[Seite 26↓]

3  MATERIAL UND METHODEN

3.1 Versuchstiere und Versuchstierhaltung

In dieser Studie wurde mit NMRI WT Mäusen, 5-HT1A Rezeptor ÜE (Linie 34) und KO Mäusen gearbeitet, die unter Standard-Laborbedingungen bei einer Raumtemperatur (RT) von etwa 21°C und einer relativen Luftfeuchtigkeit von 40-50% in Käfigen untergebracht wurden. Die Betreuung der Mäuse erfolgte im Tierstall des Institutes für Pharmakologie und Toxikologie der Charité zu Berlin, wobei die Zucht und alle weiteren Arbeiten mit den Mäusen unter entsprechend geltenden Tierschutzbestimmungen durchgeführt wurden. Als Nahrung erhielten die Mäuse Standard-Futter und Wasser ad libitum.

Die WT und ÜE transgenen Mäuse hatten den gleichen NMRI genetischen Hintergrund und wurden durch homologe Rekombination hergestellt. Die KO Mäuse mit 129 / Sv genetischem Hintergrund wurden von dem Zentrum für Neurobiologie und Verhalten an der Columbia University in New York zur Verfügung gestellt und dann mit den NMRI Mäusen über mehrere Generationen durch homologe Rekombination verpaart. Somit hatten die unter diesen Bedingungen erzeugten KO Mäuse einen ähnlich genetischen Hintergrund wie die WT und ÜE transgenen Mäuse. In der vorliegenden Studie wurden KO, WT und ÜE Mäuse von verschiedenen embryonalen Entwicklungsperioden (E12,5; E14,5; E16,5; E18,5) verwendet. Der Tag der Befruchtung wurde als E 0 bezeichnet. Postnatal erfolgte die Untersuchung zum Zeitpunkt P1,5 und P15,5.

3.2 Chemikalien und Reagenzien


[Seiten 27 - 29↓]

Chemikalien/Reagenzien

Herkunft

 

Äther

Carl Roth, Karlsruhe, Deutschland

 

Äthylenglykol

Sigma, St. Louis, USA

 

Agarose

Serva, Heidelberg, Deutschland

 

Ammoniumnickelsulfat

Sigma, St. Louis, USA

 

Aprotinin

Sigma, St. Louis, USA

 

APS (Ammoniumpersulfat)

Sigma, St. Louis, USA

 

BCA (Natrium Bicinchoninsäure-4,4-di-carboxy-2,2­bichinolin)

Sigma, St. Louis, USA

 

Bromphenolblau

Serva, Heidelberg, Deutschland

 

BSA (Rinderserum Albumin)

Sigma, St. Louis, USA

 

DAB (3,3'-Diaminobenzidin Tetrahydrochlorid)

Sigma, St. Louis, USA

 

DHBA (3,4-Dihydroxybenzylamin Hydrobromid)

Sigma, St. Louis, USA

 

1 kb DNA Ladder

MBI Fermentas, St.Leon-Rot, Deutschland

 

DA (Dopamin,3,4-Dihydroxyphenäthylamin)

Sigma, St. Louis, USA

 

DOPAC (3,4-Dihydroxyphenylessigsäure)

Sigma, St. Louis, USA

 

dNTPs set (100 mM)

Qbiogene, Deutschland

 

DTT (Dithiothreitol)

Sigma, St. Louis, USA

 

ECL (Enhanced Chemiluminescence)

Perbio, USA

 

EDTA (Ethylendiamintetraessigsäure)

Carl Roth, Karlsruhe, Deutschland

 

Entellan

Merck, Darmstadt, Deutschland

 

Entwickler

Kodak, USA

 

Ethidiumbromid

Sigma, St. Louis, USA

 

Fixierer

Kodak, USA

 

Gelatin

Merck, Darmstadt, Deutschland

 

Glutaraldehyd

Fulka, Neu-Ulm, Deutschland

 

Glycin

Serva, Heidelberg, Deutschland

 

Heparin

Ratiopharm, Ulm, Deutschland

 

Hepes(N-2-Hydroxyethylpiperazin-N’­ethansulfonsäure)

Sigma, St. Louis, USA

 

Hexan

Merck, Darmstadt, Deutschland

 

[ 3 H]8-OH-DPAT(( ± )-8-Hydroxy-2-(di- n ­ propylamino)tetralin )

Amersham.Bioscience,Freiburg, Deutschlend

 

5-HIAA (5-Hydroxyindolessigsäure)

Sigma, St. Louis, USA

 

30%H2O2 (Wasserstoffperoxid)

Merck, Darmstadt, Deutschland

 

5-HT (5-Hydroxytryptamin)

Sigma, St. Louis, USA

 

Imidazol

Sigma, St. Louis, USA

 

Kaliumchlorid

Merck, Darmstadt, Deutschland

 

Ketavet® (Ketaminhydrochlorid)

Curamed Pharma GmbH, Karsruhe

 

Leupeptin

Boehringer, Mannheim, Deutschland

 

Longasteril 70

Fresenius, Bad Homburg,

 

Magnesiumchloride

Eppendorf®, Hamburg, Deutschland

 

Methanol

Merck, Darmstadt, Deutschland

 

Na-Azid (Natriumazid)

Serva, Heidelberg, Deutschland

 

Natriumborhydrid

Carl Roth, Karlsruhe, Deutschland

 

Natriumchlorid

Merck, Darmstadt, Deutschland

 

