inseln). Die Population setzt sich aus Asthmatikern und deren unmittelbaren Verwandten zusammen. 13-20% der gesamten Bevölkerung von Barbados leiden unter Asthma. Der Anteil an Atopikern wird noch höher geschätzt. Barnes und andere haben bei der Bevölkerung von Barbados eine extrem hohe mittlere Gesamt-IgE-Konzentration gefunden, die die hohe Allergenexposititon in dieser tropischen Umgebung widerspiegelt. Das Hauptallergen der Hausstaubmilbe Dermatophagoides pteronyssinus beispielsweise liegt mit 60 µg/g Hausstaub [72] rund 30 mal höher als die „Risikokonzentration“ in den USA bzw. Europa [73]. Die exzessive Exposition erhöht die Wahrscheinlichkeit, dass genetisch prädisponierte Individuen atopische Erkrankungen ausbilden. Es gibt keine parasitären Erkrankungen auf Barbados, die die hohen IgE-Werte erklären könnten. 7% der Barbados Population rauchen, unter den Asthmatikern sind nur 5% Raucher. Alle Kernfamilien wurden über einen Asthma-Probanden ausgewählt. Die Asthmatiker wurden systematisch aus der Notaufnahme des Queen Elizabeth [Seite 37↓]Hospitals oder aus Arztpraxen auf der Basis von folgenden Einschlusskriterien ausgewählt: Erstens sollten sie älter als sechs Jahre alt sein, zweitens sollte eine ärztliche Diagnose Asthma gestellt worden sein und drittens sollten beide Elternteile verfügbar sein oder bei einem fehlenden Elternteil verfügbare Geschwister, um den fehlenden Genotyp abzuleiten. Es wurden alle Kernfamilienmitglieder eingeschlossen und wenn möglich, der Stammbaum so weit wie möglich ausgedehnt.

3.1.3 Freiburger Asthma-Population

250 Kinder mit Verdacht auf Asthma im Alter von 5 bis 18 Jahren (Mittelwert=10,8 Jahre) aus dem Einzugsgebiet von Freiburg wurden in der Kinderklinik des Universitätsklinikums Freiburg untersucht. Es wurde eine standardisierte Untersuchung durchgeführt, die Fragebögen zu klinischen Symptomen und Medikation, die Bestimmung von totalem und spezifischem IgE, Pricktests, Lungenfunktionstests, bronchiale Histaminprovokationen sowie die Bestimmung des belastungsabhängigen Abfalls des FEV1-Wertes mittels Laufbandbelastung beinhaltete. Die Teilnehmer wurden angewiesen, frühzeitig die Asthma- bzw. Allergiemedikation vor der Untersuchung abzusetzen. Die Probanden wurden mit Pricktests durch intrakutane Gaben von 17 häufigen Allergenen (Hausstaubmilben, verschiedene Gräser- und Baumpollen, Aspergillus fumigatus, Alternaria alternata, Cladosporium herbarum, Hund, Katze, Hase, Ente und Pferd) zusammen mit Positiv- (Histamin) und Negativkontrollen getestet. Der Durchmesser der resultierenden Schwellung wurde nach 15 Minuten bestimmt. Der Pricktest wurde als positiv gewertet, wenn die Schwellung mindestens halb so groß wie die der Positivkontrolle war.

Spezifische IgE-Antikörperkonzentrationen wurden mit einem enzymgekoppelten Immunosorbent Assay gegen zwei Mischungen von Gräserpollen, Milbenallergenen (Dermatophagoides pteronyssinus und Dermatophagoides farinae), Katze, Hund, Haselnuss, und Birkenpollen bestimmt (Magic Lite, Chiron Diagnostics, Fernwald). Ein Test galt bei ≥1,43ML [Seite 38↓]Units als positiv. Die Gesamt-IgE-Konzentration wurde mit Hilfe eines Enzym Allergosorbent Test (Phadezym, Pharmacia, Uppsala, Schweden) gemessen.

Die Lungenfunktion und Histaminprovokation wurden nach einem dem der MAS-Studie vergleichbaren Standardprotokoll durchgeführt. Um belastungsinduzierte FEV1-Abfälle zu evaluieren, wurden die Probanden 6 Minuten lang standardisiert körperlich belastet (Laufband). Die erste spirometrische Messung und Peak flow-Bestimmung wurden 2-3 Minuten und die zweite Messung 5-6 Minuten nach der Belastung durchgeführt.

