[Seite 25↓]

2.  Materials and Methods

2.1. Construction of plasmids encoding various fusion proteins

The various plasmid constructs encoding translational fusions of DNMT1 (Fig. 3.4 and Fig. 3.14) , HsDNA Ligase I (Fig. 3.18) and DmDNA Ligase I (Fig. 3.10) with GFP/YFP/RFP were derived from the following vectors: pEMT (Czank et al., 1991), pEGFP-N2 (Clontech), pEGFP-C1 (Clontech), pEVRF0 (Matthias et al., 1989), pDsRed1-C1 (Clontech). Eucaryotic expression in all cases is driven by the cytomegalovirus immediate-early enhancer-promoter. All plasmid constructs were made using standard cloning techniques and transformation of Escherichia coli (Sambrook and Russell, 2001). Plasmid DNA was isolated from transformed E. coli using the alkaline lysis method (Birnboim and Doly, 1979) and subsequently verified by restriction enzyme analysis. An SV40-NLS was included for efficient nuclear targeting of deletion proteins which lost the endogenous NLS. Wherever PCR was used to generate the required insert, the sequence was verified by sequencing (GATC). The PBD inserts for MTPBD-GFP, HsLigPBD-GFP and DmLigPBD-GFP fusion proteins were generated by synthesizing sense and antisense oligonucleotides corresponding to both strands of the PBD coding region (Table 2.1). The oligonucleotides were flanked with overhangs corresponding to products of EcoR I and Xma I digestions. The sense and anti-sense oligonucleotides were annealed in Sequenase buffer [0.2 M Tris-Cl (pH 7.5), 0.2 M MgCl 2 , 1 M NaCl] and subcloned into pEGFP-N2 digested with EcoR I and Xma I. The inserts were verified by sequencing. Plasmid DNA was further purified using anion-exchange columns (Qiagen) according to the instructions of the manufacturer and used for transfection of cultured Drosophila and mammalian cells.

Table 2.1. Oligonucleotides used for generating PBD-GFP fusions

Origin of PBD

Sequence of Oligonucleotides*

DNMT1

Sense strand
5'aattctgcagtgcgaccatgggacgcaccACCAGGCAGACCACCATCACGGCTCACTTCACGAAGGGCCCCACTAAACGGAAACCaggac 3'

Antisense strand
5'ccgggtcctGGTTTCCGTTTAGTGGGGCCCTTCGTGAAGTGAGCCGTGATGGTGGTCTGCCTGGTggtgcgtcccatggtcgcactgcag 3'

HsDNA Ligase I

Sense strand
5'aattctgcagtgcgaccATGCAGCGAAGTATCATGTCATTTTTCCACCCCAAGAAAGAGGGTAAAGCAAAGAAGCCagggc 3'

Antisense strand
5'ccgggccctGGCTTCTTTGCTTTACCCTCTTTCTTGGGGTGGAAAAATGACATGATACTTCGCTGCATggtcgcactgcag 3'

DmDNA Ligase I

Sense strand
5'aattctgcagtgcgaccatgcaaaagtctataacctccttcttcaagaagaaatccgatgccaccgacagcccctcgc 3'

Antisense strand
5'ccgggcgaggggctgtcggtggcatcggatttcttcttgaagaaggaggttatagacttttgcatggtcgcactgcag 3'

*Letters in bold flanking the sequences are the overhangs corresponding to products of EcoR I and Xma I digestions. The start codon is underlined.


[Seite 26↓]

2.2.  Cell culture and transfection

2.2.1. Drosophila cells

The ability of various proteins and their mutants to associate with RF in Drosophila cells was analyzed in Schneider’s line 2 (S2 cells). These cells have been generated from primary cells prepared from minced or enzymatically disaggregated late embryos of Drosophila melanogaster (Schneider, 1972) and are likely to have originated from lymphoid cells (Roberts, 1998). The cells were grown in a humidified atmosphere at a temperature of 25˚C and maintained in Shields and Sang M3 medium (Sigma) with 10% FCS at a density of 0.5 x 10 6 to 2 x 106 cells/ ml in tissue culture flasks. The cells grow partially attached and were detached by mechanical shaking and pipetting to harvest or to subculture them. Frozen cells were thawed by warming the cryovials in a 37ºC water bath and pipetting the cell suspension into a plate containing medium at 25ºC. For long term storage, the cells were harvested and resuspended at a density of 1-2 x 107 cells/ml in 10% FCS supplemented Shields and Sang M3 medium containing 45% conditioned medium (medium in which the cells were growing). The cell suspension was distributed into cryovials and DMSO was added to a concentration of 10% and the cells were immediately frozen and stored in liquid nitrogen.

