|
| [page 25↓] |
Standard protocols for various techniques in molecular biology, like preparation and analysis of DNA and RNA, enzymatic manipulation, transfection of DNA into mammalian cells, protein analysis and setup of polymease chain reaction (PCR) were performed according to Current Protocols in Molecular Biology (Ausubel et al., 1994).
The Hollenberg mouse embryo cDNA library (Behrens et al., 1996) was amplified to gain enough plasmid for yeast transformation. E.coli library culture was thawed on ice, and 103 and 106 dilutions were made in LB-ampicillin selective medium. One μl of the 103 dilution, and 50-100 μl of the 106 dilution was mixed with LB-ampicillin medium, spread onto LB-ampicillin plates and incubated at 37°C overnight. On the next day, colonies were counted to calculate the library titer (number of colony forming units per ml of bacterial suspension). A volume of this suspension containing twice as much cells as the number of independent clones of the library (5x106) was diluted in LB-ampicillin, plated at 200,000 colonies per 15-cm dish (nearly confluent) and incubated at 37°C overnight. Colonies were scraped into 1.5-liter selective medium; this suspension was incubated at 37°C with shaking for a further 2 h, bacteria were pelleted and large-scale plasmid isolation was performed using Megaplasmid columns 2500 (Qiagen).
Bait proteins for the yeast two-hybrid system are encoded in the pBTM116 vector (Bartel and Fields, 1995). This vector carries the TRP1 gene and has a polylinker downstream of LexA coding sequences. The E. coli repressor LexA consists of two domains: a C-terminal domain, which is responsible for dimerization prior to DNA binding, and an N-terminal domain responsible for specific binding to a palindromic operator containing the CTGTNNNN consensus half-site. The Hollenberg library is inserted in the VP16 vector, which carries the [page 26↓] LEU2 gene and contains a nuclear localization signal-VP16 activation domain sequence upstream of the multiple cloning site. Both pBTM116 and VP16 yeast expression vectors bear a bacterial origin of replication and an ampicillin resistance gene, which allow plasmid amplification in bacteria.
To generate TprMet-ErbB2 yeast baits, a cDNA fragment encoding amino acids 1005-1260 of rodent ErbB-2 harbouring a Y1253F mutation was inserted into the Not I/Sal I sites of pSK+ (Stratagene) This region stretches over Y1028 (Y1), Y1144 (Y2), 1201 (Y3) and 1226/7 (Y4) of ErbB-2. A cDNA sequence coding for dimerization and kinase domains of TprMet (amino acids 1-481; Park 86 cell) was generated by PCR; this fragment, flanked by 5´ Not I/EcoR I and 3´ Not I sites, was inserted into the Not I site at 5´ end of ErbB-2 in pSK+, thus rendering the hybrid cDNA for the TprMet-ErbB2(Y1-4) bait. The complete cDNA sequence was finally subcloned downstream of LexA into EcoR I/Sal I sites of pBTM116 yeast expression vector. A new TprMet hybrid protein was constructed to include Y1253 (Y5) of ErbB-2 in the bait. An ErbB-2 sequence encoding amino acids 1197-1260 was fused to TprMet as above to generate the TprMet-ErbB2(Y3-5) bait; thus, Y1201 (Y3), 1226/1227 (Y4) and 1253 (Y5) of ErbB-2 were present in this bait. A BTM-TprMet-Δtail control plasmid lacking the Met C-terminal multiple docking site was constructed by inserting a PCR fragment encoding amino acids 1-479 of TprMet into the EcoR I site of pBTM116. To generate kinase-deficient bait proteins, the wild type sequences of TprMet were excised by EcoR I/Not I and replaced by a PCR fragment containing the inactivating mutation K243A (Rodrigues and Park, 1993).
Both TprMet-ErbB2(Y1-4) and TprMet-ErbB2(Y3-5) bait proteins were used to screen the Hollenberg cDNA library from E10.5 mouse embryos. Saccharomyces cerevisiae strain L40 was used as host. This yeast strain carries two reporter genes, HIS3 and lacZ, whose expression is driven by minimal GAL1 promoters fused to multimerized LexA binding sites; therefore, yeast expressing LexA activators can be detected as histidine prototrophs or by measurable β-galactosidase activity. A pBTM116-lamin plasmid was used as a further control [page 27↓]to eliminate false positive clones. Reagents and methods for yeast two-hybrid analyses were adapted from MATCHMAKERTM Handbook (PT1265-1, Clontech).