Natriumdihydrogenphosphat

Merck, Darmstadt, Deutschland

 

Natriumhydroxid

Merck, Darmstadt, Deutschland

 

Natriumhypochloritlösung

Carl Roth, Karlsruhe, Deutschland

 

Na2-Tartrat (di-Natrium-Tartrat)

Merck, Darmstadt, Deutschland

 

NGS (Normales Ziegenserum)

Biotech

 

NHS (Normales Pferdeserum)

Biochrom KG, Berlin

 

1-Octansulfonsäure Natriumsalz Monohydrat

Fulka, Switzerland

 

Paraformaldehyd

Merck, Darmstadt, Deutschland

 

Pargylin

Sigma, St. Louis, USA

 

PCA (Perchlorsäure)

Merck, Darmstadt, Deutschland

 

Pepstatin A

Roche

 

Phenylhydrazin

Merck, Darmstadt, Deutschland

 

Pikrinsäure

Sigma, St. Louis, USA

 

PMSF (Phenylmethylsulfonylfluorid)

Carl Roth, Karlsruhe, Deutschland

 

Ponceau-S

Sigma, St. Louis, USA

 

Primer 1A 3

Tib Molbiol, Berlin, Deutschland

 

Primer 1A 5

Tib Molbiol, Berlin, Deutschland

 

Primer POS F

Tib Molbiol, Berlin, Deutschland

 

Primer POS R

Tib Molbiol, Berlin, Deutschland

 

Proteinase K

Invisorb®Spin Tissue Mini Kit, Invitek, Berlin, Deutschland

 

Rotiphorese Gel A, Acrylamid (30%)

Carl Roth, Karlsruhe, Deutschland

 

Rotiphorese Gel B, Bisacrylamid (2%)

Carl Roth, Karlsruhe, Deutschland

 

Rompun® (2%)

Bayer, Leverkusen

 

Saccharose

Merck, Darmstadt, Deutschland

 

SDS (Natriumdodecylsulfat)

Merck, Darmstadt, Deutschland

 

SDS-PAGE Standards, Broad Range

Bio-RAD, Hercules, CA, USA

 

Skim Milk

Decton Dickinson, USA

 

Taq polymerase

Eppendorf

 

TEMED (N,N,N’,N’-Tetramethyl-Ethylen-Diamin)

CarlRoth, Karlsruhe, Deutschland

 

TCA (Trichloressigsäure)

Carl Roth, Karlsruhe, Deutschland

 

Thiomersal

Merck, Darmstadt, Deutschland

 

Triton X-100

Merck, Darmstadt, Deutschland

 

Tween-20

Serva, Heidelberg, Deutschland

 

Trishydroxymethylaminomethan (Tris)

Merck, Darmstadt, Deutschland

 

Vectastain ABC Kit

Vector Laboratories, Burlingame,CA

 

Xylol

J,T,Baker, Deventer, Niederland

 


[Seite 30↓]

3.3  Verwendete Antikörper

3.3.1 Primärantikörper

Antikörper

Eigenschaft

Herkunft

Anti- 5-HT

polyklonal, Kaninchen

Sigma, St,Louis, USA

Anti-Myelinbasisprotein (MBP)

monoklonal, Maus

Sigma, St,Louis, USA

Anti- S100β

monoklonal, Maus

Sigma, St,Louis, USA

Anti- SNAP25 (C171.2)

monoklonal, Maus

Sternberger Monoclonals (Baltimore, MD, USA)

Anti- Synaptobrevin (Syb)

monoklonal, Maus

Synaptic Systems, Göttingen, Deutschland

Anti- Synaptophysin (Syp)

monoklonal, Maus

Synaptic Systems, Göttingen, Deutschland

Anti-Synaptotagmin (Syt,Cl41.1)

monoklonal, Maus

Synaptic Systems, Göttingen, Deutschland

Anti-TH

polyklonal, Kaninchen

Chemicon, Temecula,CA

Anti-TPH

monoklonal, Maus

Sigma, St,Louis, USA

3.3.2 Sekundärantikörper

Antikörper

Verdünnnug

Herkunft

biotinyliertes anti-Kaninchen IgG (Ziege)

1:2000

Vector laboratories, Burlingame,USA

biotinyliertes anti-Maus IgG (Pferd)

1:2000

Vector laboratories, Burlingame,USA

Peroxidase-gekoppeltes anti­ Kaninchen IgG (Ziege)

1:1000

Vector laboratories, Burlingame,USA

Peroxidase-gekoppeltes anti Maus IgG (Pferd)

1:500 / 1000

Vector laboratories, Burlingame,USA


[Seite 31↓]

3.4  Geräte und Materialien


[Seite 32↓]

Geräte/Materialien

Herkunft

CBM-10A Communications Bus Module

Shimadzu Corporation, Kyoto, Japan

Digitale Electrochemische Amperometritische Detektion (DECADE)

