2 Material und Methoden

2.1 Material

2.1.1 Chemikalien

↓21

3-Morpholino-Propansulfonsäure (MOPS)

C. Roth GmbH & Co., Karlsruhe

5-Brom-4-Chlor-3-Indolyl-β-D-Galaktopyranosid (X-Gal)

C. Roth GmbH & Co., Karlsruhe

Agarose DNA™

Biozym Diagnostik GmbH, Hameln

Ammoniumeisen-III-citrat

Fluka-BioChemika, Steinheim

Ampicillin

Boehringer GmbH, Mannheim

Bacto-Agar

Difco, Detroit, USA

Bacto-Trypton

Difco, Detroit, USA

Bromphenolblau

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Chloramphenicol (Cm)

Boehringer GmbH, Mannheim

Chloroform

C. Roth GmbH & Co., Karlsruhe

Dextran

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Dikaliumhydrogenphosphat

C. Roth GmbH & Co., Karlsruhe

Dinatriumhydrogenphosphat

C. Roth GmbH & Co., Karlsruhe

Ethanol

C. Roth GmbH & Co., Karlsruhe

Ethidiumbromid

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Ethylendiamintetraessigsäure (EDTA)

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Formaldehyd

C. Roth GmbH & Co., Karlsruhe

Formamid

C. Roth GmbH & Co., Karlsruhe

Glukose

Merck, Darmstadt

Glycerol

C. Roth GmbH & Co., Karlsruhe

Hefeextrakt

Difco, Detroit, USA

Isopropanol

C. Roth GmbH & Co., Karlsruhe

Isopropylthio-β-D-Galaktosid (IPTG)

C. Roth GmbH & Co., Karlsruhe

Kaliumchlorid (KCl)

C. Roth GmbH & Co., Karlsruhe

Kalziumchlorid (CaCl2)

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Kanamycin (Km)

Boehringer GmbH, Mannheim

Magnesiumsulfat (MgSO4)

C. Roth GmbH & Co., Karlsruhe

Methanol

C. Roth GmbH & Co., Karlsruhe

MOPS

C. Roth GmbH & Co., Karlsruhe

N,N-Dimethylformamid (DMF)

Merck, Darmstadt

Natriumacetat

C. Roth GmbH & Co., Karlsruhe

Natriumchlorid (NaCl)

C. Roth GmbH & Co., Karlsruhe

Natriumhydroxid (NaOH)

C. Roth GmbH & Co., Karlsruhe

Natriumkarbonat (NaHCO3)

C. Roth GmbH & Co., Karlsruhe

Natriumnitrat (NaNO3)

C. Roth GmbH & Co., Karlsruhe

Phenol

C. Roth GmbH & Co., Karlsruhe

Salzsäure (HCl)

C. Roth GmbH & Co., Karlsruhe

Sodiumdodecylsulfat (SDS)

Serva Feinbiochemika GmbH & Co. KG, Heidelberg

Tetracyclin

Sigma-Aldrich Chemie GmbH, Deisenhofen

Tris

C. Roth GmbH & Co., Karlsruhe

Trizol

Gibco/BRL, Life Technologies, New York, USA

Zinksulfat

Merck, Darmstadt

Zitronensäure-Monohydrat

Chemapol, Prag, Tschechische Republik

2.1.2 Radiochemikalien

↓22

[α-32P]-dCTP

Spez. Aktivität: 110 Tbq mmol-1

Volumenkapazität: 370 Mbp ml-1

Amersham Pharmacia Biotech, Freiburg

2.1.3 Enzyme

AmpliTaq-Polymerase

Perkin Elmer, Warrington, GB

CIAP (calf intestine alkaline phosphatase)

MBI Fermentas GmbH, St. Leon-Rot

Klenow-Fragment (large)

MBI Fermentas GmbH, St. Leon-Rot

LA Taq-Polymerase

TAKARA Bio Europe S. A., Gennevilliers, Frankreich

Lysozym

GERMED, Berlin

Proteinase K

MBI Fermentas GmbH, St. Leon-Rot

Restriktionsendonukleasen

MBI Fermentas GmbH, St. Leon-Rot

New England Biolabs GmbH, Schwalbach

RNase A/T1-Mix

MBI Fermentas GmbH, St. Leon-Rot

SAP (shrimp alkaline phosphatase)

Amersham Pharmacia Biotech, Freiburg

T4-DNA Ligase

MBI Fermentas GmbH, St. Leon-Rot

Taq-Polymerase

Qiagen GmbH, Düsseldorf

2.1.4 Nukleinsäuren

Oligonukleotide

Eurogentec, Köln

Metabion GmbH, Martinsried

TiB molbiol, Berlin

Random Hexamers

PE Applied Biosystems, Weiterstadt

Lambda-DNA

MBI Fermentas GmbH, St. Leon-Rot

DNA-Marker

MBI Fermentas GmbH, St. Leon-Rot

↓23

Tab. 1: Verwendete Plasmide.

Plasmid

Eigenschaft

Bezugsquelle oder Referenz

pACYC184

AmpR, CmR

New England Biolabs GmbH, Schwalbach

pQE12

AmpR

Qiagen GmbH, Düsseldorf

pUC4K

AmpR, KmR

Pharmacia Biotech GmbH, Freiburg

puc19

AmpR

New England Biolabs GmbH, Schwalbach

pVZ321

IncQ, mob +, KmR, CmR

Zinchenko et al. (1999)

RP4

AmpR, KmR, TetR

Datta et al. (1971)

Tab. 2: Für PCR- und Sequenzierungsreaktionen eingesetzte Primer. Die Sequenzen sind in 5’-3’-Richtung angegeben. Die in den mutagenisierenden Primern ausgetauschten Nukleotide sind fett gedruckt und unterstrichen.

 

Name

Sequenz (5’ 3’)

Standardprimer

FW

ACGACGTTGTAAAACGACGGCCAG

 

RV

TTCACACAGGAAACAGCTATGAC

cph1-Primer

P1

TGCAGGAACCAGACCTCACC

 

P2

GGGATGGAGAAGTAGAATGTGG

 

Phy100left

CATCCAGAGTCGCCTAACG

 

Phy100right

CCGTCACTGTTGCGATGA

cph2-Primer

P3

CGGGATCCAACCCTAATCGATCCTTAG

 

P4

GAAGATCTAAGTTCCCCATCAACATG

 

cph2-5L

CGGGGCAAATAGAACGAAAT

 

cph2-3955R

GATAAGGGCCCTTAAAACAGG

 

cph2-3955L

CCTGTTTTAAGGGCCCTTATC

 

cph2-4900R

CCAAGGGGAAGGGATTAATTT

 

cph2HpaIFW

GGCAGAGGCAGTTAACAGAGCTGC

 

cph2MphRV

TCGTTTCCAATGCATACTGCCAGG

 

cph2SwaIFW

CTCCACCGTCACCGAAGTGAGGC

 

cph2Eco91IRV

GTAGCGGTTACCCACTTGGGTGAGGG

 

cph2-370RV

GACAACTATCCACTGTTGTGTAATGGC

 

cph2-490FW

GTAAACCCGGGCGATTTACCG

 

cph2-490RV

CGGTAAATCGCCCGGGTTTAC

 

cph2-560FW

CTGGCCATTACCCAGTCC

 

cph2-640FW

GTATGGCGATCGTCCGGAAACC

 

cph2-1150RV

AGGAAAGACGGGGCAGAATA

 

cph2-1820RV

CCAACGTCAGGCGATCG

 

cph2-3500FW

GCCAAAAGACCAACGGATTTAG

Mutagenisierende

C129

CAGTGGATAG CGC TCATATTCAATATCTCC

Primer:

cph2-129RV

GGAGATATTGAATATGA GCG CTATCCACTG

 

C1022

GACTTGGCGGAC GT CCACAAGGAGTTAC

 

cph2-1022RV

GTAACTCCTTGTGG AC GTCCGCCAAGTC

Weitere Primer

16S100left

aagtcatcatgccccttac

 

