METHODEN

3.1 Isolierung und Kultivierung von humanen respiratorischen Epithelzellen

↓25

Bei einer Konchotomie wird zur Nasenhöhlensanierung die untere Nasenmuschel entfernt. Das bei der oben genannten Operation anfallende Gewebe kann für Forschungszwecke zur Verfügung gestellt werden (dem Ethikantrag Versch/Si 253 wurde am 22.8.2002 zugestimmt). Aus den Nasenmuscheln wurde das respiratorische Epithel mit Hilfe eines enzymatischen Verdaus isoliert [79].

Der Enzymcocktail für den Verdau beinhaltete Dispase Grade II in einer Konzentration von 2,4U/ml gelöst in PBS. Die Nasenmuscheln wurden in dieser Enzymlösung bei 4°C über Nacht inkubiert. Am folgenden Tag schabte man vorsichtig mittels eines Skalpells das respiratorische Epithel von dem darunter liegenden Bindegewebe der Nasenmuschel ab. Die so gewonnenen Epithelzellen wurden in ein mit Medium gefülltes Falconröhrchen überführt und bei 600g abzentrifugiert. Nach einmaligem Waschen mit Hanks-Salzlösung wurde die Zellzahl wie in Kapitel 3.5. bestimmt. 12.000 Zellen/cm2 wurden anschließend in eine mit Kollagen A beschichtete Zellkulturflasche ausgesät.

↓26

Für die Kollagenbeschichtung der Zellkulturflaschen wurden pro 10cm2 Kulturoberfläche 1ml einer 1:1 verdünnten Lösung Kollagen A in PBS in das Kulturgefäß gegeben und 30min bei 37°C inkubiert. Anschließend wurde die Lösung abgesaugt und das Kulturgefäß sofort verwendet oder ggf. mit PBS-Puffer überschichtet und bei 4°C für maximal sieben Tage gelagert.

Die Kultivierung der Epithelzellen erfolgte im Brutschrank bei 37°C, 5%igen CO2 Gehalt und 96%iger Luftfeuchtigkeit in Airway Epithel Cell Growth Medium (AECGM), wobei das Nährmedium alle zwei bis drei Tage gewechselt werden musste. Nach Erreichen einer 70%igen Konfluenz wurden die Zellen passagiert und wieder ausgesät.

3.2 Isolierung und Kultivierung von humanen Chondrozyten aus Nasensepten

Im Gegensatz zu der bereits erwähnten Koncheotomie und Nasenhöhlensanierung wird bei der Nasenseptum-Plastik Nasenseptumknorpel entfernt. Die im weiteren Verlauf der Operation nicht mehr benötigten knorpeligen Teile des Septums wurden zur Gewinnung von Chondrozyten zur Verfügung gestellt (dem Ethikantrag Versch/Si 254 wurde am 22.8.02 zugestimmt).

↓27

Zunächst wurde der knorpelige Anteil des Nasensetums mit einem Skalpell vom knöchernen Teil abgetrennt und in ca. 1mm2 große Stücke zerkleinert. Die 3x mit 70%igem Alkohol gewaschenen Knorpelstücke wurden in einem Enzymcocktail bestehend aus Kollagenase P (30U/ml), Kollagenase CLS II (10.000U/ml) und Hyaluronidase (1000U/ml) in eine Spinnerflasche überführt. Der enzymatische Verdau erfolgte auf einem Magnetrührer über Nacht bei 37°C, 5%CO2 Gehalt und 96%iger Luftfeuchtigkeit. Am nächsten Morgen wurde der Verdau durch ein 100µm dichtes Zellsieb gegossen, um unverdautes Material und größere Zellklumpen zu entfernen. Die aufgefangene Zellsuspension wurde mit Hanks Salzlösung auf ein Volumen von insgesamt 50ml aufgefüllt, bei 600g abzentrifugiert und einmal gewaschen. Nach erneutem Zentrifugieren bei 600g wurde das entstandene Zellpellet in Kulturmedium aufgenommen. Die Zellen wurden wie unter 3.5 beschrieben gezählt und in Zellkulturflaschen in einer Dichte von 8000 Zellen/cm2 ausgesät. Die Kultivierung erfolgte im Brutschrank bei 37°C, 5%igen CO2 Gehalt und 96%iger Luftfeuchtigkeit in supplementiertem RPMI 1640 Medium, wobei das Nährmedium alle zwei bis drei Tage gewechselt wurde.

3.3 Isolierung und Kultivierung von humanen Chondrozyten aus dem Kniegelenk

Humaner Gelenkknorpel wird von humanen Femurkondylen des Kniegelenks post mortem gewonnen (Für die Ethikkommission der Charité-Universitätsmedizin Berlin bestehen keine ethischen und rechtlichen Bedenken. Antrag am 28.2.02 genehmigt). Dazu wurden die mit Knorpel überzogenen Kondylen mit 70% Ethanol abgewischt und der Knorpel mittels Skalpell abgelöst, ohne den subchondralen Knochen zu verletzen. Die abgelösten Knorpelstücke wurden sofort in RPMI-Nährmedium gegeben und darin bis zur Weiterverarbeitung aufbewahrt. Anschließend wurde das Knorpelgewebe zunächst drei Mal mit 70%igem Alkohol gewaschen und 1x in Hanks-Salzlösung gespült und entweder in 0,5x0,5cm2 große Stücke geschnitten und im Nährmedium bei 4°C gelagert oder für die Chondrozytengewinnung wie im Punkt 3.2 beschrieben verarbeitet.