For immunostaining and microscopic analysis, S2 cells were cultured on poly-lysine coated glass coverslips to enhance attachment of cells to the coverslip. Transient transfections were done with the eucaryotic expression plasmid DNA using the CaPO4-DNA coprecipitation method (Graham and van der Eb, 1973) (Parker and Stark, 1979). Cells were transfected at a density of 1 x 106 cells/ ml. After 48 hrs of transfection, the cells were washed gently with phosphate buffered saline (PBS) and fixed with 3.7% formaldehyde in PBS and immunostained.

2.2.2. Mammalian cells

Mouse C2C12 myoblasts (Yaffe and Saxel, 1977) were used for all immunostaining and microscopic analyses as replication foci are well characterized in these cells (Cardoso et al., 1993). COS-7 (African green monkey kidney fibroblast-like cells transformed with SV40 T antigen; (Gluzman, 1981)) or 293T (human embryonic kidney cells transformed with SV40 T antigen; gift from Isao Suetake and Shoji Tajima) cells were used to test the proteins produced from the various plasmid constructs by western blot analysis.

The cells were grown in a humidified atmosphere of 5% CO2 at 37ºC in DMEM with 10% and 20% FCS for COS-7 or 293T cells and C2C12 cells respectively. The cells were grown to 70% confluency, and were subcultured every 48-72 hrs. To harvest or to subculture the cells, trypsin (0.25% trypsin, 0.02% EDTA in PBS) was used to detach C2C12 and COS-7 cells, while 293T cells were detached using 0.02% EDTA in PBS. Freezing and thawing of cells were done as described in 2.2.1, except that cells were frozen at a density of 106 cells/ml.

C2C12 cells were grown on coverslips and transfected using the CaPO4-DNA coprecipitation method. After 24 hrs of transfection C2C12 cells were washed in PBS and fixed either with ice cold absolute methanol or 3.7% formaldehyde followed by immunostaining. COS-7 cells and 293T cells were transfected using Polyfect reagent [Seite 27↓]following the instructions of the manufacturer (Qiagen). Polyfect is a synthetic polymer (dendrimer) built up from branched units that form a spherical architecture. The branches terminate in charged amino groups which interact with the negatively charged phosphate groups of nucleic acids. The Polyfect-DNA complex has a net positive charge and interacts with negatively charged moieties (like glycoproteins) at the cell surface and is taken into the cell by nonspecific endocytosis. The reagent buffers the pH of the endosome, leading to pH inhibition of endosomal nucleases, which ensures stability of PolyFect–DNA complexes. After 48-72 hrs of transfection COS-7 or 293T cells were washed in PBS, harvested and extracted for western blot analysis.