16S100right

atgggattcgcttactctc

 

pilA(+)

cggtgtattggctgctat

 

pilA(-)

ttcagcaccaccacaatcat

 

slr0359FW

GGACAAGGGAGGAAAGACCT

 

slr0359RV

CTATCCCCATGGCATTCTGT

 

slr0846FW

GATGGGCAAGGATGGCTTCT

 

slr0846RV

TTAGCCCGATCGCCTAACAA

 

slr1693FW

TAAGGCCGGGGAAATTAGTC

 

slr1969FW

atttctccccaccattatgc

 

slr1969RV

tcctgctggatactctgcac

 

sll0041FW

GCGCTCTTTTTACTGGGTTG

 

sll0041RV

GTCTGGGTCACCGATTCACT

 

sll1553FW

GTAAACATGACCCGGAGTGG

 

sll1629FW

CAAGCTTTCAATCCTTTTGCTT

 

sll1629RV

TGCCCAGATTGCACTAATTG

 

ISY100FW

TTTAAGGCAAAGGGTAGTAGCTT

 

ISY100RV

CGCCACAGTAAGAACGGATA

 

ISY120FW

TGAGCGTGTTACTGGGAGACT

 

ISY120RV

GTATGAGAGGCGCCAGTTG

 

ISY203FW

TAGACCAGAGCCAGACAAGC

 

ISY203L-RV

GCTTGTCTGGCTCTGGTCTA

 

ISY352FW

TCAAGAGAAAAACCTTCCCAGA

 

ISY352RV

TTTTTGATTCCACCAAGGATG

 

ISY391FW

CAAAGACAAGAGAGGCGAAAA

 

ISY391RV

TCCAAAACATGAGCAAATGG

 

ISY508FW

TTTCATCGAGAGTGGTGGTG

 

ISY508RV

AGTACCGGAAGGTGCGTACA

 

ISY523FW

ACAGCACGGACATCACAGAT

 

ISY523RV

CAAGCCTTTGAAGCATGAGA

 

ISY802FW

TATGCGAGCGGTTTGTAATG

 

ISY802RV

TAGCAGAAAGACGACGCAAC

 

pVZ321-Km1403

GAAGGATCAGATCACGCATCTTCCCGAC

2.1.5 Kits

DNAfree kit

Ambion, Austin, Texas, USA

HexaLabel™DNA Labeling Kit

MBI Fermentas GmbH, St. Leon-Rot

High Pure Plasmid Isolation Kit

Roche Diagnostics GmbH, Mannheim

Jet-Sorb Gel Extraction Kit

Genomed GmbH, Bad Oynhausen

Omniscript

Qiagen GmbH, Düsseldorf

pGEM-T Vector System I

Promega Corporation, Madison, USA

Qiagen Gel Extraction Kit

Qiagen GmbH, Düsseldorf

Qiagen Plasmid Midi Kit

Qiagen GmbH, Düsseldorf

Qiagen Plasmid Mini Kit

Qiagen GmbH, Düsseldorf

Qiagen Taq DNA Polymerase PCR Kit

Qiagen GmbH, Düsseldorf

Qiaquick PCR Purification Kit

Qiagen GmbH, Düsseldorf

Ready Reaction BigDye Terminator Kit

PE Applied Biosystems, Weiterstadt

SYBR-Green Kit

PE Applied Biosystems, Weiterstadt

2.1.6 Filter und Membranen

↓24

Hybond™ N+- Membranen

Amersham Pharmacia Biotech, Freiburg

HATF-Nitrozellulose Membranen

Millipore Corporation, Bedford, USA

3MM-Filterpapier

Whatman Paper Ltd., Maidstone, GB

PTFE - Filter

Millipore Corporation, Bedford, USA

Filter (0,25 µm Porengröße)

Schleicher & Schüll, Dassel

2.1.7 Technische Geräte

Aquarium Durchlüfter ELITE 800

HAGEN, Holm

Automatischer Sequenzierer: ABI Prism 377 DNA Sequencer

PE Applied Biosystems, Weiterstadt

Brutschrank

Qiagen GmbH, Düsseldorf

Elektrophoresekammer Modelle MPH und QSH

International Biotechnologies Inc. (IBI), New Haven, USA

Elektrophoresekammer, Modell Medigel

Genofit SA, Grand-Lancy, Frankreich

Feinwaage

Sartorius AG, Göttingen

Gene Amp® 5700 Sequence Detection System

PE Applied Biosystems, Weiterstadt

GS Gene Linker™ UV Chamber

BioRad Labratories, Richmond, USA

Heizblock SHT1

Stuart Scientific Co. Ltd., GB

HPLC

Waters GmbH, Eschborn

Hybridisierungsofen

Bachofer GmbH, Reutlingen

Kühlzentrifuge J2-21M, Rotoren JA-20, JA-14

Beckman Instruments Inc., Fullerton, USA

Kühlzentrifuge Biofuge fresco

Heraeus, Hanau

Laborwaage MC1

Sartorius AG, Göttingen

Laminarbox

Nuaire, Plymouth, USA

Kühlzentrifuge Megafuge 1,0 R

Heraeus, Hanau

Peltier Thermal Cycler PTC-200

Biozym Diagnostik GmbH, Hameln

pH-Meter Phi32

Beckman Instruments Inc., Fullerton, USA

Phospho-Imager Personal Molecular Imager FX

BioRad Labratories, Richmond, USA

Reinstwasseranlage Milli-RO 10/Milli-Q Plus

Millipore Corporation, Bedford, USA

RNA/DNA Calculator Gene Quant II

Amersham Pharmacia Biotech, Uppsala, Schweden

Sauerstoffelektrode

Rank Brothers Ltd., Bottisham, GB

Schreiber L200E

Linseis GmbH Meßgeräte GmbH, Selb

Spektrofluorimeter Fluorolog FL-112

Jobin-Yvon, Longjumeau, Frankreich

Spektrophotometer M500

Carl Zeiss Jena GmbH, Jena

Spektrophotometer Lambda35

PerkinElmer Instruments, Shelton, USA

Stromversorgungsgerät Power Pack 300

BioRad Labratories, Richmond, USA

Tischzentrifuge Sorvall MC 12C

DuPont de Nemours (Deutschland) GmbH, Bad Homburg

Transilluminator TFP-35M, 312 nm

Bioblock Scientific, Illkirch, Frankreich

Vakuum-Blotter Modell 785

BioRad Labratories, Richmond, USA

Vortex Genie 2™

Bender & Hohlbein AG, Zürich, Schweiz

Die Beschreibung der Belichtungsanlage sowie die verwendeten Lichtmessgeräte finden sich in den Kapiteln 2.2.5.1 und 2.2.6.

2.1.8 Verwendete Bakterienstämme

2.1.8.1  Stämme von Synechocystis

↓25

Die Photorezeptormutanten wurden in Synechocystis sp. PCC 6803 hergestellt, einem fakultativ photoheterotrophen Cyanobakterium der Ordnung Chroococcales mit natürlicher Kompetenz zur Transformation und sporadisch auftretender Motilität. Das Genom besitzt eine Größe von 3,57 Mbp mit annotierten 3168 ORFs (Kaneko et al., 1996).

Der von uns hauptsächlich verwendete WT-Stamm von Synechocystis sp. PCC 6803 wurde von der Arbeitsgruppe S.V. Shestakov (Staatliche Universität Moskau, Lehrstuhl für Genetik, Russland) zur Verfügung gestellt. Für die Analyse der IS-Elemente wurden Varianten von Syne chocystis sp. PCC 6803 aus verschiedenen Laboratorien eingesetzt. Diesen WT-Varianten wurden Nummern zugeordnet. Eine Aufschlüsselung der WT-Stämme nach Nummer und Bezugsquelle findet sich in Tab. 3. Die zu Beginn der Arbeiten vorhandenen Mutanten echter oder potentieller Photorezeptorgene sind in Tab. 4 aufgelistet.