3.4 Isolierung und Kultivierung von humanen Fibroblasten

Die Submukosa der Nasenmuschel wurde mit dem Skalpell zerkleinert und in einem Enzymcocktail bestehend aus Kollagenase P (30U/ml) und Kollagenase CLS II (10.000 U/ml) verdaut, die Fibroblasten geerntet, gezählt, mit einer Zelldichte von 4000 Zellen/cm2 ausgesät und im Brutschrank mit RPMI 1640 Medium kultiviert. Im Unterschied zu der Chondrozytenkultivierung wurde das beim 48-stündigen Mediumwechsel abgenommene Medium nicht verworfen, sondern als Medium für Co-Kulturversuche aufbewahrt. Dieses Medium bezeichnet man als konditioniertes Medium.

3.5 Zellzahl- und Vitalitätsbestimmung

↓28

Die Zellzahl wurde mit der Trypanblau-Exklusions-Methode bestimmt. 20μl der Zellsuspension wurden in einem Reaktionsgefäß mit 20μl Trypanblau verdünnt und gleichzeitig gefärbt. Die gefärbten Zellen wurden mit Hilfe der Neubauer-Zählkammer unter dem Mikroskop ausgezählt und die Anzahl der Zellen in der nach folgender Formel bestimmt: Mittelwert der in 4x16 Feldern gezählten Zellen (X) multipliziert mit dem Gesamtvolumen der Zellsuspension (Y), der Verdünnung mit Trypanblau (Faktor 2) und der durch die technischen Vorgaben der Neubauer-Zählkammer bedingten
Konstanten (104).

Zellzahl = X x Y x 2 x 104

Die Vitalitätsbestimmung erfolgt ebenfalls durch die Anfärbung der Zellen mit Trypanblau. Vitale Zellen erscheinen hell leuchtend, während tote Zellen dunkelblau angefärbt sind. Nach Division der Lebendzellzahl durch die Gesamtzellzahl und Multiplikation mit dem Faktor 100 erhält man den prozentualen Anteil an lebenden Zellen in der Zellsuspension. Primärzellisolationen, die eine Vitalität von 50% unterschritten, wurden verworfen.

↓29

Um eine Verwechslung von Erythrozyten mit respiratorischen Epithelzellen beim Zählen zu verhindern, wurde die Methode der Zellzahlbestimmung für diese Zellart modifiziert. 20μl der Zellsuspension wurden zunächst mit 20μl Essigsäure (1% v/v in PBS) gemischt. Die Essigsäure bewirkt eine Schädigung der Zellmembran der Erythrozyten, so dass diese durch die Zugabe von Trypanblau dunkelblau angefärbt wurden. Zur Berechnung mußte das Volumen der zugegebenen Essigsäure berücksichtigt werden, indem der Verdünnungsfaktor auf vier erhöht wurde.

3.6 Passagieren von Zellen aus Monolayerkulturen

Nach Absaugen des Nährmediums und einem einmaligen Waschen der Zellen mit PBS pipettierte man je nach Flaschengröße 2 bzw. 5ml Trypsin/EDTA-Lösung in die Kulturflasche und inkubierte das Zellgemisch bei 37°C im Brutschrank ca. 5min bis zum Ablösen der Zellen. Die Enzymaktivität des Trypsins wurde anschließend mit serumhaltigem RPMI -Medium abgestoppt und die Zellsuspension 5min bei 600g zentrifugiert. Das so erhaltene Zellpellet wurde in dem entsprechenden Kulturmedium resuspendiert, die Zellen gezählt und erneut in der entsprechenden Zelldichte in Kulturflaschen ausgesät.

3.7 Differenzierungskulturen von humanen respiratorischen Epithelzellen in Zellkulturflaschen

Humane respiratorische Epithelzellen aus der Passage 1 wurden in einer Zelldichte von 12.000 Zellen/cm2 in 25cm2 Kulturflaschen ausgesät und zwölf Tage über den Zeitpunkt der Konfluenz hinweg kultiviert. Zum Zeitpunkt einer 70%igen und einer 100%igen Konfluenz (d0), sowie nach vier (d4), acht (d8) und zwölf Tagen (d12) nach Konfluenz wurden die Epithelzellen aus je zwei Flaschen geerntet und deren RNA isoliert. Diese Versuchsreihe wurde mit sechs Patientengeweben durchgeführt.

3.8 Air-Liquid-Interface Kulturen von humanen respiratorischen Epithelzellen

↓30

Das Prinzip der Zellkultivierung im Air-Liquid-Interface wurde im Rahmen dieser Dissertation in der Arbeitsgruppe etabliert.

Humane respiratorische Epithelzellen wurden wie unter 3.6 beschrieben passagiert und in einer Zelldichte von 20.000 Zellen/cm2 auf spezielle Kollagenmembranen (Cellagen Discs; Abb .8) gesät.