Bait plasmids and library were sequentially introduced into host L40 yeast strain to improve the efficiency of transformation. Briefly, yeast was initially transformed with bait plasmid in a small-scale procedure, and then library screens were performed (Fields and Song, 1989). To prepare competent yeast, a single colony of L40 yeast was inoculated into 20 ml of YPD (10 g/l yeast extract, Difco; 20 g/l peptone, Difco; 2% dextrose) medium and incubated at 30°C overnight. On the next day, culture was diluted 10-fold and further incubated until OD600 was 0.5. Cells were pelleted, washed with water and resuspended in 1.5 ml of sterile 1X TE/LiAc (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 100 mM lithium acetate). Competent L40 yeast was then transformed with bait plasmid; 0.5 μg of plasmid DNA was mixed with 50 μg of salmon sperm carrier DNA, 50 μl of competent yeast and 300 μl PEG/TE/LiAc (40% polyethylene glycol, 1X TE/LiAc), vortexed and incubated at 30°C for 30 min. DMSO was added to 10%, and heat-shock transformation was performed at 42°C for 15 min. Mixture was chilled on ice, cells were pelleted, resuspended in 250 μl water and spread onto selection agar plates lacking tryptophan. Colonies appear after 2 or 3 days. For the library screen, one single colony of the bait transformants was grown to obtain 200 ml of a saturated cell suspension (OD600 greater than 1) in medium without tryptophan. This culture was added to 800 ml YPD medium to prepare 20 ml of competent yeast as above. Yeast suspension was incubated at room temperature for 10 min, and 10 mg carrier DNA, 250 μg library DNA and 140 ml PEG/TE/LiAc was addded. Mixture was incubated at 30°C for 30 min, 17.6 ml of DMSO was added, and heat-shock transformation was performed as above. Co-transformed yeast cells were resuspended in 1 liter YPD and incubated at 30°C for 1 h. Cells were pelleted, resuspended in selection medium lacking tryptophan and leucine and further incubated at 30°C for 8 h. Finally, cells were resuspended in 10 ml water and 200 μl of a dilution series was plated onto 50 selection agar plates without tryptophan, leucine and histidine in the [page 28↓]presence of 20 mM 3-aminotriazole and incubated at 30°C. Double transformants that express interacting proteins rendered colonies within 8-10 days, which were re-plated onto fresh selection agar plates for further analysis.
Interaction between bait and preys was confirmed by β-galactosidase activity filter assay and by re-transfection of bait and prey plasmids back into yeast. For filter assay, colonies from selection plates (without tryptophan and leucine) were replica-transferred onto a Whatman Nr.1 filter. The replica filter was submerged in liquid nitrogen to permeabilize cells, and then allowed to thaw. The filter was placed (colonies facing up) onto another filter presoaked in Z buffer/X-gal solution (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, pH 7.0, 0.27% β-mercaptoethanol and 0.334 g/l X-gal) and incubated at 30°C. Colonies expressing β-galactosidase appeared blue within 1-12 h.
For yeast re-transformation, library plasmids encoding interacting proteins were isolated from individual positive colonies. To remove the bait plasmid from double transformant yeast, colonies were inoculated into medium lacking leucine and cultured at 30°C for 1 day. Growth in the absence of tryptophan selection allows survival of yeast segregants without bait plasmid, which is randomly lost. To isolate the library plasmid from yeast segregants, cells from 1 ml of the above culture were pelleted, lysed in 200 μl of lysis buffer (2% Triton X-100, 1% SDS, 100 mM NaCl, 1 mM EDTA, 10 mM Tris pH 8.0) and disrupted in the presence of 200 μl phenol/chloroform/isoamyl alcohol (25:24:1) and 0.3 g of acid-washed glass beads by vortexing for 2 min; suspension was clarified by centrifugation and plasmid was recovered from the supernatant by standard ethanol precipitation. Library plasmid was amplified in E. coli HB101 strain, which is leucine auxotroph due to a leuB mutation. HB101 cells were electroporated with the isolated library plasmid and plated onto selection agar plates without leucine; therefore, transformants can be selected by complementation with the yeast LEU2 gene from the VP16 library plasmid. Bait and prey plasmids were re-transformed into yeast [page 29↓]according to the small-scale transformation protocol previously described. True positive interacting clones grew again on selective agar plates without tryptophan, leucine and histidine and were positive in β-galactosidase assays.