Antec Leyden BV, Niederland

Dynatech MR 5000 Elisa Reader

Dynatech ,Ashford, United Kingdom

Homogenisierer

Heidolph RZR 2021, Deutschland

Hybond™-C, Nitrocellulose membrane, 0,45 Micron

Amersham Life Science, Buckinghamshire, England

Hyperfilm CM

Amersham Life Science, Buckinghamshire, England

Kryostat, 2800 Frigocut

Reichert-Jung, Nussloch, Deutschland

Kühlzentrifuge 5402

Eppendorf®, Hamburg, Deutschland

LC-0AD Liquid Chromatograph

Shimadzu Corporation, Kyoto, Japan

Mikrofuge B

Beckman, USA

Lichtmikroskop

Leica DML, Wetzlar,Deutschland

Mini-Protean® 3 Electrophoresis Cell

Bio-RAD, Hercules, CA, USA

Objektträger

Menzel-Gläser, Braunschweig, Deutschland

PCR-Thermocycler Omn-E

Hybaid, USA

PH-Meter CG 840

Schott, Deutschland

Photometer UV – 1202

Shimadzu, Japan

Power / PAC 200

Bio-RAD, Hercules, CA, USA

Scientific Imaging Film

Kodak , USA

Schüttler 3005

G.F.L®, Burgwedel, Deutschland

Sonicator

Baudelin electronic, Berlin, Deutschland

Thermomixer 5436

Eppendorf®, Hamburg, Deutschland

Trans-Blot SD Semi-Dry Transfer Cell

Bio-RAD, Hercules, CA, USA

VT-03 Electrochemical Flowcell

Antec Leyden BV, The Netherlands

 

96-Loch Mikrotiter Platte

Falcon, USA

3-MM Whatman Filterpapier

Bio-RAD, Hercules, CA, USA

3.5 Methoden

3.5.1 Genotypisierung mittels Polymerase Kettenreaktion (PCR)

3.5.1.1 Lösungen und Puffer

Lösungen und Puffer

Zusammensetzung

Bindungspuffer T

Invisorb®Spin Tissue Mini Kit, Invitek, Berlin

Elutionspuffer D

Invisorb®Spin Tissue Mini Kit, Invitek, Berlin

Lysierungspuffer G

Invisorb®Spin Tissue Mini Kit, Invitek, Berlin

Taq Reaktionspuffer mit Mg 2+ (10x)

500 mM KCl ; 100 mM Tris-HCl, pH 8,3 ; 15 mM MgCl2

TAE

40 mM Tris-Acetat ; 1 mM EDTA pH 8,0

Waschpuffer

Invisorb®Spin Tissue Mini Kit, Invitek, Berlin

3.5.1.2 DNA Extraction aus dem Mausschwanz

Genomische DNA aus dem Mausschwanz wurde mittels Invisorb®Spin Tissue Mini Kit (Invitek, Deutschland) isoliert. Ein 0,5 cm Schwanzabschnitt wurde präpariert und 400 µl Lysierungspuffer G ( 3.5.1.1) und 40 µl Proteinase K zugegeben und gemischt. Die Mischung wurde dann im Eppendorf Thermomixer (Hamburg, Deutschland ) bei 52°C inkubiert, bis sich der Schwanz vollständig aufgelöst hatte. Die Lösung wurde bei RT für 2 min bei 12.000 U / min zentrifugiert. Der Überstand wurde in ein neues Eppendorfgefäß pipettiert und mit 200 µl Bindungspuffer T (3.5.1.1) gemischt und am Vortex für 10 sec geschüttelt. Die Suspension wurde in ein 2 ml Eppendorfgefäß mit einer Spinsäule überführt und für 1 min inkubiert und dann bei 12.000 U / min für 2 min zentrifugiert. Der Überstand wurde vorsichtig abgegossen und [Seite 33↓]die Spinsäule wurde mit Waschpuffer gewaschen und wieder bei 12.000 U / min für 2 min zentrifugiert.

Nach der letzten Zentrifugation wurde die Spinsäule in ein neues Eppendorfgefäß gestellt. 200 µl erwärmter (bei 37 °C) Elutionspuffer D (3.5.1.1) wurde zugegeben und bei 10.000
U / min für 2 min zentrifugiert. Die gelöste DNA wurde für die Qantifizierung und PCR eingesetzt.

3.5.1.3 Primer

Die isolierte DNA vom Schwanz der KO, WT und ÜE Mäuse wurde getrennt mit spezifischen Primer Kombinationen (Tib Molbiol, Berlin ) wie in folgender Tabelle dargestellt amplifiziert:

 

Primer

Sequenzen

WT+KO

1A5

CAG TCT CTA GAT CCC CTC CCT T

 

1A3

AGCAGCAGCGGAATATAGAAAG

WT+ÜE

POS F

AAT CAA GTG ACA AAG ATG TC

 

POS R

G TA GAG CAC TAA TAC ACA TT

3.5.1.4 Vorbereitung für PCR-Ansätze

Zur Vervielfältigung der entsprechenden DNA Sequenzen wurden folgende Ansätze verwendet:

 

WT+KO

WT+ÜE

H2O

38 µl

38 µl

10x Taq Reaction Puffer

5 µl

5 µl

10 mM dNTP

1 µl

1 µl

1.5 mM MgCl2

2.5 µl

2.5 µl

Taq DAN Polymerase

0.5 µl

0.5 µl

Primer

  

POS F

 

0.5 µl

POS R

 

0.5 µl

1A5

0.5 µl

 

1A3

0.5 µl

 

Bei jedem Experiment wurden negative Kontrolle (H2O) und positive Kontrolle (schon bekannte DNA positive Probe) gleichzeitig durchgeführt.