Tab. 3: Bezugsquellen verschiedener WT-Stämme. Diese wurden für die Analyse der IS-Elemente im Synechocystis-Genom sowie für Motilitätsuntersuchungen eingesetzt. Die in dieser Tabelle aufgestellte Nummerierung der WT-Stämme stimmt mit der in Kap. 3.5 des Ergebnisteils überein. Die Nr. 6 entspricht dem WT, der für die Inaktivierung der Gene cph1 und cph2 verwendet wurde.

Nummer des WT-Stammes

Bezugsquelle

1

F. Chauvat, Service de Bioénergétique, Département de Biologie Joliot Curie, CEA Saclay, France

2

A.R. Grossman, Carnegie Institution of Washington, Department of Plant Biology, Stanford, USA

3

Kazusa Research Institute, Japan

4

R. Rippka, Institut Pasteur Paris, France

5

M. Hagemann, Universität Rostock, FB Biowissenschaften, Pflanzenphysiologie

6

S.V. Shestakov, Staatliche Universität Moskau, Abteilung für Genetik, Russland

7

D. Scanlan, University of Warwick, Department of Biological Sciences, UK

8

W. Vermaas, Arizona State University, Department of Plant Biology and Center for the Study of Early Events in Photosynthesis, USA

↓26

Tab. 4: Photorezeptormutanten von Synechocystis. Diese Mutanten waren bereits zu Beginn dieser Arbeit vorhanden.

Gen

Bezeichnung

Antibiotika kassette

Einbauort

Verwendung

cph1 (slr0473)

cph1 -

Cm

BalI-BalI

(sense-Ausrichtung)

Wachstumsanalyse, Konstruktion einer cph1 - / cph2 - -Doppelmutante

cph2 (sll0821)

cph2 -

Cm

StuI

(anti sense-Ausrichtung)

Wachstumsanalyse, Konstruktion einer cph1 - / cph2 - -Doppelmutante

plpA (sll1124)

plpA -

Km

EcoRI-EcoRI

Phototaxisexperimente

sll1473

1473 -

Cm

BsaBI

Phototaxisexperimente

slr1393

1393 -

Cm

BsaBI-BsaBI

Phototaxisexperimente

Für die Insertion der Antibiotikaresistenzgen-Kassetten zur Herstellung der in Tab. 4 aufgeführten cph1 - (Cm)- und cph2 - (Cm)-Mutanten wurden folgende Konstrukte verwendet:

Das PCR-Produkt von cph1 wurde in den puc57-Vektor (Fermentas) kloniert. Cph2 wurde in den pQE12-Vektor (Qiagen) eingefügt. Diese Konstrukte wurden ebenfalls zur Insertion der Km-Kassette verwendet. Eine detailliertere Beschreibung der Mutagenese von slr0473 (cph1) und sll0821 (cph2) findet sich in Wilde et al. (2002). Die Konstruktion der plpA - -Mutante wurde in Wilde et al. (1997) beschrieben.

2.1.8.2 Stämme von E. coli

↓27

Für Klonierungen wurden folgende Stämme von E. coli verwendet:

2.2 Methoden

2.2.1  Allgemeine Kultivierungsbedingungen der Mikroorganismen

Die Kultivierung von E. coli erfolgte unter Standardbedingungen (Sambrook et al., 1989). E. coli wurde bei 37 °C entweder als Flüssigkultur in LB-Medium (1 % (w/v) Trypton, 0,5 % (w/v) Hefeextrakt, 1 % (w/v) NaCl) auf einem Schüttler (220 rpm) oder auf einem LB-Festmedium (LB-Medium, 1 % (w/v) Bacto-Agar) angezogen. Je nach Bedarf wurden dem Medium Antibiotika mit folgenden Endkonzentrationen zugefügt: Ampicillin (50 µg ml-1), Chloramphenicol (Cm, 25 oder 30 µg ml-1), Kanamycin (Km, 40 µg ml-1) und Tetracyclin (12,5 µg ml-1).

↓28

Die Anzucht von Synechocystis erfolgte photoautotroph in BG11-Medium (Rippka et al., 1979) unter kontinuierlichen Weißlicht-Bedingungen (WL, 30 µmol m-2 s-1) bei 30 °C. Für die Stammhaltung und Selektion von Mutanten wurde Synechocystis auf 0,7 % Bacto-Agar in BG11-Medium kultiviert. In Kolben gehaltene Flüssigkulturen wurden mit 100 bis 150 rpm geschüttelt. Die Endkonzentration der eingesetzten Antibiotika betrug 40 µg ml-1 für Km und 7 µg ml-1 für Cm.

Die Kultivierungsbedingungen in Zusammenhang mit der Analyse des Wachstums und der Untersuchung der lichtinduzierten Motilität sind gesondert in den Kapiteln 2.2.5.1 bzw. 2.2.6.1 beschrieben.

2.2.2 Konstruktion von Mutanten in Synechocystis

2.2.2.1  Allgemeine Methoden

Die elektrophoretische Auftrennung der DNA in Agarosegelen wurde nach Sambrook et al. (1989) durchgeführt. In Abhängigkeit von der Fragmentlänge der DNA wurden 0,8 %ige bis 1,5 %ige (w/v) TAE(1x)-Agarosegele mit TAE (40 mM Tris/Acetat, 1 mM EDTA pH 8,0) als Laufpuffer eingesetzt. Zur Sichtbarmachung der DNA wurde den Agarosegelen 0,001 % Ethidiumbromid zugesetzt. Die Beladung der Gele mit DNA erfolgte mittels eines Ladepuffers (30 % (v/v) Glycerin, 0,5 % (w/v) Bromphenolblau, 0,5 % (w/v) Xylencyanol).

↓29

Die Amplifikation von Genen bzw. Genabschnitten erfolgte nach der Methode der Polymerasekettenreaktion (PCR). Für die Herstellung von Konstrukten zur Erzeugung von Defektmutanten in Synechocystis sowie für die Gewinnung von DNA-Sonden wurde die Taq-Polymerase von Qiagen eingesetzt. Zur Synthese von möglichst fehlerfreien DNA-Abschnitten wurde die LA-Taq-Poylmerase von TAKARA verwendet. Die Zusammensetzung der Reaktion sowie das Temperatur-Zeit-Programm für die Inkubation im Peltier Thermal Cycler PTC-200 (Biozym) richtete sich nach den Empfehlungen des Herstellers. Die eingesetzten Primer sind in Tab. 2 aufgelistet. Die erzielten PCR-Produkte wurden unter Verwendung des Qiaquick PCR Purification Kit (Qiagen) nach dem Protokoll der Erzeugerfirma von den Primern abgetrennt.

Die aufgereinigten PCR-Produkte wurden unter Verwendung des pGEM-T Cloning Kit (Promega) in den Vektor pGEM-T eingebaut.

Der Verdau der DNA durch entsprechende Restriktionsenzyme sowie die Elution der gewünschten DNA-Fragmente aus Agarosegelen unter Verwendung geeigneter Kits (Qiagen Gel Extraction Kit, Qiagen; Jet-Sorb Gel Extraction Kit, Genomed) wurde nach den Angaben der Hersteller ausgeführt. Zum Auffüllen von 5’-Überhängen wurde das Klenow-Fragment (large, Fermentas) und dNTP’s entsprechend des Firmenprotokolls eingesetzt. Zur Reduktion der Anzahl falschpositiver Klone wurden die Enden geschnittener Vektoren mittels SAP (USB) oder CIAP (Fermentas) gemäß den Herstellerangaben dephosporyliert.