2.3. Cell extracts and western blot analysis

Transfected cells were harvested by centrifugation at 228 g for 5 min at 4˚C and cell pellets were resuspended in Laemmli sample buffer (2% SDS, 20% glycerol, 250 mM Tris-HCl pH 6.8, 10% β-mercaptoethanol, 0.1% bromophenol blue) and denatured by boiling at 100ºC for 5 min. Proteins were separated by SDS-PAGE. A 12% gel was used in most cases, but proteins with expected molecular weight of 71-212 kDa (Fig. 3.14B) were separated on a 5-20% gradient gel. Separated proteins were transferred to a PVDF membrane (BIO-RAD) with transfer buffer (48 mM Tris-Cl, 39 mM glycine, 0.037 % SDS and 20 % absolute methanol) using a semidry blotter (Hoefer) for 1 hr at 2 mA/cm2. Non-specific binding to the membrane was blocked by incubating it in blocking buffer (5% nonfat milk powder in PBS) for 30 min at room temperature followed by incubation in a solution of the primary antibody diluted with blocking buffer and 0.2% Tween-20 for 2 hrs at room temperature. The blot was washed three times 20 min each in PBS containing 0.2% Tween-20, incubated for 1 hr with HRP-conjugated secondary antibody diluted with the blocking buffer. The HRP signals were detected by ECL+ reagent (Amersham Pharmacia) following the instructions of the manufacturer. This is based on the principle that HRP/hydrogen peroxide catalyses oxidation of chemiluminescent substrates, like luminol, in alkaline conditions. The product is in an excited state and decays to ground state by emitting light. The emitted light signals were recorded in a luminescent image reader (Fuji). Images were assembled and annotated using Adobe Photoshop 5.5 and Adobe Illustrator 8.0.1. The following primary antibodies were used: rabbit anti-GFP (1:500; abcam), rabbit anti-human DNA Ligase I [1:5000, (Cardoso et al., 1997)], anti-PATH5∆ (1:5000 ; Nowak, D., Leonhardt, H. and Cardoso, M.C.). The secondary antibody used was anti-rabbit-IgG-HRP (1:10,000; Sigma).

2.4. Cell cycle and immunofluorescence analysis

2.4.1. BrdU labeling of replication foci and immunostaining

For detection of RF, cells grown on coverslips were incubated in medium with 100 µM BrdU for 15 min (pulse labeling). The cells were then washed two times with PBS and fixed with 3.7 % formaldehyde in PBS. Cells were permeabilized with [Seite 28↓]0.25% Triton-X-100 for 10 min followed by washing three times with PBS. Non-specific binding of antibodies was prevented by blocking in 0.2% fish skin gelatin (FSG) for 30 min. The cells were then incubated with mouse monoclonal anti-BrdU antibody (Beckton-Dickinson) or rat monoclonal anti-BrdU antibody (Harlan Sera-lab) along with other desired primary antibodies against replication proteins (DNA Ligase I, DNMT1, PCNA) for 1 hr at 37˚C. The primary antibodies were diluted in buffer containing 0.2% FSG, 20U/ml DNase I (Boehringer Mannheim), 0.5 mM ß-mercaptoethanol, 0.33 mM MgCl2, 33 mM Tris-Cl pH 8.1. The DNA in the chromatin is partially digested by DNase I exposing the incorporated BrdU. Following incubation in primary antibody, the cells were washed three times with 0.1% NP40 in PBS followed by incubation with fluorophore conjugated secondary antibodies at room temperature. The following primary antibodies against replication and methylation proteins were used in the various experiments: rabbit anti-PATH52 (against DNMT1) [1: 2000; (Bestor, 1992)], mouse monoclonal anti-PCNA (1:1000 with methanol fixed cells, Clone PC10, Dako), rabbit anti-PCNA (1:100, FL-261, Santa Cruz), rabbit anti-human DNA Ligase I [1:250, (Cardoso et al., 1997)]. Secondary antibodies (Jackson Immuno Research and Molecular Probes) conjugated to the following fluorophores were used: fluorescein isothiocyanate (FITC), texas red (TR), Cy5, Alexa Fluor 568 and Alexa Fluor 647. The DNA was counterstained with Hoechst 33258 or TOPRO-3 and cells were mounted in mowiol with 2.5% DABCO as an anti-fading agent. In the same immunostaining, the fluorophores were selected so that there is no overlap in their excitation-emission maxima. For example, a combination of FITC, TR, Cy5 and Hoechst 33258 would be used for a quadruple staining. The excitation-emission maxima of the various fluorescent proteins used and the fluorophores are listed in Table 2.2.

2.4.2. BrdU pulse-chase for identification of cells in G2 phase

C2C12 cells were pulse labeled with 10 µM BrdU for 15 min (pulse labeling) and washed twice with pre-warmed DMEM containing 100 µM thymidine. BrdU incorporation was chased by incubating the cells in conditioned medium containing 100 µM thymidine for 2-3 hrs. The cells were then fixed with 3.7 % formaldehyde and immunostained as described in 2.4.1.