Mutational analysis of the bait proteins was performed to characterize the ErbB-2 binding sites for each interacting protein found in the screen. Deletion mutants bearing single or tandem tyrosine residues of the ErbB-2 multiple docking region were generated by standard PCR. The PCR fragments were flanked by 5´ Not I and 3´ Sal I sites, and were used to replace the ErbB-2 wild type sequence of the hybrid TprMet-ErbB2 baits. The ErbB-2 deletion mutants fused to TprMet were: Y1 (amino acids 1014-1081) includes Y1028; Y1-2 (amino acids 1014-1160) includes Y1028 and Y1144; Y2 (amino acids 1138-1160) includes Y1144; Y2-3 (amino acids 1138-1221) includes Y1144 and Y1201; Y2F-3 is a variant of Y2-3 in which Y2 was mutated to F using a commercial kit (Clontech); Y3 (amino acids 1194-1221) includes Y1201; Y3-4 (amino acids 1194-1244) includes Y1201 and Y1226/1227; Y4 (amino acids 1220-1244) includes Y1226/1227; Y4-5 (amino acids 1220-1260) includes Y1226/1227 and Y1253; Y5 (amino acids 1248-1260) includes Y1253.
Expression of the various TprMet-ErbB2 proteins in the yeast was checked by Western blot analysis using anti-LexA antibodies (Clontech). L40 yeast transformants were grown in selective medium without tryptophan at 30°C. During exponential growth phase, OD600 was measured for 1 ml suspension; cells were pelleted from an aliquot corresponding to OD600= 0.5 and resuspended in 100 μl 2X denaturing buffer for SDS-PAGE (100 mM Tris base, pH 6.8, 20% glycerol, 4% SDS, 2% β-mercaptoethanol, 0.2% bromphenol blue). Twenty μl of this suspension was loaded per slot onto an 8% polyacrylamide gel, proteins were resolved, blotted in a PVDF membrane and Western Blotting was performed according to standard protocols.
|
| [page 30↓] |
Full-length cDNA of Vav2 (Δ29 isoform; Schuebel et al., 1996) was isolated from a λgt11 E17.5 mouse embryo cDNA library, using a cDNA fragment of Vav2 from a clone found in the yeast two-hybrid screen. To generate Flag-tagged Vav2 proteins, the corresponding cDNA sequences were inserted in frame in the Not I site downstream of a Flag epitope tag in pcDNA 3.1(+) (Invitrogen). The cDNAs of ΔN-Vav2 (encoding amino acids 189-839 of full-sizeVav2) and ΔN-Vav2-ΔC (encoding amino acids 189-595) were amplified by PCR using full-size Vav2 as template. To generate ΔN-Vav2-dblmut and ΔN-Vav2-ΔCΔPH, the sequences encoding amino acids 336-342 and 383-507, respectively, were further deleted by overlapping PCR. To generate the cDNA of TrkErbB2-Δtail, an Nco I/Not I fragment encoding the ErbB-2 C-terminal tail (amino acids 1006-1260) was removed from a pSK+/TrkErbB2 plasmid (Sachs et al., 1996) and replaced by a triple HA epitope tag flanked by Nco I and compatible EagI sites; then, the sequence coding for HA-tagged TrkErbB2-Δtail was excised EcoR I/Eag I and subcloned into pcDNA 3.1(+) using EcoR I/Not I sites. The cDNA of HA-tagged TrkErbB2-Vav2 was constructed by inserting the full-size sequence of Vav2 (encoding residues 2-839) into the Eag I site downstream from triple HA. To generate the kinase-deficient mutant TrkErbB2-Kin-, a 951 bp-cDNA fragment containing the inactivating K758A mutationwas excised by Nco I/Mro I from the pLSV-K758A plasmid (Ben-Levy et al., 1994) and inserted into pUC118-TrkErbB2 (Sachs et al., 1996)in place of the wild-type sequence; the cDNA of TrkErbB2-Kin- was excised by Acc65 I/Spe I from pUC118 and inserted into Acc65 I/Xba I sites of pcDNA 3.1(+). In TrkErbB2mut, Y1028 and Y1201 of ErbB-2 C-terminal tail were mutated to phenylalanine using a commercial kit (Clontech).