↓30

DNA-Fragmente wurden mittels T4-DNA-Ligase (Fermentas) ligiert. Die eingesetzten Mengen an Vektor und Insert orientierten sich an folgender Gleichung:

 

Ligationsansätze wurden nach Sambrook et al. (1989) in chemisch kompetente Zellen des E. coli-Stammes XL1-blue transferiert, die nach der CaCl2-Methode (Sambrook et al., 1989) hergestellt wurden. Transformierte Zellen wurden mittels Zugabe der entsprechenden Antibiotika selektiert. Im Fall der Klonierung von PCR-Produkten wurden positive Klone über Blau-Weiß-Selektion durch den Zusatz von 40 µl IPTG (20 mg ml-1 in H2O) und 40 µl X-Gal (20 mg ml-1 in DMF) identifiziert.

↓31

Die Isolation der Plasmide ist in Kapitel 2.2.3.2 beschrieben.

2.2.2.2 Konstruktion von Mutanten durch ortsgerichteteMutagenese

Zusätzlich zu den Deletions- bzw. Insertionsmutanten des cph2-Gens wurden Mutanten erzeugt, bei denen das chromophorbindende Cystein über ortsgerichtete Mutagenese durch eine andere Aminosäure ausgetauscht wurde.

Die ortsgerichtete Mutagenese wurde durch eine PCR mit mutagenisierenden Primern kombiniert mit Primern (Tab. 2), die an bereits vorhandene Restriktionsschnittstellen binden, erzielt (Abb. 6). Das cysteinkodierende Kodon innerhalb der mutagenisierenden Primer wurde so verändert, dass neben einer neuen Aminosäure auch eine neue Restriktionsschnittstelle zum vereinfachten Aufspüren der gewünschten Klone entstand (Eco47III für GAF1 und AatII für GAF3). In einer ersten PCR (Taq-Polymerase, Qiagen) wurden zwei kurze Fragmente upstream sowie downstream vom Mutagenisierungsort amplifiziert. Diese beiden Fragmente wurden als template zusammen mit den beiden äußeren Primer in einer zweiten PCR eingesetzt. Aufgrund der überlappenden Bereiche im Mutagenisierungsort wurden die beiden kürzeren Fragmente zu einem neuen verlängertem Produkt verschmolzen. Das neu synthetisierte Produkt wurde in den pGEM-T-Vektor eingebaut. Mit Hilfe der beiden vorhandenen Schnittstellen wurde das mutationstragende Fragment gegen das entsprechende WT-Fragment über Restriktionsverdau ausgetauscht.

↓32

Abb. 6 : Position der Primer für die Konstruktion von cph2 -Mutanten mittels ortsgerichteter Mutagenese. Das chromophorbindende Cystein im N-terminalen Bereich wurde durch ein Alanin ausgetauscht, das Cystein im C-terminalen Bereich durch ein Valin.

2.2.2.3 Erstellen einer Mini-Genbank

Für die Herstellung einer Mini-Genbank von Synechocystis wurde die chromosomale DNA mit einem geeigneten Restriktionsenzym geschnitten. Die fragmentierte DNA wurde anschließend elektrophoretisch aufgetrennt. DNA-Banden im gewünschten Größenbereich wurden aus dem Agarosegel ausgeschnitten und eluiert (Kap. 2.2.2.1; Qiagen Gel Extraction Kit). Das eluierte Fragment wurde in den mit dem gleichen Restriktionsenzym linearisierten puc19-Vektor (New England Biolabs) inseriert. Mit dem gewonnenen Konstrukt wurde anschließend E. coli transformiert. Die Auffindung des gewünschten Klones erfolgte über Kolonie-Hybridisierung (Kap. 2.2.4.3). Nach Vermehrung der Plasmid-DNA wurde diese sequenziert und für weitere Klonierungen eingesetzt.

2.2.2.4 Transformation von Synechocystis

Die Transformation erfolgte nach einer von Ermakova et al. (1993) beschriebenen Methode.

↓33

Die Zellen wurden durch Zentrifugation (4500 rpm, 7 min, 25 °C) aus 5 ml Kultur in der exponentiellen Wachstumsphase geerntet und in ca. 100 µl BG-11 aufgenommen. Anschließend wurden 5 bis 10 µg Plasmid-DNA der Zellsuspension zugefügt. Das resultierende Gemisch wurde für 3 bis 4 h im Licht bei Raumtemperatur inkubiert und während dieser Zeit mehrfach invertiert. Nach Ablauf der Inkubationszeit wurde das Gemisch auf ein antibiotikafreies BG-11-Festmedium (2.2.1) ausplattiert und bei 28 °C und 10 µmol m-2 s-1 inkubiert. In Abhängigkeit vom Selektionsantibiotikum wurde nach 24 h 10 µg ml-1 Km oder nach 48 h 2,5 µg ml-1 Cm unter einen Teil der Agarplatte zugegeben, so dass durch langsames Diffundieren des selektiven Agens ein Konzentrationsgradient entstand. Nach 10 bis 14 Tagen wurden die Transformanten vereinzelt und auf Festmedien mit schrittweise steigender Antibiotikumkonzentration bis zum Erreichen des Endwertes von 40 µg ml-1 für Km und 7 µg ml-1 für Cm überführt.

2.2.2.5 Konjugation

Der konjugale Transfer der Plasmid-DNA erfolgte über eine sogenannte „Drei-Eltern-Kreuzung“. Als Cargo-Plasmid wurde das sich in Synechocystis autonom replizierende, mob + -tragende pVZ321-Plasmid (in E. coli-Stamm XL-1 blue) verwendet. Als konjugatives Plasmid diente RP4 (in E. coli-Stamm J53).

In Vorbereitung der Konjugation wurden jeweils 0,25 ml einer Übernachtkultur von J53/RP4 und XL1-blue/pVZ321 in einer Zwischenkultur (10 ml LB-Medium mit den entsprechenden Antibiotika; 2,5 h, 37°C, Schüttler) vermehrt. Nach Abzentrifugieren der E. coli-Zellen (5 min, 2500 rpm, Raumtemperatur) wurde das Pellet in 1 ml LB-Medium aufgenommen. Beide E. coli-Stämme wurden anschließend im Verhältnis 1:1 gemischt, abzentrifugiert (2500 rpm, 5 min, Raumtemperatur) und das Zellpellet in 0,1 ml LB-Medium aufgenommen. Während des folgenden Inkubationsschrittes (1h, 30°C) wurde das konjugative RP4-Plasmid in den XL1-blue/pVZ321-Stamm transferiert. Nach Ablauf der Inkubation wurden 1,9 ml einer Synechocystis-Kultur (OD 0,6-0,8) der E. coli-Suspension zugefügt, abzentrifugiert (2500 rpm, 5 min, Raumtemperatur) und das resultierende Zellpellet in 30 µl BG11-Medium resuspendiert. Anschließend wurde das Synechocystis/E. coli-Gemisch auf einen HATF-Filter (auf BG11-Festmedium mit 5 % LB-Medium platziert) aufgetropft. Nach 2 d Wachstum wurden die Zellen auf eine 3 µg ml-1 Cm enthaltende Selektionsplatte transferiert.