Die Diagnose eines Asthma bronchiale stützte sich auf asthmatische Symptome, den Gebrauch von antiasthmatischen Medikamenten sowie einer nachgewiesenen BHR (Histaminprovokation und/oder Laufbandbelastung).

3.2 Materialien

3.2.1 Geräte


[Seite 39↓]

Wasserbad

GFL 1086, Gesellschaft für Labortechnik, Burgwedel

Zentrifugen

Varifuge RF, Heraeus Sepatech,

 

HanauCentrifuge 5415D, Eppendorf AG, Hamburg

Pipetten

Eppendorf Multipette plus, Eppendorf AG, Hamburg

 

3,5ml Transferpipette, Sarstedt AG & Co, Nümbrecht

 

Eppendorf Research Pipetten 0,5-10µl;10-100µl; 100-1000µl, Eppendorf AG, Hamburg

 

Multichannel Finnpipette 5-50µl, Thermo Labsystems, Egelsbach

 

Finnpipette 40-200µl Thermo Labsystems, Egelsbach

Photometer

Biophotometer, Eppendorf AG, Hamburg

PCR-Maschinen

Tpersonal, Biometra GmbH, Göttingen

 

T3 Thermocycler, Biometra GmbH, Göttingen

Vacuumzentrifuge

Speedvac SVC100, Savant, Framingdale, NY, U.S.A

Vortexer

Minishaker MS1, IKA-Works Inc., Wilmington, NC, U.S.A.

Waage

Mettler PE3000, Mettler Waagen GmbH, Giessen, Schweiz

Mikrowellenherd

MW-715m 1200W, Clatronic GmbH, Kempen

Magnetrührer

Ikamag Ret, IKA-Labortechnik, Staufen

Gelkammern

Sub-Cell GT Mini / Wide Gel Electrophoresis System, Bio-Rad Laboratories Inc., California, USA

Spannungsquelle

PowerPac 300,. Bio-Rad Laboratories Inc., California, USA

UV-Transilluminator

TI 1, Biometra GmbH, Göttingen

Drucker

Digital Grafic Printer UP-D860E, Sony Corp.,Tokio, Japan

Digitale Sofortbildkamera

MWG Biotech, Ann Arbor, MI, U.S.A

LightCycler

LightCycler II, Roche Diagnostics GmbH, Mannheim

Kapillarzentrifuge

LC Carousel Centrifuge, Roche Diagnostics GmbH, Mannheim

LightCycler Software

Version 3.5, Roche Diagnostics GmbH, Mannheim

PC

Vectra, Hewlett Packard GmbH, Waldbronn

Drucker

Deskjet 970CXI, Hewlett Packard GmbH, Waldbronn

Bildschirm

P1110, Hewlett Packard GmbH, Waldbronn

3.2.2 Verbrauchsmaterialien

Blutabnahmeröhrchen

EDTA Monovetten, Sarstedt AG & Co., Nümbrecht

DNA-Extraktionskit

QIAamp DNA Midi Kit, Qiagen GmbH, Hilden

Konische Polystyrolröhrchen

Falcon 15ml u. 50ml, Bexton Dickinson Labware, Meylan Cedex, Frankreich

Reaktionsgefäße

Safe-Lock Microcentrifuge Tubes 1,5ml, Eppendorf AG, Hamburg

 

Qiagen Collection Tubes 15ml, Qiagen GmbH, Hilden

 

Tubes 4ml 75x11,5mm, Sarstedt AG & Co., Nümbrecht

Pipettenspitzen

Combitips plus 2,5ml u. 10ml, Eppendorf AG, Hamburg

 

Eurotips in Racks 100µl u. 1000µl , Eppendorf AG, Hamburg

 

10µ, 100µl, 1000µl, Sarstedt AG & Co., Nümbrecht

UV-Küvetten

Kuvette 220-1600nm, Eppendorf AG, Hamburg

Mikrotiterplatten

96-well Format, Greiner Bio-one GmbH, Frickenhausen

Handschuhe

SatinPlus Exam Gloves, Safeskin GmbH, Neufahrn

 