[Seite 34↓]

3.5.1.5  Durchführung der PCR

2 µl DNA Extraktionsprobe aus dem Mausschwanz wurde mit 48µl unter 3.5.1.4 beschriebenen PCR-Ansatz gemischt. Ein PCR-Zyklus wurde wie folgt durchgeführt:

Reaktionsschritt

WT+KO

WT+ÜE

Initiale Denaturierung

90 sec bei 94 °C

90 sec bei 94 °C

Denaturierung

30 sec bei 94 °C

30 sec bei 94 °C

Annealing

45 sec bei 60 °C

45 sec bei 52 °C

Extension

3 min bei 72 °C

45 sec bei 72 °C

Zahl der Zyklen

30

27

Finale Extension

10 sec bei 72 °C

10 sec bei 72 °C

3.5.1.6 Agarose-Gelelektrophorese

Mit Hilfe der Gelelektrophorese wurde DNA Fragment zur Analyse und Isolierung aufgetrennt. Die Größe der DNA-Moleküle in Basenpaaren (bp) wurde im Vergleich mit einem 1 kb DAN Ladder (MBI Fermentas) abgeschätzt. 10 µl / Geltasche DNA-Standard und PCR vervielfältigte DNA Produkte wurden auf 1% Agarose-Gel im TAE Puffer (1x) aufgetragen und bei einer konstanten Spannung von 80 V etwa 20 min aufgetrennt.

3.5.2 Autoradiographie

3.5.2.1 Lösungen und Puffer

Lösungen und Puffer

Zusammensetzung

Inkubationspuffer

25 ml 1 M Tris; 1,015 g MgCl2; 1 ml 0,5 M EDTA; pH 7,7

Spezifische Bindungslösung

35 ml Inkubationspuffer; 3,5 µl Pargylin; 8,75 μl [3H]-8OH-DPAT (1mCi / ml)


[Seite 35↓]

3.5.2.2  Durchführung der Autoradigraphie

P1,5 und P15,5 KO, WT und ÜE Mäuse wurden dekapitiert, die Gehirne sofort entnommen, in pulverisiertem Trockeneis eingefroren und bis zur Bearbeitung bei –80°C gelagert. Die Gehirne wurden seriell koronar (20 µm) mit dem Kryostat (Reichert-Jung, Nussloch, Deutschland) bei
-15°C geschnitten und die Schnitte direkt auf SuperFrost®Plus Objektträger (Menzel-Glaser, Deutschland) aufgezogen und bei –80°C aufbewahrt.

Die Schnitte wurden in Inkubationspuffer mit 0,1% Pargylin bei RT für 10 min vorinkubiert und dann in spezifischer Bindungslösung (3.5.2.1) bei RT für 60 min inkubiert. Die Schnitte wurden zweimal 5 min mit Inkubationspuffer mit 0,1% Pargylin bei 4°C gewaschen, dann mit vorgekühltem destilliertem Wasser (4°C) einmal 1 min gespült und an der Luft 24 h getrocknet. Anschließend wurden die Schnitte auf Amersham Hyperfilm CM bei RT für 3 Wochen exponiert.

3.5.3 Immunhistochemie

3.5.3.1 Verwendete Lösungen und Puffer


[Seite 36↓]

Lösungen/Puffer

Zusammensetzung

ABC- Komplex

10 ml 2 % PBS-A; 10 µl Elite A; 10 µl Elite B

Blocklösung

9,7 ml 10% NGS in PBS; 0,3 ml 10% Triton X-100 in H2O; 5 µl Phenylhydrazin

Gefrierschutzlösung

6,9 g 0,1 M NaH2PO4.1H2O; 150 g Ethylenglycol;
150 g Saccharose; pH 7,4

Fixierungslösung

4% (w / v) Paraformaldehyd; 0.05% (v / v) Glutaraldehyd; 0,1 M PBS (pH 6,81)

Inkubationslösung

500 µl Vorinkubationslösung; 50 µl 3% Ammonium­nickelsulfat; 25 µl 0,3% H2O2

Phosphat-gepuffete physiologische Kochsalzlösung (PBS) 1 M

80 g Natriumchlorid; 2 g Kaliumchlorid; 14 g NaH2PO4.1H2O; 2 g Natriumhydroxid; 1000 ml H2O; pH 6,81

Nachspülungslösung

27,6 g NaH2PO4.1H2O; 100 g Saccharose; 2000 ml H2O; pH 7,38

PGPIC-Fixierungslösung

80 g Paraformaldehyd; 300 µl 10 N Natriumhydroxid; 27,6 g NaH2PO4.1H2O; 4 ml 25% Glutaraldehyd;
333 ml Pikrinsäure; 2000 ml H2O; pH 7,38

Vorinkubationslösung

100 µl 1 M Imidazol; 100 µl 5% DAB; 500 µl 1M Tris; 9,5 ml H2O

Primäre Antiköperlösung

10 ml 10% NGS; 0,3 ml 10% Triton X-100 in H2O; 100 µl 10% Natriumazid; 100 µl 1% Thiomersal

Sekundäre Antiköperlösung

10 ml 2% PBS-A; 0,3 ml 10% Triton X-100 in H2O; 100 µl 10% Natriumazid

3.5.3.2 Präparation der Gehirne

Gehirne von embryonalen und P1,5 Mäusen

Die KO, WT und ÜE trächtigen Mäuse wurden jeweils am E12,5, E14,5, E16,5 oder E18,5 dekapitiert. Die Embryonen wurden aus dem Uterus entfernt und in eine eisgekühlte physiologische Kochsalzlösung gelegt. Die Gehirne der Embryonen wurden sofort entnommen und in der Fixierungslösung ( 3.5.3.1) bei 4°C für 4-6 h fixiert.