Abb. 8 : Kollagenmembraneinsatz für die Air-Liquid Interface Kultur

↓31

Diese Kollagenmembranen mußten vor dem Einsatz in 6-well Platten platziert und mit 7ml AECG-Medium für 30min bei 37°C inkubiert werden, bevor sie mit den hREC besiedelt wurden. Die mit Epithelzellen beschichtete Membran wurde dann bis zur Konfluenz bei 37°C kultiviert. Jetzt wurde das Medium oberhalb der Zellen entfernt, um ein Luftmilieu zu simulieren, das so genannte Air-Liquid-Interface. Die Gesamtkulturdauer nach dem Erreichen der Konfluenz betrug zwölf Tage, wobei das Medium unterhalb der zellhaltigen Membran jeden zweiten Tag gewechselt werden musste. Zum Zeitpunkt einer 100%igen Konfluenz (d0) sowie nach vier (d4), acht (d8) und zwölf Tagen (d12) nach Konfluenz wurden die Epithelzellen von je zwei Kollagenmembranen geerntet und anschließend die RNA isoliert. Auch bei diesem Versuch wurden Epithelzellen von sechs Patienten verwendet.

3.9 Hochdichte-Pelletkulturen aus humanen Chondrozyten

Für die Hochdichte-Pelletkulturen wurden zunächst Chondrozyten von humanem Nasenseptumknorpel verschiedener Patienten wie beschrieben isoliert, kultiviert und in flüssigem Stickstoff eingefroren. Für die Herstellung eines Zell-Pools wurden die Chondrozyten aller Patienten gleichzeitig aufgetaut und die Zellsuspensionen vereinigt. Dieses Zellgemisch wurde in Zellkulturflaschen ausgesät und kultiviert. Kurz vor der Konfluenz wurden die Zellen wie in 3.6 beschrieben trypsiniert und anschließend gezählt. Je 1,5x106 Zellen wurden in 15ml Rörchen überführt und diese für 5min bei 324g zentrifugiert. Der Überstand wurde verworfen und die Zellen mit 1ml Basismedium gewaschen. Nach erneutem Zentrifugieren für 5min bei 324g, wurden die Pellets in 0,5ml TGFß-1 supplementiertem Differenzierungsmedium resuspendiert, erneut zentrifugiert und anschließend im Brutschrank bei 37°C, 5% CO2 Atmosphäre kultiviert. Eine Kontrollgruppe wurde ebenfalls mit Differenzierungsmedium, aber ohne den Zusatz von TGFß-1, kultiviert. Der Medienwechsel erfolgt alle 48h.

3.10 Gesamt-RNA Isolation

3.10.1 Gesamt-RNA Isolation aus humanen respiratoischen Epithelzellen in Monolayerkulturen

Für die Isolation der Gesamt-RNA wurde das Medium über den humanen respiratorischen Epithelzellen abgesaugt, der Zellrasen wurde mit 1ml Tri-Reagent LS pro 25cm2 Kulturoberfläche versetzt und für 1min bei Raumtemperatur inkubiert. Anschließend wurde mit Hilfe eines Zellschabers die Epithelzellen vom Flaschenboden gelöst [80;81]. Das entstandene Zelllysat wurde in 2ml Reaktionsgefäße überführt und bei –80°C gelagert. Waren alle Zelllysate eines Patienten zu den unter 3.7 beschriebenen Zeitpunkten gesammelt, begann erst dann die eigentliche Gesamt-RNA-Isolation. Die gefrorenen Zelllysate wurden aufgetaut, 5min bei Raumtemperatur inkubiert und mit 133µl 1-Bromo-3-chlorpropan (BCP) pro 1ml Zelllysat versetzt, 20sec geschüttelt und für 15 Minuten bei Raumtemperatur inkubiert. Anschließend zentrifugierte man die Proben 45min bei 4°C und 12.000g. Das Zentrifugat wies dann bereits eine Phasentrennung auf.

↓32

Die obere RNA-haltige Phase wurde abgenommen, in ein neues Reaktionsgefäß überführt und auf Eis weiterbearbeitet. 70% Isopropanol wurde entsprechend dem RNA-haltigen Probenvolumen 1:1 zugegeben und bei –20°C für 30min inkubiert. In dieser Phase wurde die RNA gefällt. Die RNA wurde im Anschluss durch Zentrifugation bei 4°C und 12.000g als Pellet gewonnen. Der Überstand wurde verworfen und das Pellet mit 70% Ethanol gewaschen und erneut zentrifugiert (4°C; 12.000g). Das Ethanol wurde nach der Zentrifugation verworfen und durch zusätzliche Lufttrocknung vollständig entfernt. Das RNA Pellet wurde nun in 20µl DEPC H2O (Diethyl-pyrocarbonat-Wasser) aufgenommen und bei 65°C innerhalb von 5min gelöst. Den Gehalt an Gesamt-RNA bestimmt man durch photometrische Messung, die unter 3.11 näher beschrieben wird.

3.10.2 Gesamt-RNA Isolation aus Air-Liquid-Interface-Kulturen

Zu den unter 3.8 beschriebenen Zeitpunkten wurden je zwei Kollagenmembranen mittels Skalpell aus ihren Plastikhalterungen geschnitten und je 1ml Tri-Reagent LS auf die Zellen gegeben. Mittels eines Zellschabers wurden die Zellen von der Membran gelöst. Das erhaltene Zelllysat wurde wie in 3.10.1 beschrieben weiterbehandelt und so die Gesamt-RNA aus diesen Zellen isoliert.