[Seite 29↓]

Table 2.2. Excitation and emission maxima of
various fluorophores used.

Fluorescent proteins/ Fluorophore

Excitation maxima (nm)

Emission maxima (nm)

GFP

489

508

YFP

514

527

DsRed (RFP)

558

583

FITC

494*

518*

Texas red

595*

615*

Cy5

650*

670*

Alexa Fluor 568

578*

603*

Alexa Fluor 647

650*

668*

Hoechst 33258

346

460

TOPRO-3

642

661

*Approximate excitation and fluorescence emission maxima for conjugates.

2.4.3. Localization of DNMT1 at mitotic chromatin

Association of DNMT1 with mitotic chromatin was detected by fixing cells with ice cold absolute methanol for 10 min followed by immunostaining with anti-PATH52 Ab in buffer containing DNase I as described in 2.4.1. DNMT1 was detected in mitotic chromatin with anti-PATH52 Ab only in methanol fixed cells and when DNase I was included in the buffer. This suggests the epitope recognized by anti-PATH52 Ab [amino acid 255-753 (Bestor, 1992)] which lies within the TS region) is hidden and gets unmasked by DNase I treatment only in methanol fixed cells. However, association of DNMT1 with mitotic chromatin was observed with other antibodies against DNMT1 [anti-DNMT1 N-term Ab against the first 118 amino acids of DNMT1 which was a gift from Suetake, I., (Suetake et al., 2001); anti-DNMT1 C-term Ab against the C-terminal domain of DNMT1 which was a gift from Gaudet, F., (Gaudet et al., 1998)] in formaldehyde fixed cells.

2.4.4. Obtaining cells in G1

G1 cells were obtained by isolating mitotic cells by mechanical shake off. C2C12 cells (50% confluent) growing on a 100 mm dish with 10 ml medium were vigorously agitated without spilling the medium. Mitotic cells being loosely attached get detached from the surface. The mitotic cells were harvested by centrifugation at 228 g for 5 min and resuspended in 2 ml medium. The cells were then laid on coverslips in a 35 mm dish and incubated for 2 hrs. The cells were pulse labeled with BrdU and immunostained as described in 2.4.1. None of the cells stained BrdU positive indicating that they were still in G1.


[Seite 30↓]

2.5.  Microscopy

Immunostained cells were examined on a Zeiss LSM 510 microscope with 63x or 100x NA 1.4 Plan-Apochromat oil immersion objective with Nomarsky optics. Ar-laser (488, 514 nm), HeNe-laser 1 (543 nm) and HeNe-laser 2 (633 nm) were used to excite the fluorophores. The excitation lasers and detection filters used for the different flurophores are listed in Table 2.3. Images were acquired using the Zeiss LSM510 software and processed, assembled and annotated using Adobe Photoshop 5.5 and Adobe Illustrator 8.0.1.

Hoechst 33258 counterstained nuclei were imaged in an Axioplan 2 microscope equipped with phase-contrast and epifluorescence optics, using a 63x NA 1.4 Plan-Apochromat oil immersion objective. A Hg lamp was used as the light source in combination with excitation and emission filters listed in Table 2.3. Images were acquired with a cooled CCD camera (SensiCam) using Zeiss Axiovision software.

Table 2.3. Excitation and emission filters used for detecting the signals from the different fluorophores and fluorescent proteins.

Fluorophore/

Fluorescent protein

Zeiss LSM 510

Zeiss Axioplan 2

Excitation Laser (nm)

Beam splitter (nm)

Emission filters (nm)

Excitation Filters (nm)

Beam splitter (nm)

Emission filters (nm)

FITC, GFP, YFP*

488

HFT UV/488/ 543/633

500-530 BP

450-490 BP

510

515-565 BP

TR, Alexa Fluor 548, DsRed (RFP)

543

HFT UV/488/ 543/633

565-615 BP

530-585 BP

600

615 LP

Cy5, Alexa Fluor 647, TOPRO-3

633

HFT UV/488/ 543/633

650 LP

575-625 BP

645

660-770 BP

Hoechst 33258

-

-

-

365/12 BP

395

397 LP

* YFP can be excited also by 488nm laser. Note: BP = Band pass; LP = Long pass; HFT = Hauptfarbteiler (Main beam splitter)