Die jeweiligen P1,5 KO, WT und ÜE Mäuse wurden dekapitiert. Die Gehirne wurden sofort aus den auf Eis gelagerten Schädeln entnommen und in Fixierungslösung ( 3.5.3.1) bei 4°C für 4-6 h fixiert.

Anschließend wurden die Gehirne von E12,5 bis P1,5 auf 2% Agarose-Gel Blöckchen und Korkplättchen aufgebracht und in Stickstoff gekühltem Hexan (– 60°C) gefroren und bei –80°C aufbewahrt. Die Gehirne wurden seriell koronar (20µm) mit dem Kryostat bei -25°C geschnitten und die Schnitte direkt auf SuperFrost®Plus Objektträger aufgezogen und etwa 30 min an der Luft getrocknet und anschließend bei –20°C aufbewahrt.


[Seite 37↓]

Gehirne von P15,5 Mäusen

Die jeweiligen P15,5 KO, WT und ÜE Mäuse wurden mit einer intraperitonealen (ip) Injektion von Ketaminhydrochlorid (Ketavet®, 0,1 mg / g Körpergewicht) und 2 % Xylazinhydrochlorid (Rompun®, 0,013 mg / g Körpergewicht) narkotisiert und mit 2500 IU Heparin ip behandelt. Der Brustkorb wurde eröffnet und das Herz freipräpariert. Der Blutkreislauf wurde am linken Ventrikel geöffnet und über einen Polyethylenschlauch mit einem Perfusionssystem verbunden. Die Perfusion wurde wie in folgender Tabelle dargestellt durchgeführt.

Perfussionslösung

Perfussionsdruck

Zeitdauer

Vorspüllösung (Longasteril 70)

50 Torr

10 sec

PGPIG (3.5.3.1)

100 Torr

5 min

 

20 Torr

5 min

Nachspüllösung (3.5.3.1)

70 Torr

5 min

Nach der Perfusion wurden die Gehirne entnommen und in der Nachspüllösung mit 1% PFA bei 4°C für 24 h aufbewahrt. Im Anschluss daran wurden die Gehirne zum Schutz vor Gefrierartefakten in einer 30% Saccharose in PBS (0,1M, pH 6,81) bei 4°C für 24 h eingelegt. Anschließend wurden die Gehirne auf 2% Agarose-Gel Blöckchen und Korkplättchen aufgebracht und in Stickstoff gekühltem Hexan (– 60°C) gefroren und bei –80°C aufbewahrt.

Die Gehirne wurden seriell koronar mit dem Kryostat bei – 25°C (25 µm) geschnitten und die Schnitte wurden in Gefrierschutzlösung (3.5.3.1) bei – 20°C aufbewahrt.

3.5.3.3 DAB – Immunfärbung

Die Schnitte von Embryonen und P1,5 Mäusen wurden in eine feuchte Inkubationskammer gelegt. Die Schnitte von P15,5 Mäusen, die in der Gefrierschutzlösung aufbewahrt waren, wurden zuerst viermal für 5 min in 0,1M PBS gespült. Zur Zerstörung der endogenen Peroxidaseaktivität wurden alle Schnitte von E12,5 bis P15,5 30 min bei RT mit 0,05% Phenylhydrazin in 0,1M PBS mit 10% NGS oder NHS und 0,3% Triton-X 100 behandelt. Anschließend wurden die Schnitte in eine entsprechend verdünnte Lösung des Primärantikörpers (Tab. 1) überführt und bei 4°C 36 h inkubiert.


[Seite 38↓]

Tab.1 Verdünnungen der Primärantikörper bei den verschiedenen Entwicklungsstadien

 

P15,5

P1,5 - E12,5

Anti-5-HT

1: 10000

1: 5000

Anti-MBP

1: 2000

1: 500

Anti-TH

1: 2000

1: 500

Anti-S100β

1: 2000

1: 500

Nach viermaligem Waschen für insgesamt 1 h in 0,1 M PBS und Vorinkubation für 1 h bei RT in der PBS-A Lösung (2% BSA in 0,1 M PBS) wurden die Schnitte mit der entsprechenden Lösung des Sekundärantikörpers (1:2000) 24 h bei 4°C beschichtet.

Es folgten widerum Spülung und Vorinkubation, bevor die Schnitte mit dem unter 3.5.3.1 beschriebenen Avidin-Biotin-Peroxidase-Komplex (ABC-Komplex) für 4 h bei RT inkubiert wurden.

Nach vier fünfminütigen Auswaschen des ABC-Komplexes in 0,1M PBS wurden die Schnitte 15 min bei RT mit der Vorinkubationslösung (0,05% DAB und 10 mM Imidazol) vorinkubiert, anschließend wurde die gebundene Peroxidase durch Zugabe von 0,3% Ammoniumnickelsulfat und 0,015% H2O2 angefärbt. Nach 3-5 min wurde die Reaktion durch Zugabe von 0,1M PBS gestoppt und nach zwei fünfminütigen Auswaschen in 0,1M PBS wurden die Schnitte von P15,5 Mäusen auf die Gelatine-beschichtete Objektträger aufgezogen und etwa 30 min an der Luft getrocknet, anschließend wurden alle Schnitten (E12,5-P15,5) in einer aufsteigenden Alkoholreihe (70%, 90%, 96%, 2x 100%) für insgesamt 10 min entwässert, dann in Xylol gebracht und danach in Entellan eingedeckt und unter dem DML Lichtmikroskop (Fa. Leica) analysiert und photographiert. Bei jedem Experiment wurden negative Kontrollen (ohne Primärantikörper) gleichzeitig durchgeführt.