3.11 Bestimmung des Gesamt-RNA Gehalts

Die gelöste Gesamt-RNA wurde am Photometer gemessen. Hierzu wurde eine 1:50 Verdünnung der Gesamt-RNA in DEPC-Wasser angesetzt, die über die optische Dichte (OD) bei 260nm quantifiziert wurde. Die Quantifizierung wurde unter der Annahme durchgeführt, dass eine Absorption von eins der Menge von 40g/l Einzelstrang-RNA (ssRNA) entspricht, wobei die Absorption der Verdünnung im linearen Messbereich des Gerätes (OD 0,1-1) zu messen ist. Als Referenzwert wurde das Lösungsmittel DEPC-Wasser eingesetzt. Parallel wurde die Verunreinigung mit Proteinen über die OD bei 280nm bestimmt. Das Verhältnis der OD-Werte bei einer Wellenlänge von 260nm zu 280nm beschreibt die Reinheit der Gesamt-RNA. Die gelöste Gesamt-RNA wurde bei –80°C gelagert.

3.12 cDNA-Synthese

↓33

Für die cDNA Synthese wurden 2-5µg Gesamt-RNA eingesetzt (Gubler und Hoffmann, 1983; modifiziert). Zu der Gesamt-RNA wurde in einem ersten Schritt 1µl Oligo-(dt)12-18 Primer (0,5µg/µl) gegeben und für 10min bei 70°C denaturiert. Nach dem Denaturierungsschritt wurde die Probe auf 4°C abgekühlt, mit 4µl 5x First Strand Puffer, 2µl 0,1M DTT, 1µl dNTP-Mix (je 10mM dATP, dCTP, dGTP und dTTP in TE-Puffer) und 0,4µl Rnase Inhibitor (40U) versetzt und 2min bei 37°C inkubiert. Dem Reaktionsansatz fügte man anschließend 1µl SuperScript Reverse Transkriptase zu und inkubierte diesen für weitere 60 Minuten bei 37°C. Nach Zugabe von 60µl TE-Puffer erfolgte die Inaktivierung des Enzyms nach 10min bei 95°C.

3.13 Real-time RT-PCR

Das Prinzip und die Technik der real time RT-PCR wurde im Rahmen dieser Dissertation in der Arbeitsgruppe am iCycler (Biorad) etabliert.

In einem Reaktionsansatz für die real-time RT-PCR wurden zu der Ausgangs-cDNA (Template-cDNA) 2µl 10x SYBR PCR Puffer, 25mM MgCl2, 1,25mM dNTPs, 10pmol Primer (Tab.1) und 0,5U Ampli-Taq-Gold-Polymerase pipettiert. Mit PCR-H20 wurde der Ansatz auf ein Endvolumen von 20µl aufgefüllt. Ein Reaktionszyklus im iCycler setzt sich wie folgt zusammen:

↓34

  1. Denaturierung bei 95°C für 35 Sekunden
  2. Primer-Hybridisierung (Annealing) und Synthese für 45 Sekunden bei der primerspezifischen Annealingtemperatur

Die beiden Schritte wurden 40x wiederholt. Dem Zyklus geht eine Aktivierung der Ampli-Taq-Gold-Polymerase und eine vollständige Denaturierung der Ausgangs cDNA für
10 Minuten bei 95°C voraus.

Die Daten der real-time RT-PCR wurden in jedem Zyklus mehrfach bei der Annealing Temperatur aufgenommen. Anschließend wurde eine Schmelzkurvenanalyse durchgeführt. Dazu wurde eine Denaturierung bei 95°C für 30 Sekunden und darauf folgend ein Reanealing der PCR Produkte bei 55°C für 30 Sekunden durchgeführt. Die Schmelzkurve besteht aus 80 Zyklen von 55°C auf 95°C mit einer jeweiligen Temperaturerhöhung um jeweils 0,5°C für 7 Sekunden. Die Daten der Schmelzkurve wurden in jedem Zyklus bei einer Erhöhung um jeweils 0,5°C aufgenommen.

↓35

Tab. 1 : Auflistung der verwendeten Oligonukleotide für die real-time RT-PCR

Gen

Accession

Product
Length

Forward Primer (5´ 3`)

Reverse Primer (5´ 3`)

CK5

NM_000424

139bp

TGGTCTCCCGTGCCGCAGTTCTAT

ATTTGGGATTGGGGTGGGGATTCT

CK13

NM_002274

107bp

CCATGAAGAGGTGAGCGGGGATTG

CTGTGGGGATGGGAAAGGAAGATGTG

CK14

NM_000526

94bp

TGGCCGCGGATGACTTC

CTCGCTCTTGCCGCTCTG

CK18

NM_199187

170bp

AGCGCCAGGCCCAGGAGTATGAGG

TATCCGGCGGGTGGTGGTTCTTTTG

GAPDH

XM_006959

149bp

GGCGATGCTGGCGCTGAGTAC

TGGTCCACACCCATGACGA

3.13.1 Auswertung der real time RT-PCR

Die Analyse der PCR liefert digitale, während der PCR aufgenommene Daten. Aus einem Diagramm, in dem die Fluoreszenz (abgeglichen gegen die Hintergrundfluoreszenz) über die Zeit (in PCR Zyklen) aufgetragen ist, lässt sich der Threshold-Zyklus (Ct) bestimmen. Der Ct-Wert gibt an, in welchem Zyklus die Fluoreszenz einer Probe erstmalig deutlich über der Hintergrundfluoreszenz liegt. Es gilt: Je mehr Ziel-Gen in der Ausgangsprobe vorhanden ist, desto kleiner ist der Ct-Wert. Zudem ist der Ct-Wert abhängig von der Effektivität der PCR-Reaktion, welche hauptsächlich von der Primereffektivität beeinflusst wurde.