Nitrile Exam Gloves, Safeskin GmbH, Neufahrn

PCR-Reaktionsgefäße

PCR Tubes ultradünn 0,2ml Strips a 8 Tubes u. Caps, Biozym Diagnostik GmbH, Hess. Oldendorf

 

PCR Softstrips 0,2ml Strips a 8 Tubes u. Caps, Biozym Diagnostik GmbH, Hess. Oldendorf

 

Multiply-Pro Cap 0,2ml, Sarstedt AG & Co., Nümbrecht

Parafilm

American National Can, Menaska, WI, U.S.A

Mikrotiterplatte

Nunc, Roskilde, Dänemark

LightCycler Kapillaren

Capillaries, Roche Diagnostics GmbH, Mannheim


[Seite 40↓]

3.2.3 Reagenzien und Chemikalien

Ethanol, absolut (100%)

Merck KgaA, Darmstadt

Steriles Wasser

Aqua ad injectabile, Braun, Melsungen

Agarose

Agarose Ultrapure, GibcoBRL, Paisley, Schottland

PCR-Öl

Bayol F, Serva, Heidelberg

3.2.4 Puffer und Lösungen

TBE-Puffer

10x Tris-Borat-EDTA-Puffer, pH8,3 Merck KgaA, Darmstadt

Probenauftragspuffer

10x DNA-Probenpuffer: 200mM EDTA (pH8,2), Sigma, Steinheim

 

50 Vol.% Glyzerin C3H8O3 (87%), Carl-Roth GmbH, Karlsruhe

 

0,25% Bromphenolblau, Carl-Roth GmbH & Co., Karlsruhe

 

0,25% Xylencyanol FF, Sigma Chemical Inc., Steinheim

Ethidiumbromid 1%

Carl-Roth GmbH & Co., Karlsruhe

3.2.5 Enzyme und zugehörige Puffer

Taq-Polymerase

5U/µl, AmpliTaq Gold, Applied Biosystems, Roche, Mannheim

PCR-Puffer

10x PCR buffer (+15mM MgCl2), Applied Biosystems, Roche, Mannheim

dNTPs

dNTPs, je 2,5mM, Applied Biosystems, Roche, Mannheim

DNA-Leiter

100bp DNA-ladder, 0,1 µg/µl, Invitrogene GmbH, Karlsruhe

BPU1102 (CelII)

10u/µl, Amersham Pharmacia, Buckinghamshire, England

BPU-Puffer

20mM Tris-HCl (pH8,2), 10mM MgCl2, 60mM NaCl, 1mM DTT, 0,1% BSA, Amersham, Pharmacia, Buckinghamshire, England

3.2.6 Primer und Sonden

PCR-Primer

10µM, TIBMOLBIOL, Berlin

Sonden

5µM, TIBMOLBIOL, Berlin


[Seite 41↓]

3.3  Methoden

3.3.1 Gewinnung der Blutproben und Extraktion der genomischen DNA

Die durch Venenpunktion gewonnenen Blutproben wurden in EDTA-Röhrchen abgenommen und bei –20°C gelagert. Zur Extraktion der genomischen DNA aus Vollblut wurde der QIAamp DNA Midi Kit von QIAGEN nach dem Arbeitsprotokoll des Herstellers verwendet: 2 ml EDTA-Blut wurden in ein Reagenzröhrchen überführt, mit 200 μl QIAGEN Proteaselösung und 3 ml Puffer AL gründlich gemischt und für 20 Minuten bei einer Temperatur von 70°C in einem Wasserbad inkubiert. Nach dem Hinzufügen von 2 ml Ethanol (100%) wurde das Gemisch über eineQIAamp Midi Säule für 3 Minuten bei 3000 rpm (~1850g) in zwei Arbeitsschritten zentrifugiert. Das Filtrat wurde verworfen und die Säule mit 2 ml Puffer AW1 beladen und für 1 Minute bei 5000rpm zentrifugiert. Entsprechend wurde die Säule mit Puffer AW2 beladen und für 15 Minuten zentrifugiert. Mit 300µl Puffer AE wurde die an die Säule gebundene DNA durch Zentrifugation für 5 Minuten mit 5000 rpm eluiert und in Reaktionsgefäße überführt. Alle Zentrifugationsschritte fanden bei Raumtemperatur statt. Die Lagerung der DNA erfolgte bei –20°C und –80°C.