The TransformerTM Site-Directed Mutagenesis kit (Clontech) was used to generate Trk-ErbB2 variants in which single or pairs of tyrosine residues of the ErbB-2 C-terminal tail were [page 31↓]mutated to phenylalanine. Two oligonucleotide primers were used to introduce a base change in double-stranded DNA. One primer (referred to as the mutagenic primer) introduced the desired mutation. The second primer (referred to as the selection primer) disrupted a unique restriction site to facilitate the ultimate selection of the mutated plasmid. A unique Sca I of pUC118-Trk-ErbB2 was mutated to a Hpa I site with the selection primer 5' CAGAATGACTTGGTTAACTACTCACCAGTC 3' (highlighted is the mutated base). Mutagenic primers were Y2F (5' CCCCAGCCCGAGTTTGTGAACCAA 3'), Y3F (5' GGAG
AACCCTGAATTCTTAGTACCGAGAGAAGGC 3') and Y4F (5' GCCCAGCCTTTGACA
ACCTCTTTTTCTGGGACCAG 3'). The two primers were simultaneously annealed to one DNA strand of the target plasmid. After standard elongation, ligation and a primary selection by digestion with Sca I and Hpa I, the mixture of wild-type and mutated plasmid was transformed into BMH 71-18 mutS E. coli strain, which contains a DNA mismatch repair deficiency mutation. Plasmid DNA was prepared from the mixed bacterial population and isolated DNA was again digested by Sca I and Hpa I. Mutated DNA was resistant to digestion with Sca I but sensitive to Hpa I, whereas parental DNA was linearized by Sca I. A new transformation of E. coli with the Sca I restriction mixture rendered high recovery of the mutated plasmid. Protocols were carried out according to Clontech's user manual. Mutated Trk-ErbB-2 DNAs were digested by Acc65 I/Spe I from pUC118 and inserted into the Kpn I/Xba I sites of pcDNA3.1(+). A TrkErbB2 variant without both Vav2 binding sites (termed TrkErbB2mut) was generated by Y1F mutation of pcDNA-TrkErbB2-Y3F, using a unique Nde I site for the selection primer (5' TACATCAAGTGTATCCTCTGCCAAGTACGCCCC
CTA 3') and a Y1F mutagenic primer (5' CTGGTAGACGCTGAAGAGTTTCTGGTGCCCC
AGC 3').
Human embryo kidney 293T cells were used for transient transfections. For morphogenesis assays on matrigel, EpH4 mouse mammary epithelial cells were used. EpH4 cells (Lopez-Barahona et al., 1995) are a clonal epithelial derivative of IM-2 mouse mammary gland [page 32↓]epithelial cells, which were originally isolated from mammary tissue of a mid-pregnant mouse (Reichmann et al., 1989). In our lab, the variant EpH4 K6 was subcloned (Niemann et al., 1998), which exhibits a pronounced morphogenic potential on matrigel. The K6 subclone was used in this work.
3x106 293T cells were plated per 15-cm dish and co-transfected with 4 μg Flag-tagged Vav2 and 200 ng TrkErbB2, TrkErbB2-Kin- or TrkErbB2mut expression vectors by calcium/phosphate precipitation. Twelve hours after transfection, cells were starved in serum-free DMEM medium for 36 h. Prior to lysis, cells were stimulated with 50 ng/ml NGF (Promega) in the presence of 1 μM phenylarsine oxide at 37°C for 10 min, and then washed with ice-cold PBS (Sachs et al., 1996). Cells were harvested in 800 μl lysis buffer supplemented with phosphatase and protease inhibitors (50 mM HEPES, 50 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, pH 7.5; inhibitors were added at the following end concentrations: 10 mM NaF, 1 mM Naorthovanadate, 10 mM Na pyrophosphate, 1 mM PMSF, 0.5 μg/ml aprotinin) and incubated on ice for 15 min. Lysates were clarified by centrifugation at 14,000 rpm for 10 min at 4°C. For immunoprecipitations, 300 μl cell lysate was mixed with an equal volume of HNTG buffer (20 mM HEPES, 150 mM NaCl, 10% glycerol, 0.1% Triton X-100, pH 7.5; inhibitors were used as for lysis buffer) and incubated with primary antibodies at 4°C overnight. Immunoprecipitates were resuspended in 70 μl denaturing loading buffer and heated at 95°C for 3 min. Proteins were resolved by SDS-PAGE, and transferred to PVDF membranes for 1 h at 100 mAmp per blot using a Trans-Blot SD semi-dry electroblotter (BioRad). Membranes were blocked with 5% low-fat milk powder in PBS at 25°C for 3 h, or with 0.5% Tween 20 and 10% FCS in PBS for anti-phosphotyrosine primary antibodies. Membranes were incubated with primary antibodies in blocking solution at 4°C overnight. Following 3 washes with PBS containing either 5% milk or 0.05% Tween (for anti-phosphotyrosine Western blots), membranes were incubated with peroxidase-conjugated secondary antibodies at 25°C for 45 min. After thorough washing, [page 33↓]proteins were detected by enhanced chemiluminescence (Amersham). For protein interaction studies in mammary epithelial cells, EpH4 cells were serum-starved for 1 day, stimulated with 2 ng/ml neuregulin-β1 (R&D Systems) at 37°C for 10 min and lysed as for 293T cells. Immunoprecipitation followed by SDS-PAGE and Western blotting was performed as above. For detection of Vav2/ErbB-2 complexes in mammary tissue, mammary glands from 17.5-day pregnant mice were solubilized in lysis buffer and incubated with anti-Vav2 antibodies at 4°C for 7 h. Co-immunoprecipitated ErbB-2 was detected as described above.