2.2.3 Isolation von Nukleinsäuren

2.2.3.1  Isolation der Gesamt-DNA aus Synechocystis

↓34

Die Gesamt-DNA wurde nach Franche und Damerval (1988) isoliert. Hierfür wurden ca. 200 ml einer Synechocystis-Kultur am Ende der logarithmischen Wachstumsphase abzentrifugiert (6000 rpm, 7 min, 4 °C). Die geernteten Zellen wurden zweimal in 40 ml TE-Puffer (10 mM Tris/HCl, 1 mM EDTA, pH 8,0) gewaschen. Für einen osmotischen Schock der Zellen wurde das Zellpellet in 4 ml TES-Puffer (25 % (w/v) Saccharose, 50 mM Tris/HCl, 1 mM EDTA, pH 8,0) resuspendiert und der gesamte Ansatz kurzzeitig in flüssigem Stickstoff eingefroren. Die Zellen wurden während einer einstündigen Inkubation bei 37 °C nach Zugabe von 5 mg ml-1 Lysozym und 100 mM EDTA aufgeschlossen. Anschließend wurde das Zelllysat für 1 h bei 60 °C (alternativ: 16 h und 37 °C) mit 3,2 U Proteinase K (Fermentas) und 2 % SDS behandelt. Die Nukleinsäuren wurden mit Phenol/Chloroform (1:1 (v/v)) von den Zellresten extrahiert. Hierfür wurden gleiche Volumina von Zellextrakt und Phenol/Chloroform gemischt. Die obere Phase wurde nach 15minütiger Zentrifugation (6000 rpm, 4 °C) abgezogen und erneut mit Phenol/Chloroform gereinigt. Eventuelle Phenolreste in der wässrigen Phase wurden nach Zugabe von Chloroform im Verhältnis 1:1 und anschließender Zentrifugation (6000 rpm, 15 min, 4 °C) beseitigt. Die DNA wurde mit 0,7 Volumen Isopropanol präzipitiert (Inkubation für 5 min bei Raumtemperatur; Zentrifugation: 13000 rpm, 30 min, 4 °C). Das gewonnene DNA-Pellet wurde mit 1 ml 70 %igem (v/v) Ethanol gewaschen und für 1 h luftgetrocknet. Die DNA wurde in 30 bis 100 µl TE-Puffer aufgenommen. Die Beseitigung der RNA erfolgte enzymatisch mittels 2 µl RNase A/T1-Mix (Fermentas) (30 min, 37 °C; Hitzeinaktivierung: 10 min 72 °C).

2.2.3.2 Isolation von Plasmid-DNA aus E. coli und Synechocystis

Die Plasmid-DNA wurde mittels alkalischer Lyse isoliert (Sambrook et al., 1989). High-copy-Plasmide wurden aus Zellpellets (5000 rpm, 7 min, 4 °C) von 3ml-Übernachtkulturen extrahiert. Die alkalische Lyse erfolgte unter Verwendung der entsprechenden Puffer aus kommerziellen Kits (Qiagen Plasmid Mini Kit, Qiagen GmbH; High Pure Plasmid Isolation Kit, Roche Diagnostics GmbH) nach dem von der Firma empfohlenen Protokoll. Die Plasmid-DNA wurde durch Zugabe von 0,7 Volumen Isopropanol gefällt und wie in Kap.2.2.3.1 beschrieben behandelt. Zur Sequenzierung bestimmte Plasmid-DNA wurde über Säulen aus dem Qiagen Plasmid Mini Kit (Qiagen GmbH) nach dem entsprechenden Protokoll der Hersteller-Firma gereinigt.

Low-copy-Plasmide wurden mit dem Qiagen Plasmid Midi Kit (Qiagen GmbH) aus Zellpellets von 50ml-Kulturen gewonnen.

↓35

Für die Präparation des pVZ321-Plasmides aus Synechocystis wurden die Zellen aus 400 ml Kultur (OD ca. 0,8 bis 1,5) durch Zentrifugation (6000 rpm, 10 min, 4 °C) geerntet. Das Zellpellet wurde zweimal in 50 ml TE-Puffer gewaschen. Anschließend wurden die Zellen in 3 ml TES-Puffer resuspendiert und nach Zugabe von 5 mg ml-1 Lysozym und 100 mM EDTA lysiert (Inkubation: 30 min, 37 °C). Nach einer 10minütigen Inkubation auf Eis wurde dem Lysat 2 % SDS zugegeben und der Reaktionsansatz für weitere 10 min auf Eis gelagert. Dem folgte die Zugabe von 0,2 M KCl und eine Inkubation für 10 min auf Eis. Nach Zentrifugation des Zelllysates (6000 rpm, 15 min, 4 °C) wurde der Überstand mit Phenol/Chloroform, wie in Kap. 2.2.3.1 beschrieben behandelt und die DNA mittels Isopropanol gefällt (siehe Kap. 2.2.3.1). Neben der Plasmid-DNA enthielt das Präparat auch chromosomale DNA.

2.2.3.3 Präparation von RNA aus Synechocystis

Für die Isolation von RNA wurden Zellkulturen aus der exponentiellen Wachstumsphase für 1 oder 2 h unter verschiedenen Lichtbedingungen inkubiert. Unmittelbar nach Ablauf der Belichtungszeit wurden ca. 25 ml Zellkultur zu einer ähnlichen Menge Eis gegeben und abzentrifugiert (5000 rpm, 5 min, 4 °C). Das Zellpellet wurde sofort in flüssigem Stickstoff eingefroren und bis zum Zellaufschluss bei -80 °C gelagert. Für die Untersuchung der mRNA-Menge von pilA1/pilA2 wurden die Synechocystis-Zellen direkt von Platten aus den Motilitätsexperimenten (Kap. 2.2.6.1) gewonnen, die unter konstanten Lichtbedingungen gehalten wurden. Die auf diesem Weg gewonnen Zellen wurden ebenfalls sofort in flüssigem Stickstoff eingefroren und bei -80 °C aufbewahrt.

Die Gesamt-RNA aus Synechocystis wurde mit Trizol nach den Instruktionen der Herstellerfirma isoliert. Das Zellpellet wurde mit 1 ml Trizol in Mörserbechern, die vorher mit flüssigem Stickstoff gekühlt wurden, pulverisiert. Nach einer 20 bis 30 minütigen Inkubation bei Raumtemperatur wurde der Reaktionsansatz mit 200 µl Chloroform intensiv vermischt. Die Proben wurden zunächst bei Raumtemperatur für 15 min gelagert und anschließend abzentrifugiert (13000 rpm, 15 min, 4 °C). Die entstandene obere Phase wurde abgenommen und die RNA mit 0,7 Volumen Isopropanol präzipitiert (Zentrifugation: 13000 rpm, 30 min, 4 °C). Das RNA-Pellet wurde mit 70 %igen (v/v) Ethanol gewaschen und nach Lufttrocknung in 20 bis 40 µl RNase-freiem Wasser gelöst.

↓36

Die für die Reverse Transkription bestimmte RNA wurde nach einem leicht modifizierten Protokoll isoliert. Das Zellpellet wurde in 2 ml Trizol pulverisiert und die Menge an Chloroform auf 400 µl verdoppelt.

2.2.3.4 Spektrophotometrische Bestimmung von Nukleinsäure-Konzentrationen

Die Ermittlung der Konzentration von DNA und RNA erfolgte über die Messung der Optischen Dichte (OD) an einem Spektrophotometer (RNA/DNA Calculator Gene Quant II, Amersham) bei einer Wellenlänge von 260 nm. Zur Berechnung der Nukleinsäure-Konzentration wurden die Umrechnungsfaktoren für doppelsträngige DNA (1 OD entspricht 50 µg ml-1) sowie für RNA (1 OD entspricht 40 µg ml-1) einbezogen. Die Reinheit der Nukleinsäuren wurde über den Quotienten aus der Bestimmung der OD bei 260 und 280 nm abgeschätzt.

2.2.4 Analyse von Nukleinsäuren

2.2.4.1 DNA-Sequenzierung

Die Sequenzierung der DNA erfolgte nach der Kettenabbruch-Methode (Sanger et al., 1977). Die Sequenzierungsreaktion wurde unter Verwendung des Ready Reaction BigDye Terminator Kits (PE Applied Biosystems) nach Herstellervorgaben angesetzt und enthielt in Abhängigkeit von der Plasmidgröße 0,7 oder 1 µg DNA sowie 1 µM Primer (Tab. 2). Nach Ablauf der Synthesereaktion wurde die DNA durch Zugabe von 1 Volumen Präzipitationspuffer (30 µg ml-1 Dextran, 50 mM EDTA) sowie 96 %igem Ethanol im Verhältnis 10:1 gefällt. Das nach Zentrifugation (13 000 rpm, 30 min, 15 °C) entstandene Pellet wurde in 150 µl 70 %igem (v/v) Ethanol gewaschen und in 1,7 µl Ladepuffer (PE Applied Biosystems) aufgenommen. Die Analyse der Sequenz erfolgte in einem automatischen Sequenzierer (ABI Prism 377 DNA Sequencer, PE Applied Biosystems) durch die Firma DLMBC.