3.3.2 Photometrische Bestimmung der DNA-Konzentration

Die DNA-Konzentration der aufgereinigten Proben wurde mittels UV-Photometrie bestimmt. Der Leerwert wurde mit dem gleichen Mischungsverhältnis wie die Probe, d.h. 5 µl AE-Puffer plus 75 µl H2O ermittelt. Die DNA-Lösung wurde mit destilliertem Wasser 1:15 in Greiner 96-well Platten verdünnt (5 µl DNA-Lösung, 75 µl Wasser).

3.3.3 Verdünnung der Proben

Um eine definierte Ausgangskonzentration für die folgenden Arbeitsschritte zu erhalten, wurde aus den Ergebnissen der photometrischen Messung ein Verdünnungsschema berechnet. Die Proben wurden mit einer 1:10-Verdünnung des Elutionspuffers von QIAGEN auf eine einheitliche Konzentration von [Seite 42↓]20 ng/µl gebracht.

3.3.4 Polymerase-Kettenreaktion

Für die Polymerase-Ketten-Reaktion wurden folgende Primer benutzt:

HNMT -(C314T)-SNP

HNMT F:

5’-CAATTAAAATTgATggTgTgTCA

TS=52,7°C

HNMT R:

5’-TTTCTCCAACATTCTACTTTggTA

TS=53,2°C

C5aR -(C245T)-SNP

C5aR F:

5’-AAgAgATggCCCCAAATA

TS=51,2°C

C5aR R:

5’-TTCgAgACTCACCATGTTC

TS=49,8°C

IL4- C-(590T)-SNP

IL-04 A:

5’-ggggCTCCTTCTCTgCATAgA

TS=58,7°C

IL-04 S:

5’-TgggTAAggACCTTATggACCTg

TS=59,7°C

IL13- (Arg130Gln)-SNP

IL13 130 S:

5’-TTTGTAAAGGACCTGCTCTTACA

TS=54,7°C

IL13 130 A:

5’-GCACAGGCTGAGGTCTAAGCTA

TS=57,8°C

IL13- (C-1055T)-SNP

IL13 1055 S:

5’-TGGGGGTTCTGGAGGACT

TS=58,4°C

IL13 1055 A:

5’-AGCCTTAGTCCAGGTCAGAGAT

TS=55,3°C


[Seite 43↓]

IL4RA- (Ser478Pro)- und IL4RA- (Gln551Arg)-SNP

IL4RA 478.551 S:

5’-CAGAGACGCCCCTCGTCAT

TS=59,9°C

IL4RA 478.551 A:

5’-CAGGCTTGAGAAGGCCTTGTAAC

TS=60,5°C

Diese Primer schließen beide SNPs ein.

IL4RA- (Ile50Val)-SNP

IL4RA 50 B:

5’-CATGCTCGCTGGGCTTGAA

TS=61,5°C

IL4RA 50 L:

5’-CCAGCCAGCCTACAGGTGA

TS=59,1°C


[Seite 44↓]

Tab. 3: Protokolle für die Single- bzw. Duplex-PCR-Ansätze. Bei allen PCR-Ansätzen wurde mit der Annealingtemperatur = 52°C gearbeitet.

Die PCR lief unter folgenden Konditionen ab:

Initialer Denaturierungsschritt bei 95°C für 10min

PCR-Zyklus:

Denaturierung

95°C

10sec

Annealing

52°C

30sec

Elongation

72°C

40sec

Es wurde mit 50 Zyklen gearbeitet und nach zweiminütiger Finalelongation auf 4°C abgekühlt.

3.3.5 Restriktionsenzymatische Spaltung

Um den SNP des Kandidatengens C5aR nachzuweisen, wurde das PCR-Produkt mit folgendem Reaktionsansatz bei 37°C für 90 Minuten restriktionsenzymatisch gespalten.