[Seite 31↓]

2.6.  Live cell microscopy

For live cell microscopy, cells were grown on 40 mm diameter glass coverslips and cotransfected with plasmids encoding F-TS-GFP or GMT and RFP-Ligase (cell cycle marker for live cells). 24 hrs after transfection, the coverslip was assembled in a FCS2 live cell microscopy chamber (Bioptechs). The chamber was mounted onto the stage of the microscope and the temperature of the coverslip was maintained at 37˚C using a temperature controller (Bioptechs). Care was taken to prevent photo-damage of cells by screening the cells with minimum intensity of excitation light. Images were acquired using the 488 nm and 543 nm laser lines at low power (1-5%). Four Z-stacks of 1 µm distance were imaged every hour and the cells were followed throughout the cell cycle. During the progress of imaging over a long period, the fluorescence decreased because of bleaching. In such cases, the detector gain was increased to detect weak signals.

After image acquisition, the different Z scans at each time point were analyzed visually to correct for movement of the cell in the Z plane by arranging them sequentially so as to include the same structures in each sequential image. A sequence of images were selected and processed in Adobe Photoshop 5.5 and Adobe Illustrator 8.0.1 for assembly and annotation in the figures. Movies were created from these sequential images using Adobe Premiere 5.1.

2.7. Sequence analysis

2.7.1. Search for DNA Ligase I homologue in Drosophila

DmDNA Ligase I cDNA was identified by searching the Drosophila genome database and the EST database (BDGP) with DNA Ligase I sequence from different organisms (mouse, human, yeast) as query using the BLAST program (Altschul et al., 1990). The sequences obtained were aligned pairwise using BLAST2 (at BCM Search Launcher http://searchlauncher.bcm.tmc.edu/) for generating the schematic of alignments shown in Fig. 3.8. Phylogenetic comparison of the human DNA Ligases and the putative Drosophila Ligases were done using the Jotun-Hein method (Hein, 1990) in Lasergene program. The DmDNA Ligase I cDNA clone (LD41868) was obtained from ResGen.

2.7.2. Multiple sequence alignments, profiles and profile search

Multiple sequence alignments were generated using programs available with the Lasergene software or the Heidelberg Unix Sequence Analysis Resources (HUSAR) (DKFZ, Heidelberg). The specific programs used in each case are mentioned in the figure legends in the Results section. The multiple sequence alignment in Fig. 3.29 is displayed using PrettyBox, which shades regions that agree with a calculated consensus sequence. In some cases the alignment obtained were edited by visual inspection to get maximal alignment.

A ‘profile’ is a quantitative representation of the occurrence of residue at a given position in a group of aligned sequences. Profiles were generated in cases [Seite 32↓]where the set of related sequences have small sequence lengths (10-30 amino acids; the PBD and TS motif). Generation of profiles and searching of databases with the profiles were carried out with the ProfileMake and ProfileSearch programs (Gribskov et al., 1987) available at HUSAR. Profiles of the aligned sequences were made with default settings. ProfileMake creates the profile which is a position-specific scoring table that quantitatively represents the information from a group of aligned sequences. The profile generated was used to search for similar sequences in a given sequence(s) or the Swissprot and GenBank databases using ProfileSearch with default settings.

2.7.3. PSI-BLAST searches

PSI-BLAST (position-specific iterated-BLAST) is a database search program that automatically combines three distinct operations: it constructs a multiple sequence alignment from BLAST output data; it calculates a position-specific score matrix from this alignment; and it uses this matrix to search the database for similar sequences (Altschul et al., 1997). PSI-BLAST (NCBI) was used for searching the non-redundant peptide database for sequences similar to the TS. After the first round of iteration, only the statistically significant sequences (E-value better than threshold) in the BLAST output data were selected for calculating the position-specific score matrix for successive iterations. E-value is the expectation value - the number of different alignments that is expected to occur in a database search by chance with scores equivalent to or better than the one obtained. After four iterations, no more new sequences were obtained.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
11.05.2004