[Seite 39↓]

3.5.4  Western Blot

3.5.4.1 Verwendete Lösungen und Puffer

Lösungen und Puffer

Zusammensetzung

Antikörperlösung

1,5 g BSA (1,5 %); 100 ml 1xTS-Puffer

BCA-Lösung A

25,8 mM BCA-Dinatrium;160 mM Na2CO3
7 mM Na2-Tartrat; 100 mM NaOH; 113 mM NaHCO3

BCA-Lösung B

160 mM CuSO4.5H2O

Elektrophorese Puffer ( 10 x )

30 g Tris;144 g Glycin; 10 g SDS;1000 ml H2O

Homogenisierungspuffer

320 mM Saccharose; 4 nM Hepes; pH 7,5 (aufbewahrt bei –20°C).Vor Gebrauch frisch dazugeben: Leupeptin (1µg / ml in H2O), Pepstatin (1µg / ml in H2O),Aprotinin (2µg / ml in H2O), und PMSF (0,5 mM in Ethanol)

Magermilchpuffer

25 g Skim Milk (5%); 500 ml 1xTS-Puffer; 500 µl Tween-20

0,2% Ponceau-S Lösung

1 g Ponceau-S; 3 % TCA; 500 ml H2O

3 x Probenpuffer

4,5 g SDS;12,48 ml Sammelgel-Puffer (4x); 1,5 ml 0,1 M EDTA; 15g Saccharose; 800 µl Bromphenolblau (4mg / ml); 45 ml H2O; 5 ml 1,5 M DTT; pH 6,8-7,0

Sammelgel-Puffer (4x)

500 mM Tris; 0,4 % SDS; pH 6,8

Semi-Dry-Blotpuffer

2,9 g Glycin; 5,8 g Tris; 0,379 g SDS; 800 ml H2O; 200 ml Methanol

10xTS-Puffer

24,23 g Tris; 87,66 g NaCL;1000 ml H2O;
pH 7,5

Trenngel-Puffer (4x)

1,5 M Tris; 0,4 % SDS; pH 8,8


[Seite 40↓]

3.5.4.2  Aufarbeitung der Gehirne

Die trächtigen KO, WT und ÜE Mäuse wurden dekapitiert und die Embryonen in verschiedenen Entwicklungsperioden wurden aus dem Uterus entfernt und in eisgekühlte physiologische Kochsalzlösung gelegt. Die Gehirne der Embryonen wurden sofort auf Eis herauspräpariert und umgehend im 0,5 ml (3 gepoolte Gehirne bei E12,5 und E14,5), 1 ml (bei E16,5) oder 1,5 ml (bei E18,5) eisgekühlten Homogenisierungspuffer (3.5.4.1) homogenisiert.

Die P1,5 KO, WT und ÜE Mäuse wurden dekapitiert und die Gehirne sofort auf Eis entnommen und in 1,5 ml eisgekühltem Homogenisierungspuffer (3.5.4.1) homogenisiert.

Die P15,5 KO, WT und ÜE Mäuse wurden mit Äther tief anästhesiert und dekapitiert. Nachdem die Gehirne auf Eis herauspräpariert wurden, wurden sie sofort in 2 ml eisgekühltem Homogenisierungspuffer (3.5.4.1) homogenisiert.

Alle Homogenate wurden mit einer Kühlzentrifuge 5402 bei 5500 U / min für 15 min bei 4°C zentrifugiert. Ein Teil des Überstands wurde zur Bestimmung der Proteinkonzentration eingesetzt und der andere Teil wurde mit 3 x Probenpuffer im Verhältnis 2 : 1 gemischt, bei
95°C für 5 min erhitzt und aliquotiert bei -20° C aufbewahrt.

3.5.4.3 Bestimmung der Proteinkonzentration

Über Verdünnungsreihen wurde eine Standardkurve von 50 bis 400 µg / ml BSA hergestellt. Die Proben wurden üblicherweise mit 0,4% Triton-X 100 in Verdünnungsreihen angesetzt und in Duplikaten in die Löcher einer 96-Loch Mikrotiter Platte (20 µl / Loch) pipettiert. Dazu wurden pro Loch 200 µl der BCA Reaktionslösung zugegeben (eine Mischung aus BCA Lösung A und B im Verhältnis von 50:1, v / v). Die Mikrotiter Platte wurde dann für 30 min bei 60°C im Wasserbad inkubiert. Anschließend wurde die Platte für 10 min zum Abkühlen stehen lassen, bevor die Extinktion der Proben bei 550 nm in einem ELISA-Reader (Dynatech MR 5000, UK) gemessen wurde. Die Proteinkonzentrationen der Proben wurden anhand der Standardkurve bestimmt.


[Seite 41↓]

3.5.4.4  Western Blot und Immundetektion

SDS – Polyacrylamidgelelektrophorese (SDS – PAGE)

Herstellung des Gels

Das Gel wurde wie folgt hergestellt.