3.14 Durchflusszytometrische Analysen

3.14.1 Vorbereitung der Zellen

Primäre humane respiratorische Epithelzellen wurden wie unter 3.1 beschrieben isoliert, wobei anstatt eines Übernacht Verdaus bei 4°C das Gewebe 4h bei 37°C im Inkubator verdaut wurde. Mittels eines Percollgradienten trennte man anschließend die Erythrozyten von den Epithelzellen. Dazu wurden in einem 50ml Probenröhrchen 20ml Percoll mit einer Dichte von 1,077g/ml vorgelegt, mit 10ml der Zellsuspension überschichtet und 15min bei 900g ohne Bremse zentrifugiert. Nach dem Zentrifugationsschritt wurde der in der oberen Phase sichtbare weiße Ring, der die kernhaltigen Zellen enthält, abgenommen. Die so gewonnene Zellfraktion wurde mit PBS gewaschen, in ungefärbter Hank’s Salzlösung aufgenommen und die Zellzahl wie unter 3.5 beschrieben bestimmt.

3.14.2 Antikörperfärbung

↓36

Die zu untersuchenden Zellen wurden in eine PBS/BSA-Lösung (0,5% BSA in PBS gelöst)überführt und mit dem entsprechenden Antikörper versetzt, wobei ein Gesamtvolumen von 100µl erreicht wurde. Die Inkubation des Zell-Antikörper-Gemisches erfolgte unter Lichtausschluß bei Raumtemperatur für 30min. Die optimale Antikörperverdünnung wurde in einer Verdünnungsreihe ermittelt, man spricht hier vom Austitrieren des Antikörpers (Tabelle 2). Nach der Inkubation wurden die Zellen mit 1ml der PBS/BSA-Lösung gewaschen und 10min bei 510g und 4°C abzentrifugiert. Nach dem Waschschritt wurden die markierten Zellen in 250µl PBS/BSA-Lösung aufgenommen. Im direkten Anschluss an die Antikörpermarkierung erfolgt die Messung der PE-markierten Zellen am Durchflußzytometer. Die Zellen, die mit dem Biotin-gekoppelten Antikörper CD3 gefärbt wurden, wurden nachfolgend in einem zweiten Färbeschritt mit Streptavidin-PE (SA-PE) gefärbt. Dazu wurde SA-PE in einer 1:400 Verdünnung zu den markierten Zellen gegeben und 10min bei Raumtemperatur unter Lichtausschluss inkubiert. Danach wurde mit 0,5% PBS/BSA Lösung wie zuvor beschrieben gewaschen und die Zellen konnten in 250µl PBS/BSA-Lösung aufgenommen und am Fluoreszenz-durchflusszytometer gemessen werden.

Tab. 2 : Antikörperverdünnung für die Färbung der hREC für die Analyse am Durchflusszytometer

Primärantikörper

Verdünnung

CD49f – PE (Mouse, Anti-Human)

1:10

CD104 – PE (Mouse, Anti-Human)

1:200

CD104 – PE (Mouse, Anti-Human) für die Sortierung am FACS

1:75

CD3 – Biotin (Mouse, Anti-Human)

1:800

Streptavidin-PE1

1:400

1 Hierbei handelt es sich nicht um einen Antikörper sondern um die Sekundärfärbung für die Biotin-Streptavidin Kopplung

3.14.3 Vorarbeiten am Durchflusszytometer und Messung der Proben

Das Fluoreszenzdurchflusszytometer ist direkt mit einem Computer (Apple/MacIntosh; iMAC) zur digitalen Verarbeitung der Ergebnisse verbunden. Zunächst wurden die Kapillaren des Fluoreszenzdurchflusszytometers mit destillierten Wasser (Aqua bidest.) gespült. Danach wurde die Probe gemessen. Bei einer zweiten Messung der gleichen Probe wurden zusätzlich mit 2µl 0,1mg/ml Propidiumiodid (PI) zugegeben, das avitale Zellen anfärbte. Die Aufnahme der Ergebnisse erfolgte in einem Dot Plot bzw. in einem Density Plot, in dem zunächst die Rauhigkeit der Zellen (SSC) über der Größe der Zellen (FSC) aufgenommen und dargestellt wurde. Zusätzlich konnten nun die Detektoren, die Licht unterschiedlicher Wellenlängen detektieren, ausgewählt werden. So ließen sich die Proben unter geeigneter Anregungsenergie analysieren. Die aufgenommenen Daten wurden anschließend mit der Auswertungssoftware Cellquest der Firma BD Bioscience analysiert und als zweidimensionale Dot-Plot-Diagramme dargestellt.

3.14.4 Gwinnung der Basalzellen durch FACS

↓37

Für die Gewinnung der markierten Zellen mussten diese aus dem Zellgemisch separiert werden. Dazu wurden die primären hREC mit dem Antikörper CD104-PE in der Verdünnung 1:75 für eine halbe Stunde bei Raumtemperatur inkubiert und die markierten Zellen zur Sortierung eingesetzt. Da das für die Sortierung verwendete FACS nicht so sensitiv ist, wie das Durchflusszytometer, das zur Analyse von Zellen verwendet wurde, musste in diesem Fall der Antikörper in höherer Konzentration eingesetzt werden. Die separierten Zellen wurden anschließend in Reaktionsgefäßen aufgefangen und mit AECG-Medium in Zellkulturflaschen ausgesät und im Inkubator kultiviert.