Antibodies used for immunoprecipitation and Western blotting were: anti-Flag (affinity beads, Sigma), anti-Flag Octapeptide (Zymed), anti-Vav2 (DPH, Calbiochem), anti-ErbB-2 (Ab-8, NeoMarkers) and anti-PY antibodies (PY20, Transduction Laboratories). Peroxidase-conjugated secondary antibodies were: goat anti-rabbit (Calbiochem), goat anti-mouse (Jackson ImmunoResearch) and rabbit anti-sheep, Upstate Biotechnology). Protein G Sepharose 4 FAST FLOW (Amersham Pharmacia Biotech) was used for immuno-precipitation.
EpH4 cells were transfected with Flag-tagged ΔN-Vav2, Flag-tagged ΔN-Vav2 mutants, HA-tagged TrkErbB2-Vav2 or TrkErbB2-Δtail expression vectors by standard calcium/phosphate method and selected for neomycin resistance in the presence of 800 μg/ml G418. Individual clones stably expressing the exogenous proteins were expanded and tested for morphogenesis on Matrigel (basement membrane from Engelbreth-Holm-Swarm murine tumor, Sigma; Niemann et al., 1998). 24-well plates were cooled on ice, and each well was coated with 70 μl Matrigel solution. Plates were incubated at 37°C for 30-60 min until Matrigel solidified. EpH4 cells were plated dropwise as a suspension containing approximately 300-500 cell clusters/ml in DMEM supplemented with 10% FCS and the following hormones: bovine prolactin (at 3 μg/ml; Sigma), hydrocortisone (at 1 μg/ml; Merck) and insulin (at 5 μg/ml; Sigma). After one day of culture at 37°C, medium was replaced by serum-free DMEM [page 34↓]containing hormones. Neuregulin-β1 (at 1 ng/ml) or NGF (at 100 ng/ml) were added to medium, which was changed daily. Assays were terminated after 5 days of culture. For branching morphogenesis assays, 24-well plates were coated with a 5 mm-thick layer of collagen; then, matrigel was added on top and cells were plated as above. Assays were performed in the presence of DMEM medium supplemented with 10% FCS, hormones and HGF/SF (at 10 units/ml).
For light and electron microscopy studies, matrigel specimens were fixed with 2.5 % glutaraldehyde in 0.1 M phosphate buffer and 0.18 M sucrose at 4°C for 2 days, postfixed with 1% OsO4 in 0.1 M phosphate buffer for 2 h, dehydrated in a graded ethanol series and embedded in Poly/BedR 812 (Polysciences, Inc). For light microscopy, semithin section (1 μm) were stained with toluidine blue and analyzed in a Zeiss Axioplan II imaging microscope. Ultrathin sections (70 nm) were contrasted with 2% uranyl acetate and lead citrate (Merck) and analyzed in a Philips EM 400T electron microscope.
For in situ hybridization (Hülsken et al., 2001), sections of third thoracic glands of 16-day pregnant mice were used. Digoxygenin-labelled RNA probes were synthesized with T3 or T7 RNA polymerase using DIG RNA kit (Boehringer Mannheim). Probes were: neuregulin, nucleotides 391-1458 (Yang et al., 1995); ErbB-2, nucleotides 1746-3780; Vav2, nucleotides 1-2232 plus 504 nucleotides 5´ from start codon. Pyrogenin was used for red counterstaining.
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 3.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 19.10.2004 |