2.2.4.2 Markierung von DNA-Sonden

↓37

Die DNA-Sonden wurden über die random-oligonucleotide-prime-Methode mit dem Hexa-Label™DNA Labeling Kit’s (Fermentas) markiert. Für die Reaktion wurden 100 ng DNA sowie 1,85 MBq (50 µCi) [α-32P]-dCTP (Amersham) eingesetzt. Das Protokoll wurde nach den Angaben des Herstellers durchgeführt.

Die zur Herstellung einer Sonde verwendete DNA wurde auf zwei Wegen gewonnen: (1) Amplifikation über PCR und Aufreinigung des Produktes mit Hilfe des Qiaquick PCR Purification Kit (Qiagen) nach Herstellerangaben (Kap. 2.2.2.1) oder (2) Restriktion von Konstrukten über geeignete Enzyme und Elution des gewünschten Fragmentes aus einem Agarosegel (Kap. 2.2.2.1).

2.2.4.3 Southern-Blot-Analyse

In Vorbereitung für den Transfer der elektrophoretisch aufgetrennten DNA auf Hybond™ N+-Membranen (Amersham) wurden die Agarosegele zur Erzeugung von DNA-Strangbrüchen mit UV-Licht (312 nm, 60 mJ, 60 s; GS Gene Linker™) bestrahlt. Der DNA-Transfer erfolgte unter Verwendung eines Vakuum–Blotters (Modell 785, BioRad). Während des Blottens wurden die Agarosegele mit Lösungen in folgender Reihenfolge behandelt: Denaturierung mittels 0,5 M NaOH/1,5 M NaCl (30 bis 40 min) und Neutralisierung mittels 0,5 M Tris-HCl (pH 7,5)/1,5 M NaCl (30 bis 40 min). Anschließend wurde die Membran in 2x SSC (20x SSC: 3 M NaCl, 0,3 M Natriumcitrat, pH 7,0) für 2 min äquilibriert. Nach dem Trocknen der Membran wurde die DNA durch Einwirken von UV-Licht (312 nm, 150 mJ, 150 s; GS Gene Linker™) mit dem Filter vernetzt.

↓38

Prähybridisierung und Hybridisierung der Filter erfolgte in einem Hybridisierungsofen (Bachofer) in speziellen Glasröhren. Die Filter wurden in einem Hybridisierungspuffer
(0,25 M Na2HPO4/NaH2PO4 (pH 7,2)/ 7 % (w/v) SDS) bei 65 °C für 30 min prähybridisiert. Nach Zugabe der Sonde wurde bei gleicher Temperatur 4 h oder über Nacht hybridisiert. Die ungebundene sowie die unspezifisch gebundene Sonde wurde durch folgende Waschschritte von der Membran entfernt: zweimal 15 min in 2x SSC/ 0,5 % SDS bei Raumtemperatur, anschließend zweimal 15 min in 0,1x SSC/ 0,1 % SDS bei 65 °C.

Die vom Filter ausgehende Strahlung wurde über die storage-phosphor-Technologie an einem Phospho-Imager erfasst, wobei sich die Exponierungsdauer der Filter nach der Stärke der radioaktiven Strahlung richtete. Das Einscannen der kristallbeschichteten Schirme und die Auswertung der Daten erfolgte am Phospho-Imager Personal Molecular Imager FX (BioRad Labratories).

2.2.4.4 Koloniehybridisierung

Bakterienkolonien, die den Vektor mit dem gewünschten Insert enthielten, wurden mittels Koloniehybridisierung (Grunstein-Hogness-Technik) identifiziert. Die Bakterien wurden von Agarplatten auf Hybond™N+-Membranen (Amersham) transferiert und die Zellen durch Behandlung der Membran mit 0,5 M NaOH/1,5 M NaCl (5 min, Raumtemperatur) lysiert. Anschließend wurde der Filter zweimal 5 min in 0,5 M Tris-HCl (pH 7,5)/1,5 M NaCl neutralisiert. Nach Entfernung der Zellreste und Waschen der Membran in 2x SSC wurde die DNA durch UV-Licht (312 nm, 150 mJ, 150 s; GS Gene Linker™) mit dem Filter vernetzt. Prähybridisierung und Hybridisierung wurde wie im oberen Abschnitt beschrieben durchgeführt.

2.2.4.5 Northern-Blot-Analyse

↓39

Die Übertragung der RNA aus denaturierenden Agarosegelen auf Hybond™N+-Membranen (Amersham) erfolgte über Kapillartransfer. Die Agarosegele zur elektrophoretischen Auftrennung der RNA hatten folgende Zusammensetzung: 1,2 % (w/v) Agarose, 4 % (v/v) Formaldehyd, 1x MEN-Puffer (20 mM MOPS, 5 mM Natriumacetat, 1 mM EDTA pH 8,0). Vor dem Beladen eines Agarosegeles wurde die RNA in 2x Ladepuffer (95 % (v/v) Formamid, 0,025 % (v/v) SDS, 0,5 mM EDTA, 0,4 % (v/v) Ethidiumbromid) aufgenommen und für 5 min bei 65 °C denaturiert. Der Laufpuffer enthielt 1xMEN.

Für den RNA-Transfer wurde das Agarosegel mit der Oberseite nach unten auf einer Pufferbrücke angeordnet, die aus mehreren Lagen 3MM-Whatman-Papier bestand. Die Hybond™N+-Membran wurde auf die ursprünglichen Unterseite gelegt. Zur Erzeugung eines Flüssigkeitsstromes durch das Agarosegel in Richtung Membran wurde ein ca. 10 cm hoher Stapel aus trockenem 3MM-Whatman- und Filter-Papier auf die Membran geschichtet und mittels einer Glasplatte und eines Gewichtes (ca. 500 bis 800 g) fixiert. Der Transferpuffer bestand aus 10x SSC. Der Transfer vollzog sich über eine Zeitspanne von ca. 16 h. Anschließend wurde die Membran in 2x SSC für ca. 3 min äquilibriert und nach dem Trocknen zur Vernetzung der RNA mit dem Filter mit UV-Licht (312 nm, 150 mJ, 150 s; GS Gene Linker™) behandelt.

Prähybridisierung und Hybridisierung (16 h) erfolgten in einem Formamid-Puffer (50 % (v/v) Formamid, 7 % (w/v) SDS, 0,12 M Natriumphosphat-Puffer pH 7,2, 0,25 M NaCl) bei 55 °C. Die DNA-Sonde (zur Markierung siehe Kap. 2.2.4.2) wurde nach Ablauf der 30 minütigen Prähybridisierung zugegeben. Im Anschluss an die 16 stündige Hybridisierung wurden die RNA-Filter nach folgendem Protokoll gewaschen: 15 min in 2x SSC/ 1 % SDS bei Raumtemperatur, anschließend zweimal 15 min in 0,1x SSC/ 0,1 % SDS bei 55 °C.

2.2.4.6 Quantitative real-time RT-PCR

↓40

Die mRNA-Menge schwach transkribierter Gene wurde mit der Quantitativen real-time RT-PCR bestimmt. Im ersten Schritt wurde die nach einem leicht modifizierten Protokoll präparierte RNA (Kap. 2.2.3.3) mit Hilfe des DNAfree Kit (Ambion) nach den Instruktionen des Herstellers von möglichen Verunreinigungen durch DNA befreit. Die cDNA wurde aus 500 ng Gesamt-RNA unter Verwendung der Reversen Transkriptase Omniscript (Qiagen) und zufällig bindender Hexamerprimer (Random Hexamers, PE Applied Biosystems) synthetisiert. Vor dem Syntheseschritt wurde die RNA für 5 min bei 65 °C denaturiert. Dem folgte eine 2 minütige Inkubation bei Raumtemperatur zur Anlagerung der Hexamerprimer. Nach Zugabe der Reversen Transkriptase wurde der Reaktionsansatz für 60 min bei 37 °C und anschließend für 5 min bei 93 °C inkubiert. Dem Kontrollansatz wurde keine Reverse Transkriptase zugefügt. Zum Schutz vor RNA-Degradation enthielt der Reaktionsansatz 1,6 U µl-1 Ribonuclease Inhibitor (Fermentas).