3.15  In vitro Co-Kultursysteme

3.15.1 Co-Kultivierung von respiratorischen Epithelzellen und nativem Gelenkknorpel

Bei der Herstellung von Co-Kulturen wurden jeweils 5x105 humane respiratorische Epithelzellen in 10µl AECG-Medium resuspendiert und auf jeweils einen 0,5cm2 großen Gelenkknorpelchip, der zuvor in eine 12 Well-Platte gelegt wurde, getropft. Nach einer Inkubation von 3h bei 37°C im Brutschrank pipettierte man 1ml und nach 24h noch 1ml Nährmedium dazu. Die Kultivierungsdauer betrug 7 bzw. 14 Tage. Alle zwei Tage wurde ein Mediumwechsel vorgenommen. Nach dieser Zeit wurden die Co-Kulturen kryokonserviert und Kryoschnitte für die histologische Färbung angefertigt.

3.15.2 Co-Kultivierung von respiratorischen Epithelzellen und in vitro gezüchteten Knorpelpellets

Nach drei Wochen wurden die Knorpelpellets in 48-Well-Platten überführt und immobilisiert, indem sie mit jeweils 5µl Matrigel an den Boden der Zellkulturplatten geklebt wurden. 1x105 humane respiratorische Epithelzellen der Passage 1 wurden in AECG-Medium resuspendiert, auf jeweils ein Pellet aufgetropft und das Konstrukt für 30min bei 37°C im Brutschrank inkubiert. Im Anschluss wurde je 1ml AECG-Medium oder alternativ konditioniertes Medium zu den Konstrukten gegeben und über 14 Tage im Brutschrank kultiviert und für die anschließenden Färbungen mit den AK CD44v6 und 34ßE12 kryokonserviert.

3.15.3 Co-Kultivierung von respiratorischen Epithelzellen und humanen Knorpelzellen auf Kollagenmembranen

↓38

Die Kollagenmembran (Cellagen Disc) wurde durch einen Plastikring, auf dem kleine Füßchen befestigt sind, stabilisiert. Da die Membran auf der Unterseite mit Zellen besiedelt werden musste, legte man sie in eine 6-Well-Platte mit dem Plastikring nach oben und pipettiert 5x104 Chondrozyten pro 1,5ml RPMI-Medium auf die Membran. Nach 24 Stunden waren die Chondrozyten adhärent und das Cellagen Disc konnte durch Drehen mit einer sterilen Pinzette wieder in seine richtige Position gebracht werden. Nach Konfluenz der Chondrozyten (ca. 48h) wurde das RPMI Medium abgesaugt und eine Zellsuspension von 5x105 respiratorische Epithelzellen in 1,5ml AECG-Medium auf die Oberseite der Membran gesät. Die Unterseite wurde nun mit 2,5ml AECG-Medium gefüllt. Der Mediumwechsel erfolgte alle zwei Tage.

Der Zeitpunkt der Konfluenz der respiratorischen Epithelzellen wurde als Tag 0 definiert. Es wurden zwei Experimente durchgeführt, die parallel liefen. Im ersten wurde am Tag 0 der Co-Kultivierung das Medium oberhalb der Membran abgesaugt, sodass die respiratorischen Epithelzellen sich zum einen oberhalb in einer Gasphase befanden, zum anderen die Knorpelzellen unterhalb der Membran in einer flüssigen Phase (dem Nährmedium), verblieben. Man nennt diese Art der Kultivierung Air-Liqid-Interface Kultur. Im zweiten Experiment waren die respiratorischen Epithelzellen vollständig mit Medium bedeckt (Immersionskultur), wobei das Medium alle zwei Tage gewechselt wurde. Jeweils am Tag 0, 4 und 8 wurden die Co-Kulturen in Tissue Tek eingebettet und Kryoschnitte für die Histologie angefertigt.

3.15.4 Herstellung von Co-Kulturen aus nativen humanen Gelenk-knorpelchips und humanen respiratorischen Epithelzellen

Humane Gelenkknorpelchips mit einem Durchmesser von ca. 0,5cm wurden mit einer sterilen Pinzette in 24-Well-Platten gegeben. Auf die Knorpelchips wurde 1ml einer Fibroblastenzellsuspension mit einer Zelldichte von 1x106 Zellen/ml gegeben und 48h im Brutschrank mit RPMI-Kulturmedium inkubiert. Nach 24h erfolgte ein Mediumwechsel zu 3/4 des Gesamtvolumens an Kulturmedium. Nach 48h wurde das Kulturmedium vollständig entfernt und humane respiratorische Epithelzellen der Passage 1 mit einer Zelldichte von 1x106 Zellen/ml in einem Gemisch aus RPMI-Kulturmedium und AECG-Medium 1:1 (v/v) auf die Kulturen pipettiert. Alle 24h wurde das Medium wieder zu 3/4 abgesaugt und mit frischem RPMI-Kulturmedium/AECGM 1:1 (v/v) versetzt.

3.16 Immunhistochemische und histologische Untersuchungen

3.16.1 Kryo-Einbettung des Probenmaterials und Anfertigung von Kryoschnitten

↓39

Die Co-Kultur bzw. die Nasenmuschelspitze wurden mit Eindeckmedium luftblasenfrei in speziellen Plastikschalen eingebettet. Die so behandelten und anschließend langsam in flüssigem Stickstoff eingefrorenen Proben wurden bis zum Schneiden bei –80°C gelagert.