 

Trenngel (1 x 10%)

Sammelgel (1 x 3,75 %)

Trenngel-Puffer (pH 8,8)

1,5 ml

 

Sammelgel-Puffer (pH 6,8)

 

500 μl

Acrylamid Stammlösung

2,0 ml

250 μl

Bisacrylamid Stammlösung

0,8 ml

100 μl

H2O

1,7 ml

1150 μl

TEMED

8,0 μl

2,6 μl

10%APS

60 μl

20 μl

Mittels SDS–PAGE unter Anwendung des diskontinuierlichen Puffersystems nach dem Prinzip von Lämmli (1970) können Proteine entsprechend ihrem Molekulargewicht aufgetrennt werden. Die Acrylamidkonzentration des Trenngels wurde je nach gewünschtem Auftrennungs­bereich variiert. Ein 10 %iges Trenngel erreicht eine gute Auftrennung von Proteinen mit einer Molmasse bis zu 10kDa.

Auftragung der Proben und Standards

Vor dem Aufbringen auf das Gel wurden die zu analysierenden Proteinproben für 5 min bei 95°C zur Denaturierung erhitzt und sofort auf Eis gestellt. Nach Polymerisation des Sammelgels wurden die Proben jeweils nach den gewünschten Proteinkonzentrationen (z.B. 20-30
µg / Tasche) in die Tasche des SDS-Polyacrylamidgels aufgetragen. Zur Charakterisierung des Molekulargewichts der aufzutrennenden Proteine wurde bei jedem Lauf des Gels ein Standard im SDS-PAGE mitgeführt. Vom Standard wurde 10 µl / Tasche SDS-PAGE Standard von 6,5 bis 200 kDa verwendet, die 1:20 mit dem SDS reduzierten Probenpuffer (3.5.4.1) verdünnt und für 5 min bei 95°C erhitzt wurde.


[Seite 42↓]

Gelelektrophorese

Nach Beladung des Polyacrylamidgels wurden die Proben bei RT für etwa 30 min bei 80V aufgetrennt, bis die Front des Probenpuffers die Grenze des Trenngels erreicht hat. Anschließend wurde die Spannung auf 160 V umgestellt und das Gel für etwa 1 h bei RT weiterlaufen lassen, bis die Front des Probenpuffers den unteren Gelrand erreicht hat.

Western Blot

In der Transferapparatur (Mini-Protean®3 Electrophoresis Cell, Bio-RAD) wurde ein Sandwich aus folgenden Komponenten zusammengestellt.

Kathode Platte

vorgetränktes 3 MM Whatmann Filterpapier

vorgetränktes 3 MM Whatmann Filterpapier

SDS - Polyacrylamidgel

vorgetränkte NC - Membran

vorgetränktes 3 MM Whatmann Filterpapier

vorgetränktes 3 MM Whatmann Filterpapier

Anode Platte

Der Transfer erfolgte in der oben aufgebauten Transferapparatur für 25 min bei RT bei einer Stromstärke von 300 mA pro Gel im Semi-Dry Verfahren unter Verwendung von Semi­ Dry Puffer.

Um die Banden der Marker-Proteine sichtbar zu machen und die Integrität der übrigen Proteine zu testen, wurden die NC-Membranen nach erfolgtem Transfer in 0,2% Ponceau-S Lösung für 2-3 minangefärbt und anschließend mit H2O gewaschen und getrocknet. Zur Bestimmung verschiedener Proteine in einer Membran wurde die Membran mit dem Skalpell in horizontale oder vertikale Streifen geschnitten, wobei die Banden der Marker-Proteine als Anhaltspunkte für das ersichtliche Molekulargewicht der Proteine dienten.


[Seite 43↓]

Immundetektion

Die Membranen wurden jeweils getrennt von jeder Gruppe mit dem Antiserum inkubiert. Nach dem Absättigen der unspezifischen Bindungsstellen mit 5% Magermilchpuffer in TBS / 0,1% Tween 20 (3.5.4.1) bei RT für 1 h wurden die Membranen mit dem in der Antikörperlösung
( 3.5.4.1) verdünnten Primärantikörper bei 4°C 24 h inkubiert.

Tab.2 Verdünnungen der Primärantikörper in der verschiedenen Entwicklungsstadien

 

P15,5

P1,5 - E12,5

Anti-MBP (Maus)

1: 2000

1:1000

Anti-TH (Kaninchen)

1: 4000

1:1000-2000

Anti- SNAP25 (Maus)

1:1000

1:1000

Anti- Synaptotagmin (Maus)

1:1000

1:1000

Anti- Synaptobrevin (Maus)

1:10 000

1:10 000

Anti- Synaptophysin (Maus)

1:10 000

1:5000

Um unspezifisch gebundene Antikörper zu entfernen, wurden die Membranen viermal für 15 min mit 5% Magermilchpuffer gewaschen. Der Nachweis gebundener Antikörper erfolgte für 1 h bei RT mit Peroxidase-gekoppelten Pferd-anti-Maus bzw. Schaf-anti-Kaninchen­Sekundärantikörper (beide Verdünnungen von 1:1000 in Antikörperlösung, 3.5.4.1). Nach zweimaligem 15 min Waschen der Membranen mit 5% Magermilchpuffer wurden die Membranen nur mit TBS zweimal für 15 min gewaschen. Alle Inkubations-und Wasch-Schritte wurden auf einem Schüttler durchgeführt.