[Seite 45↓]

PCR-Produkt

10,0µl

Aqua

5,65µl

BPU 1103 10u/µl

0,35µl

BSA

2,0µl

BPU-Puffer

2,0µl

 

20,0µl

Die Reaktion wurde mit 1,5µl Probenauftragspuffer gemischt und in Taschen eines 3%-Agarosegels aufgetragen. Die Fragmente wurden gelelektrophoretisch getrennt. Eine Lagerung der Proben zur späteren Verarbeitung wurde bei –20°C vorgenommen.

C/C C/T C/T T/T T/T

Wobei N für eine beliebige Base steht

Abb. 12: Genotypanalyse des C5aR-(C-245T)-SNP verschiedener Individuen mittels PCR-Amplifikation und Restriktionsverdau mit BPU 1103. Das (T245)-Allel wird nicht verdaut. Es resultiert eine Bandenlänge von 301 bp (obere Bande). Liegt das (C245)-Wildtypallel vor, ergeben sich Fragmente mit einer Größe von 258 bp (untere Bande) und 43 bp (nicht zu sehen). Das Enzym BPU 1103 schneidet die Sequenz folgendermaßen:

Wobei N für eine beliebige Base steht


[Seite 46↓]

3.3.6  Gelelektrophorese (C5aR)

Jeweils 10 µl des PCR-Produktes beziehungsweise des Restriktionsansatzes wurden auf einer Mikrotiterplatte mit 1 µl Proben-Auftragspuffer gemischt und in die Taschen eines 3%-Agarosegels pipettiert und in TBE-Puffer elektrophoretisch bei 90 V und 400 mA für 60 min aufgetrennt. Als Marker wurde eine 100 bp-DNA-Leiter verwendet. Die Färbung erfolgte in einer Ethidiumbromidlösung (1 µg/ml) für 10 Minuten, anschließend wurde in einem Wasserbad für 10 Minuten entfärbt. Unter einem UV-Transilluminator mit einer Wellenlänge von 312 nm konnten die aufgetrennten Banden durch Fluoreszenz detektiert und photographiert werden.

3.3.7 LightCycler

3.3.7.1 Aufbau

Der LightCycler besteht aus zwei funktionellen Komponenten, der Thermocycler-Einheit und der Fluoreszenz-Meßeinheit. Das Gerät kann mit Hilfe fluoreszenzmarkierter Oligonukleotidproben sequenzspezifische Fluoreszenz messen. Die Reaktion findet in 32 Glaskapillaren statt, die gleichzeitig als Küvetten für die Fluoreszenzmessung dienen. Eine Hochleistungsleuchtdiode emittiert blaues Licht, das nach Passage eines Filters und eines Kollimators eine Wellenlänge von 470 nm hat und die Proben anregt. Drei unabhängige Photoelemente können Licht der Wellenlängen 530 nm, 640 nm und 710 nm gleichzeitig detektieren.

3.3.7.2 Sonden

Um eine Punktmutation nachzuweisen, werden zwei Oligonukleotidsonden eingesetzt. Die erste Sonde, der sogenannte „Sensor“, bindet an den 5’-Abschnitt der zu untersuchenden Region und ist an seinem eigenen 3’-Ende mit dem Fluorophor Fluoreszin gekoppelt. Die zweite Sonde, der „Anchor“, bindet an den 3’-Abschnitt der spezifischen genomischen DNA und ist entweder mit [Seite 47↓]dem Farbstoff LightCyclerRed-640 oder LightCyclerRed-705 an seinem eigenen 5’-Ende gekoppelt. Binden nun beide Sonden an den Zielabschnitt der genomischen DNA, dann liegen die Farbstoffe in unmittelbarer Nähe zueinander. Wird der „Sensor“-Farbstoff durch die Bestrahlung mit der Leuchtdiode angeregt, kann er die aufgenommene Energie an den „Anchor“-Farbstoff weitergeben, der seinerseits angeregt wird und Licht einer anderen Frequenz emittiert, das vom LightCycler detektiert werden kann. Dieser sogenannte Fluorescence Resonance Energy Transfer (FRET) tritt nur auf, wenn beide Sonden an ihre Zielsequenz binden und die Farbstoffe Kopf-an-Kopf zu liegen kommen.

Abb. 13: Prinzip des FRET bei Hybridisierung der Sonden mit der Zielsequenz und Anregung (nach LightCycler-Manual, Roche).