Das Schneiden der Kryoblöcke erfolgte am Kryostaten bei ca. –20°C. Die Schnittdicke betrug 6µm. Um eine gute Haftung der Gewebe auf einem Objektträger zu gewährleisten, benutzte man speziell behandelte Super Frost Plus Objektträger. Die Kryoschnitte wurden 24h bei Raumtemperatur getrocknet und entweder gleich gefärbt oder bei –20°C zusammen mit Silikagel (feuchtigkeitsminderndes Mittel) gelagert.

3.16.2 Fixierung von Air-Liquid-Interface und Chamber Slides Kulturen

Für die immunhistochemische und histologische Färbung von Zellen wurden Chamber Slides verwendet. Es handelte sich um Objektträger aus TPX-Permanox, auf die acht gleich große Kammern geklebt waren, die zum Eindecken leicht entfernt werden konnten. Die Zellen wurden wie in einer Zellkulturflasche im Monolayer bis zur Färbung kultiviert. Der Vorteil dieser Chamber Slides ist, dass man nur eine geringe Zahl an Zellen benötigt und zudem mehrere Antikörper gleichzeitig testen kann.

↓40

Unter den vielen Fixierungsmöglichkeiten hat sich die Fixierung mit einem Aceton/Methanol-Gemisch (1:1 v/v) für die zu untersuchenden Zellarten als optimal erwiesen.

Zunächst saugt man das Nährmedium ab, wäscht die Zellen 1x mit PBS-Puffer, überschichtet diese mit dem Aceton/Methanol-Gemisch und lässt die Zellen
10min bei Raumtemperatur inkubieren. Anschließend wurde das Gemisch abgesaugt und entweder beginnt man mit der immunhistochemischen Färbung, oder man überschichtet die ALI-Kulturen bzw. Chamber Slides mit PBS-Puffer und lagerte diese für 1-2 Tage bei 4°C

Diese Lagerung wurde notwendig, da Kulturen mit unterschiedlichen Kultivierungszeiten unter gleichen Bedingungen gefärbt werden sollten.

3.16.3 Alcian-Blau-Färbung

↓41

Die Alcian-Blau-Färbung dient zur Anfärbung saurer Mukopolysaccaride. Saure Polysaccharide befinden sich unter anderem in der Knorpelmatrix, die somit gut dargestellt werden kann.

Die aufgetauten Kryoschnitte, bzw. die Chamber Slides und Air-Liquid-Kulturen wurden mit 3%iger Essigsäure eingestellt und für 30min bei Raumtemperatur in einer Lösung aus 1%igem Alcian Blau 8GX in 3%iger Essigsäure inkubiert. Der pH-Wert soll etwa 2,5 betragen. Nach mehrmaligem Spülen in 3%iger Essigsäure und Waschen in Aqua dest. erfolgte die Gegenfärbung mit Kernechtrot (5g Aluminiumsulfat auf 100ml Aqua dest. + 0,1g Kernechtrot ) für 4-5min bei Raumtemperatur. Nach erneutem Spülen in Aqua dest. wurden die Schnitte bzw. die ALI-Kulturen in einer aufsteigenden Alkoholreihe entwässert und über Xylol in Kanadabalsam eingedeckt. Die Chamber Slides dagegen durften nicht mit Xylol in Berührung kommen und wurden deshalb nicht entwässert, sondern nach dem Spülen mit einem wässrigen Medium (Aquatex) eingedeckt.

3.16.4 Masson-Goldner Trichrom Färbung

Die Masson Goldner Trichromfärbung ist zur Darstellung von kollagenen Bindegewebsfasern geeignet, die sowohl in der Knorpelmatrix als auch in der Basalmembran vorhanden sind und grün angefärbt werden.

↓42

Die aufgetauten Kryoschnitte wurden kurz getrocknet und für 2min in einer Eisenhämatoxylinlösung nach Weigert (1:1 Gemisch aus 1% Hämatoxylin in 96% Ethanol und 1,16g Eisen(III)-Chlorid in 98ml Aqua dest. und 4ml 1N HCL) bei RT inkubiert. Anschließend wurde der überschüssige Farbstoff mit Leitungswasser ausgewaschen. Im zweiten Färbeschritt wurden die Kryoschnitte 5-10min in Säurefuchsin-Ponceau (0,2g Ponceau de Xylidine und 0,1g Säurefuchsin in 300ml Aqua dest. und 0,6ml Eisessig) gefärbt und mit 1%iger Essigsäure gespült. Zur Vorbereitung auf die nächste Färbung wurde der Kryoschnitt 15-30sec in Phosphormolibdänsäure-Orange G-Beizlösung (3,0g Phosphormolibdänsäure und 2g Orange G in 100ml Aqua dest.) gebeizt. Mit 1% Essigsäure wurde der Farbstoff fixiert und die Beizung unterbrochen. Darauf folgte die Färbung mit Lichtgrün (0,1g Lichtgrün in 100ml Aqua dest. und 0,2ml Eisessig) für 5min gefolgt von einem 5min Spülschritt mit 1% Essigsäure. In einem letzten Schritt wurden die Kryoschnitte drei Mal 5min mit 100% Alkohol entwässert und über Xylol in Kanadabalsam eingedeckt.