Für die Bestimmung der cph1- und der cph2-Transkriptmenge wurden jeweils 10 bis 40 ng der umgeschriebenen RNA als Triplikate für die Quantitative PCR eingesetzt. Im Fall der als Bezugsgröße dienenden 16S rRNA wurde diese Menge auf 10 bis 40 pg reduziert. Die Negativkontrollen aus der Reversen Transkription lagen nur als Unikate vor. Für das Ansetzen der PCR wurde der SYBR-Green Kit (PE Applied Biosystems) unter Berücksichtigung der Herstellervorgaben verwendet. Außerdem enthielt der Ansatz 400 nM der entsprechenden Primer. Die Primerpaare wurden so gewählt, dass PCR-Produkte mit einer Länge von 90 bis 110 Basenpaaren (bp) entstehen. Die PCR fand mit dem folgenden Programm statt: 10 min Denaturierung und Enzymaktivierung bei 95 °C, 40 Zyklen mit je 10 s Denaturierung bei 95 °C, 30 s Anlagern der Primer bei 60 °C und 45 s Elongation bei 72 °C. Die PCR und die zeitliche Erfassung der Produkte erfolgte in einem Gene Amp® 5700 Sequence Detection System in Kombination mit der dazugehörigen Software (Version 1.3) (PE Applied Biosystems). Die Transkriptmenge wurde mit nachstehender Gleichung berechnet:

 

↓41

Der für die Quantifizierung notwendige Ct-Wert entspricht der Anzahl von Zyklen bei einem festgelegten Fluoreszenzsignal in der exponentiellen Phase der Produktvermehrung in der PCR. Die Fluoreszenz wird von entsprechend markierten Nukleotiden aus dem SYBR-Green Kit nach dem Einbau in eine doppelsträngige DNA emittiert.

2.2.5 Wachstumsanalyse

2.2.5.1  Kultivierungsbedingungen

Für die Aufnahme von Wachstumskurven wuchsen WT und Phytochrommutanten in einer batch-Kultur mit Luftbegasung bei 30 °C in BG11-Medium (Rippka et al., 1979). Die Belichtung der Kulturen erfolgte kontinuierlich. Intensität und Qualität des Lichtes (WL-Fluoreszenzlampen; TDL58W/865, Philips) wurde unter Verwendung spezieller Plastikfilter (Lee Filters, Undover, GB) reguliert. Die optische Dichte (OD) wurde bei einer Wellenlänge von 750 nm am Spektrophotometer (Lambda35) erfasst.

Die Vorkultur erfolgte unter mittleren Lichtbedingungen (ML, 30 µmol m-2 s-1; Lee-Filter Nr. 210). Dem Medium der Phytochrommutanten wurde die entsprechende Menge Antibiotikum (2.2.1) zugesetzt.

↓42

Zur Untersuchung des Wachstumsverhaltens wurden die Kulturen nach Erreichen einer OD750nm von ca. 0,8 auf 0,15 verdünnt. Anschließend wurden die Kulturen mit kontinuierlichem Starklicht (HL, 165 µmol m-2 s-1), ML, Schwachlicht (LL, 6 µmol m-2 s-1; Lee-Filter Nr. 210 und 211), BL (12 µmol m-2 s-1; Lee-Filter Nr. 119), GL (8 µmol m-2 s-1; Lee-Filter Nr. 090), RL (15 µmol m-2 s-1; Lee-Filter Nr. 106) und FRL (0,3 W m-2; Lee-Filter Nr. 106 und 119) belichtet. Zum Erzeugen von FRL wurde zusätzlich zu den Fluoreszenzlampen ein Halogenscheinwerfer eingesetzt. Die Lichtstärke von WL und RL wurde mittels des Sensors 190SA (LI-COR, Bad Homburg) gemessen, die Intensität des FRL hingegen unter Verwendung des Pyranometersensors LI-200SA (LI-COR). Die Spektralverteilung der aufgeführten Lichtbedingungen wurde mittels der hoch auflösenden Spektroradiometer SR-9910 (Macam Photometrics Ltd, Livingston, GB) und LI-1800UW (LI-COR, Inc., Lincoln Nebraska, USA) erfasst und ist in Abb. 7 dargestellt.

Die Zugabe von Antibiotika zum Medium könnte das Auftreten von scheinbar phänotypischen Effekten bewirken. Um dies zu verhindern, wurde den Kulturen während der Wachstumsanalyse kein Antibiotikum zugefügt.

2.2.5.2 Berechnung der Wachstumsrate

Zur Analyse des Wachstums wurde über einen bestimmten Zeitraum die OD spektrophotometrisch bei 750 nm ermittelt. Die Häufigkeit der Probennahme richtete sich nach der Verdopplungsgeschwindigkeit der Zellen. Die Wachstumsrate wurde in der exponentiellen Wachstumsphase als linearer Anstieg des natürlichen Logarithmus der OD gegen die Zeit bestimmt. Die Wachstumsraten der Phytochrommutanten wurden als Prozentwert der WT-Kontrolle dargestellt.

↓43

Abb. 7 : Spektralverteilung des für Wachstumsanalysen und Phototaxisstudien (Kap. 2.2.6 ) genutzten Lichtes.

2.2.5.3 Kompetitionsexperimente

Zur Bestätigung der Resultate aus der Bestimmung der lichtabhängigen Wachstumsrate wurden Kompetitionsexperimente durchgeführt. Hierbei wurden WT und Mutante gemeinsam in einem Anzuchtskolben kultiviert und die zeitliche Verschiebung des Anteils der Mutantenzellen in der Mischkultur bestimmt.

Der Vorkultur im ML folgte eine Zwischenkultur, in der sich die Kulturen an die zu testenden Lichtbedingungen akklimatisieren sollten. Nach Erreichen einer OD750nm von 0,5 bis 0,8 wurde die Zellzahl mittels eines Hämozytometers kalkuliert (Thoma, Bad Blankenburg), die Zellen von WT und cph1 - - bzw. cph2 - -Mutante wurden im Verhältnis 1:1 gemischt und auf eine OD750nm von ca. 0,15 verdünnt. Die Häufigkeit der Probennahme erfolgte in Abhängigkeit von der Wachstumsgeschwindigkeit im Abstand von 2 bis 6 Tagen. Die Proben wurden in zwei bzw. drei Verdünnungsstufen auf Km-haltige bzw. antibiotikafreie Platten mit 6 ml Top-Agar (BG11, 0,75 % (w/v) Bacto-Agar) ausplattiert. Nach ca. zwei Wochen wurden die gewachsenen Kolonien ausgezählt. Auf den antibiotikafreien Platten wuchsen sowohl WT- als auch Mutanten-Kolonien, während auf den Km-haltigen Agarplatten nur Mutantenzellen überleben konnten. Die Mutantenzellen wurden als prozentualer Anteil an der Gesamtzellzahl berechnet.

2.2.5.4 Bestimmung von Photosyntheseparametern

2.2.5.4.1 Analyse der Pigmentzusammensetzung

↓44

Die Bestimmung der Pigmentzusammensetzung und des Pigmentgehaltes wurde an einer HPLC (Waters GmbH, Eschborn) mit dem Prinzip der „Reversed Phase Chromatography“ durchgeführt. Durch diese können die Pigmente Chlorophyll a (Chl a), Zeaxanthin (Zea), β-Karotin (β-Car), Myxoxanthophyll (Myx) und Echinenon (Ech) analysiert werden.