Das Thermoelement kühlt das Reaktionsgemisch nach einem initialen Denaturierungsschritt bei 95°C auf 45°C ab. Anschliessend wird die Temperatur schrittweise erhöht und zeitgleich die Fluoreszenz gemessen. So kann eine Schmelzkurve aufgezeichnet werden, da die Intensität der Fluoreszenz proportional mit der Ablösung der Sonden von der untersuchten DNA abnimmt. Eine einzige unterschiedliche Base in der untersuchten Zielsequenz (Punktmutation) bewirkt eine schlechtere Hybridisierung mit der Sonde und so eine um einige Grad Celsius verschobene Schmelzkurve.


[Seite 48↓]

Abb. 14: Oben: Die Abbildung zeigt schematisch das Prinzip der Mutationsanalyse mit einer Wildtyp-spezifischen Sonde. Unten: Die HNMT-(C314T)-Genotypisierung zeigt beispielhaft wie das Hybrid aus Sonde und untersuchtem Amplikon durch die „fehlerhafte“ Anlagerung nur einer Base instabiler wird und seine Schmelztemperatur dadurch um einige Grad Celsius niedriger liegt.


[Seite 49↓]

Für die Genotypisierung wurden folgende Oligonukleotid-Sonden eingesetzt:

HNMT -(C314T)-SNP

Sensor:

5’-AgCTTgTAgCCAAgACATCgAACC

TS=61,7°C

Anchor:

5’LC-Red705-CgAgAACgTAAAgTTTgCTTggCAT p

TS=63,8°C

IL4-C -(590T)-SNP

Sensor:

5’-LC-Red640-gAACATTgCCCCCCAgTg p

TS=60,5°C

Anchor:

5’-CgACCTgTCCTTCTCAAAACACTAAACTTg

TS=64,4°C

IL13- (Arg130Gln)-SNP

Sensor:

5’-LC-Red640- TTTCAGTTGAACCGTCCCTCGC p

TS=64,2°C

Anchor:

5’-CAGGTCCTGTCTCTGCAAATAATGATGCTTTCGA

TS=69,5°C

IL13- (C-1055T)-SNP

Sensor:

5’-LC-Red705- CCTGCTCTTCCCTCATTTTCCTAG p

TS=60,4°C

Anchor:

5’-CCCCTGCAGCCATGTCGCCTT

TS=69,4°C

IL4RA-( Ser478Pro)-SNP

Sensor:

5’-CGCAGCTTCAGCAACCCCCT

TS=66,4°C

Anchor:

5’-LC-Red705-GCCACTCACCGTGTCCCAGAGAGCT p

TS=69,4°C


[Seite 50↓]

IL4RA- (Gln551Arg)-SNP

Sensor:

5’-LC-640-CCAGTGGCTATCAGGAGTTTGTA p

TS=56,5°C

Anchor:

5’-TGCAGCCCCCGTCTCGGCCCCC

TS=78,2°C

IL4RA- (Ile50Val)-SNP

Sensor:

5’-LC-640-TCCGTTGTTCTCAGGGACACACGT p

TS=76,9°C

Anchor:

5’-AGCAGGTGGCACACGCACCCCGC

TS=65,8°C

LightCycler Sondenansatz

Aqua ad inj.

7,1µl

Sensor 1

0,2µl

Anchor 1

0,25µl

Sensor 2

0,2µl

Anchor 2

0,25µl

 

8,0µl

Zu je 8 µl des PCR-Produktes wurden 8 µl Sondenansatz gegeben, in der Kapillare gemischt und für 30 Sekunden bei 3000 rpm zentrifugiert.

3.3.8  Statistische Methoden

Populationsbasierte Assoziationsstudien

Die Allelfrequenzen für jeden SNP wurden errechnet. Der χ2- Test wurde angewendet, um die Abweichung der Genotypfrequenzen vom Hardy-Weinberg-Gleichgewicht zu bestimmen. Der Expectation-Maximization-Algorithmus des Programms Arlequin (Schneider S, Excoffier L. Arlequin (Version 2.0), Genetics and Biometry Laboratory, 2000)) wurde angewandt, um die Haplotypfrequenzen für jedes SNP-Paar zu bestimmen. Die Kopplungsungleichgewicht-(LD)-Statistik D’ wurde auf der Basis der so [Seite 51↓]ermittelten Frequenzen errechnet [74]. Ein Wahrscheinlichkeitstest des Programms Arlequin wurde durchgeführt, um die Signifikanz von Abweichungen vom Kopplungsungleichgewicht zu untersuchen.