Zur Detektion der Peroxidase Aktivität wurden die Membranen für 1 min in Chemolumineszenz-Lösung inkubiert und in einer Filmkassettte zusammen mit einem Scientific Imaging Film ( Kodak, USA) für 1-30 min exponiert. Die Exponierungszeit hing von der Stärke des Bandsignals ab.


[Seite 44↓]

3.5.5  Quantitative Analyse von Monoamin-Neurotransmittern und deren Metaboliten mittels Hochdruckflüssigkeitschromatographie mit elektrochemischer Detektion (HPLC-ED)

Die Erfassung des Gehalts an endogenem 5-HT und dessen Metabolit 5-HIAA, DA und dessen Metabolit DOPAC, und NA erfolgte mittels HPLC-ED und wurde an KO, WT and ÜE Mäusen in verschiedenen Entwicklungsperioden (E12,5; E14,5; E16,5: E18,5; P1,5; P15,5) durchgeführt. Bei jeder Gruppe wurden jeweilig mindestens sechs Mäuse benutzt.

3.5.5.1 Durchührung der HPLC-ED

Die Bedingungen der Bestimmung von 5-HT und 5-HIAA

Mobile Phase

0.1 M Natriumazetat

 

1 mM EDTA

 

5 % Methanol

 

pH 4.5

Stationäre Phase

Spherisorb ODS - 2.5µm, 250mm x 4.6mm

Injektionsvolumen

20 µl

Säulentemperatur

35°C

Flussrate

1.0 ml / min

elektrochemischer Detektor

Arbeitselektrode: glassy carbon

 

Referenzelektrode: 3 M KCl

 

Potential: +0,65 V


[Seite 45↓]

Die Bedingungen der Bestimmung von DA und NA

Mobile Phase

0.1 M Natriumphosphat

 

0,1 mM EDTA

 

0,5 mM Octansulfonsäure

 

5 % Methanol

 

pH 4,75 - 4,8

Stationäre Phase

Merck Lichrospher 100 RP-18, 5µm, 125mm x

 

4,0mm

Injektionsvolumen

20 µl

Säulentemperatur

35 °C

Flussrate

0,8 ml / min

elektrochemischer Detektor

Arbeitselektrode: glassy carbon

 

Referenzelektrode: 3 M KCl

 

Potential: +0,65 V

3.5.5.2 Präparation und Aufarbeitung der Gehirne

Die trächtigen KO, WT und ÜE Mäuse wurden jeweils am E12,5, E14,5, E16,5 oder E18,5 dekapitiert und die Embryonen wurden aus dem Uterus entfernt und in eine eisgekühlte physiologische Kochsalzlösung gelegt. Die Gehirne der Embryonen wurden sofort entnommen und auf Trockeneis eingefroren und bis zur Bestimmung bei –80°C aufbewahrt. Die P1,5 und P15,5 KO, WT und ÜE Mäuse wurden dekapitiert und die Gehirne sofort entnommen, auf Trockeneis eingefroren und bei -80°C aufbewahrt.

Jedes P15,5 Gehirn wurde auf einer Kühlplatte (-15°C) in fünf verschiedene Subregionen (Bulbus olfactorius, Frontalcortex, Striatum, Hippocampus, und Hypothalamus) präpariert. Jede Probe wurde sofort in einem 1,5 ml Eppendorf-Röhrchen gewogen und bei - 80°C aufbewahrt.


[Seite 46↓]

Bestimmung von 5-HT und 5-HIAA

Die Gewebe wurden mit entsprechender Menge (je nach der Verdünnung) von 0,1 M Perchlorsäure (PCA) versetzt und mit einem Sonicator homogenisiert und dann bei 13 000 rpm für 20 min bei 4°C zentrifugiert. Vom Überstand wurden 20 μl direkt ins HPLC-ED System injiziert (Sperk, 1982)

Bestimmung von DA und NA

Die Gewebe wurden mit entsprechender Menge (je nach der Verdünnung) von 0,1 M PCA versetzt und mit einem Sonicator homogenisiert und bei 13 000 rpm für 20 min bei 4°C zentrifugiert. 300 µl Überstand wurden mit 30 µl 10-7 M internen Standard (DHBA) und1 ml 1% Al2O3 in Tris / HCl (pH 8,6) versetzt und bei 4°C für 10 min geschüttelt, anschließend in einer Eppendorfzentrifuge (90° fixer Winkel) für 90 sec zentrifugiert. Der Überstand wurde abgesaugt und das Pellet mit 1 ml H2O gewaschen und danach noch einmal 90 sec zentrifugiert. Der entstehende Überstand wurde abgesaugt und das Pellet mit 300 µl 0,1 M PCA versetzt und bei
4 °C für 10 min geschüttelt und danach 90 sec zentrifugiert. Von diesem Überstand wurden 20 µl direkt ins HPLC-ED System injiziert (Sperk et al. 1981).

3.5.6 Statistische Auswertung

Die gewonnenen Daten wurden als Mittelwerte und Standardfehler (MW+SEM) angegeben. Zur statistischen Auswertung bei Vergleich mehrerer Gruppen wurde mit Hilfe des Statistikprogrammes von SigmaStat ein one-way ANOVA (one-way analysis of variance, die eine Aussage darüber trifft, ob sich mehrere Gruppen signifikant voneinander unterscheiden) durchgeführt, gefolgt von dem Tukey’s post hoc-Test. Als statistisch signifikant wurden Werte mit p < 0,05 definiert.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
03.02.2004