3.16.5 Hämatoxylin / Eosin Färbung

Diese Färbung dient als Übersichtsfärbung. Zellplasma stellt sich rosa dar, Zellkerne sowie Knorpelmatrix blau.

Nach 5min Fixierung der Kryoschnitte in Aceton/Methanol (1:1 v/v) wurden die Präparate 2-5min in Aqua dest. gespült und dann mit Hämalaun nach Meyer für 7-10min inkubiert. Nach kurzem Spülen der Kryoschnitte in Aqua dest. und 1% HCl-Ethanol erfolgt der Farbumschlag von violett nach blau unter fließendem Leitungswasser für ca. 30min. Anschließend wurden die Präparate kurz in Aqua dest. gespült und 4min mit Eosin (3g Eosin in 300ml 70% Ethanol) gefärbt. Nachfolgend wurden die Schnitte in 96% und 100% Ethanol entwässert und über Xylol in Kanadabalsam eingedeckt.

3.16.6 Immunhistochemische Färbungen

↓43

Als Detektionssystem wurde die DAKO EnVision HRP-Maus-AEC Methode gewählt. Dieses System basiert auf einem enzymmarkierten (HRP), wasserlöslichen Polymer, an das Sekundärantikörper (Ziege, Anti-Maus) konjugiert wurden. Die Vorteile gegenüber z.B. den Streptavidin-Biotin-Techniken sind die 2-Schritt-Methode und die höhere Sensivität.

Die aufgetauten Kryoschnitte bzw. die mit PBS-Puffer überschichteten Chamber Slides und die Air-Liquid-Interface-Kulturen wurden nach kurzer Trocknung 5min im kalten Aceton/Methanol-Gemisch fixiert. Vor dem Färben kamen alle Proben für ca. 30 min zum Trocknen in den Wärmeschrank bei 37°C.

Alle folgenden Schritte wurden in der feuchten Kammer durchgeführt. Da es sich bei der EnVision-Methode um ein Peroxidase-System handelt, musste die endogene Peroxidase mit 3%igem H2O2 geblockt werden (5min bei RT). Nach anschließendem Waschen in PBS-Puffer folgte die Proteinblockierung (20min RT) mit 10%igem Ziegenserum (da es sich um EnVision Ziege, Anti-Maus handelte), um eine unspezifische Hintergrundfärbung auszuschließen. Nach erneutem Waschen folgt die Inkubation mit den jeweiligen primären Antikörpern (Maus, Anti-Human) für 30min bei 37°C.

↓44

Zum Nachweis von Basalzellen in humanen respiratorischen Epithelzell-Kulturenwurden folgende monoklonale Antikörper eingesetzt:

Tab. 3 : Antikörperverdünnung für die immunhistochemische Färbung der hREC

Primärantikörper

Verdünnung

Maus, Anti-Human CD44v6

1:500

Maus, Anti-Human 34ßE12

1:50

Maus, Anti-Human CD49f

1:500

Maus, Anti Human CD104

1:500

Als Negativ-Kontrolle diente ein IgG1-Antikörper. Nach der Inkubation folgten drei Waschschritte mit PBS-Puffer.

↓45

Im nächsten Schritt wurde das gebrauchsfertige Polymer-Konjugat (Ziege, Anti-Maus) auf die Schnitte pipettiert und 30min bei 37°C inkubiert. Nach erneutem Waschen (3x) folgte die Substratumsetzung mit der Chromogen-Substrat-Lösung (AEC) für ca. acht bis zehn Minuten bei RT.

Zum Schluss erfolgte nach erneutem Waschen in Aqua dest. die Kernfärbung mit Hämatoxylin nach Meyer für 5min. Zum Bläuen der Zellkerne wurden die Proben bis zu 30min in Leitungswasser gestellt und anschließend mit einem wässrigen Medium (Aquatex) eingedeckt.

3.17 Rasterelektronenmikroskopie

Das native Gewebe und die Air-Liquid-Interface-Kulturen (ALI-Kulturen) wurden in 5% Glutaraldehyd in PBS für 2h bei RT fixiert. Anschließend wurden die Proben über eine aufsteigende Alkoholreihe für je 10 min von 50% bis 90% Ethanol (in 10% Schritten) und zuletzt in 100%igem Ethanol drei Mal 10min entwässert. Die Entwässerung wurde mit einer Kritisch-Punkt-Trocknung abgeschlossen, da die sonst verbleibenden Wassermoleküle ein Hochvakuum in der Probenkammer des Rasterelektronenmikroskops unmöglich machen würden. Bei der Kritisch-Punkt-Trocknung wurde die Restfeuchte der Proben durch mehrmaliges Spülen mit flüssigen C02 ersetzt. Die eigentliche Trocknung erfolgte danach bei 37,8°C und 50bar, wobei das C02 entfernt wurde, sodass die Probe beim Trocknungsvorgang nicht schrumpfte, sondern alle Strukturen erhalten blieben.

↓46

Es folgte das Beschichten der Proben mit Gold-Paladium (Schichtdicke 20nm) in einem Sputtergerät. Die Auswertung der Proben erfolgte an einem Rasterelektronenmikroskop unter Hochvakuum (10-5MPa). Im Rasterelektronenmikroskop können Oberflächen-strukturen dargestellt werden, sodass sich diese Methode zum Nachweis von Flimmerzellen und bedingt für Becherzellen eignet.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
23.11.2005