Das Grenzwerteffektmodell Generalized Estimation Equotations (GEE) wurde angewendet, um die Assoziation zwischen Genotyp und den longitudinal gemessenen IgE-Werten zu ermitteln. GEE sind statistische Methoden um Einflussgrößen auf korrelierte Daten mittels Regression zu untersuchen.

Um die Veränderung der IgE-Werte während der siebenJahre für die verschiedenen Genotypen zu testen, wurden Interaktionsterme zwischen Alter, Alter2, Alter3 und Genotyp in das Modell aufgenommen.

Für jeden SNP wurden je ein kodominantes Modell und das in früheren Studien verwendete genetische Modell angewendet [75]. Gen-Gen- und Gen-Umweltinteraktionen wurden durch Einfügen von Interaktionstermen in das Regressionsmodell untersucht (z.B. mütterliches Rauchen). P-Werte <0,05 wurden als statistisch signifikant gewertet.

Um den möglichen Einfluss von systematischen Selektionsfehlern auf die Ergebnisse zu testen, wurde ein gewichtetes lineares Modell (weighted linear model (WLM)) angewendet, um die beobachteten Daten bezüglich der ursprünglichen Kohorte zu gewichten. Gewinnt man ähnliche statistische Koeffizienten bzw. Aussagen mit Hilfe des gewichteten linearen Modells und des Grenzwertmodells, ist ein systematischer Selektionsfehler unwahrscheinlich.

Für die Gene mit mehr als zwei Varianten wurden Haplotypanalysen durchgeführt. Die Drei-Lokus-Haplotypanalysen für das IL4RA-Gens wurden mit PHASE (Version 1.0) durchgeführt (Stephens M, 2001). Gewichtete lineare [Seite 52↓]Regression wurde dann für die IgE-Werte zu jedem Zeitpunkt getrennt durchgeführt.

Familienbasierte Assoziationsstudie

Wie bei der populationsbasierten Assoziationsstudie wurde auch hier das Grenzeffektmodell Generalized Estimation Equotations (GEE) verwendet. Es wurde jedoch eine andere Kovariante definiert, die statt des Genotyps des Kindes die Transmission des mutierten Allels von beiden Eltern berücksichtigt.

3.3.8.1  Der modifizierte TDT für quantitative Merkmale:

Der TDT-Test, der auf der Auswertung kompletter Trios (Vater, Mutter, Kind) beruht, wurde im Abschnitt 1.2.2.4 bereits genauer beschrieben. Eine Modifikation des TDT für quantitative Merkmale wurde wie folgt vorgenommen und jeweils auf die longitudinalen Daten der Kinder der MAS-Kohorte angewandt [76]:

Der Grenzeffekt auf das arithmetische Mittel wird durch Kovarianten bestimmt und wird wie folgt errechnet: Log (IgE)ij = β0 + β1xi1 + β2 (Geschlecht)i3 (Alter)ij4 (Alter2)ij5 (Alter3)ij + εij. Die Kovarianz wird definiert als: Corr (εijik) =Ri (α). Log (IgE)ij bedeutet der j. IgE-Wert des i. Kindes, und x1 ist eine Kovariante, die die Transmission von Allel 1 beider Eltern eines Kindes darstellt. Die Transmission nimmt Werte von xi1 = Hi M (Ti M – ½) + Hi P (Ti P – ½) an, wobei Hi M und Hi P jeweils einen Wert von 1 oder 0 annehmen, abhängig davon, ob die Mutter und der Vater des Kindes heterozygot für Allel 1 ist. Die Transmissionsindikatoren Ti M and Ti P werden Werte von 1 annehmen, wenn Allel 1 von jeweils Mutter oder Vater auf das Kind transmittiert wurde und 0 wenn nicht.

Alle Analysen wurden mit dem statistischen Paket STATA (Version 7) durchgeführt und die Analysen der Longitudinaldaten sowie die familienbasierten Analysen mit SAS (Version 8.2).


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
08.03.2005