Für die Bestimmung der Pigmentzusammensetzung wurden 2 ml der Zellkulturen aus der logarithmischen Phase abzentrifugiert und die Zellpellets bei -20 °C gelagert. Die Pigmente wurden durch die Zugabe von 0,5 oder 1 ml Methanol und anschließender lichtgeschützter Inkubation für 1h auf Eis extrahiert. Die gewonnenen Extrakte wurden über PTFE - Membranfilter mit einer Porengröße von 0,45 µm (Millipore) von Zelltrümmern abgetrennt. Das Injektionsvolumen lag, abhängig von der Pigmentkonzentration, bei 150 oder 200 µl. Alle beschriebenen Arbeiten fanden unter abgeschwächtem Licht statt.

Das Waters HPLC–System bestand aus einem Photodiodenarray-Detektor (Waters PDA 996), dem Waters 717plus Autosampler mit einem Heizungs-/Kühlungsaggregat zur Kühlung des Probenraumes und einem Pumpensystem (Waters 600E system controller und Waters 600 fluid unit). Die Auftrennung der Pigmente erfolgte über eine C18-Säule (Waters Sphe risorb 5µ ODS2 Column 4,6 x 250 mm) in Verbindung mit einer Vorsäule (Waters Guard – Pak Inserts Resolve C18) und einem Waters RCM 8 x 10 Modul bei Raumtemperatur. Der Laufmittelgradient ergab sich aus unterschiedlichen Mischungsverhältnissen von Laufmittel (LM) A (Acetonitril : H2O : Triethylamin; 1800 : 200 : 2) und LM B (Ethylacetat). Der LM-Gradient zur Auftrennung der Pigmente hatte das folgende Muster: 16 min isokratisch 100 % LM A; 18 min linearer Gradient von 100 % LM A zu 100 % LM B; 3 min isokratisch 100 % LM B; 4 min isokratisch 100 % LM A. Die Dauer des Probendurchlaufs durch die HPLC betrug 41 min bei einer Flussrate von 1,0 ml min-1. Die Daten wurden durch einen Computer mit der HPLC - Software Millenium 2010 Version 2.00 (Millipore) registriert und ausgewertet. Die Kalibrierung erfolgte durch Pigmentstandards (VKI, Hörsholm, Dänemark). Für die Bestimmung des Eichfaktors für Myx und Ech waren keine Pigmentstandards verfügbar. Hierfür wurden die beiden Pigmente aus einem Pigmentextrakt über die HPLC aufgereinigt. Die in die Berechnung des Pigmentgehaltes eingehenden Eichfaktoren sind in Tab. 5 aufgelistet.

↓45

Tab. 5: Eichfaktoren für die HPLC-Pigmentbestimmung.

Pigment

Eichfaktor

Retentionszeit (min)

Myx

8,7 x 10-5

18

Zea

6,2 x 10-5

20

Chl a

15,0 x 10-5

26

Ech

12,2 x 10-5

28

β-Car

6,6 x 10-5

35

Die Menge eines Pigmentes berechnet sich aus der Peakfläche, dem Injektions- und dem Extraktvolumen. Die qualitative Analyse der Pigmente erfolgte über die Erfassung des Absorptionsspektrums im Peakmaximum und der Retentionszeit. Beides wurde mit den Daten bekannter Substanzen aus einer Spektrenbibliothek verglichen.

2.2.5.4.2 Bestimmung des Phycocyanin/Chlorophyll a - Verhältnisses

Das Verhältnis von Phycocyanin (PC) zu Chlorophyll a (Chl) wurde aus den Absorptionsspektren ganzer Zellen ermittelt, welche an dem Spektrophotometer M500 mit einem Einsatz für streuende Proben aufgenommen wurden (Carl Zeiss Jena GmbH). Die Berechnung erfolgte nach der in Myers et al. (1980) beschriebenen Formel:

↓46

 

2.2.5.4.3 Aufnahme von 77K-Fluoreszenz-Emissionsspektren

Die Fluoreszenz-Emissionsspektren von WT und Phytochrommutanten wurden bei 77 K und einer Anregungswellenlänge von 440 nm mit einem Spektrofluorimeter Fluorolog FL-112 mit einem 1680 Emissionsdoppelmonochromator (Jobin-Yvon) aufgenommen. Eine auf ca. 5 µg Chl eingestellte Zellsuspension, bestehend aus 300 µl in BG11-Medium aufgenommenem Zellmaterial und 700 µl Glycerin, wurde in Form von Kügelchen in flüssigem Stickstoff eingefroren. Die Untersuchungen wurden in Zusammenarbeit mit Dr. Heiko Lokstein am Max-Born-Institut (Berlin) durchgeführt.

2.2.5.4.4 Messung der Sauerstofffreisetzung

Die Sauerstofffreisetzung wurde von Zellkulturen in der exponentiellen Wachstumsphase ermittelt. Eine Küvette mit integrierter Sauerstoff-Elektrode vom Clark-Typ (Rank Brothers Ltd.) wurde mit 4 ml Zellkultur und 5 mM Natriumhydrogenkarbonat beladen. Die Messung erfolgte bei 30 °C unter Lichtsättigung. Die Sauerstoffentwicklung wurde über einen Schreiber erfasst und nach der in diesem Kapitel genannten Formel berechnet. Für die Kalibrierung der Sauerstoff-Elektrode wurde der Schreiberausschlag bei Sauerstoffsättigung nach intensiver Luftdurchmischung von 4 ml Wasser sowie der Schreiberausschlag am Nullpunkt der Sauerstoffkonzentration nach Natriumdithionit-Zugabe bestimmt.

↓47

Δ stellt die Änderung des prozentualen Sauerstoffanteils dar. L entspricht der temperaturabhängigen Sauerstoffsättigungskonzentration (0,23 µmol ml-1 bei 30 °C). Die Zeit t ergab sich aus dem Schreibervorlauf. Als Bezugsgröße diente die Masse an Chl im Messvolumen.

2.2.6 Untersuchung der Phototaxis

2.2.6.1  Phototaxis-Assay

Der Einfluss von Cph1 und Cph2 auf das phototaktische Verhalten von Synechocystis wurde getestet, indem WT- und Mutantenzellen auf Agarplatten einem Lichtgradienten ausgesetzt wurden. Diese Platten setzten sich aus BG11, 0,5 % (w/v) Bacto-Agar und 5 mM Glukose zusammen. Der Lichtgradient wurde mit Hilfe einer black box mit einer Öffnung an der Vorderseite geschaffen. Vor diese Öffnung wurden Plastikfilter (Lee Filters, Undover, GB) befestigt, um BL (Lee-Filter Nr. 119), GL (Nr. 090), RL (Nr. 106) und FRL (Nr. 119+106) zu erzeugen. Als Lichtquelle dienten WL-Fluoreszenz-Lampen (TDL58W/865; Philips). Die in den Boxen herrschende Lichtintensität wurde mit Hilfe der Lichtsensoren LI-190SA für WL (1,5 µmol m-2 s-1), BL (1,3 µmol m-2 s-1) und GL (0,6 µmol m-2 s-1) sowie LI-200SA (beide LI-COR, Bad Homburg) für RL (0,3 W m-2) und FRL (0,2 W m-2) gemessen. Die Spektralverteilung der aufgeführten Lichtbedingungen ist in Abb. 7 dargestellt. Die Zellen wurden in drei Entfernungen von der Lichtquelle aufgetragen, wobei das Licht von 100 % an der ersten Position auf 60 % an der zweiten und 35 % an der dritten Position reduziert wurde.

↓48

Neben den hauptsächlich genutzten Plastikfiltern wurden für die Phototaxis-Assays Photodioden (Tab. 6) sowie für BL eine Kombination aus einem blauen dichroischen Filter (Edmund Scientific, Barrington, USA) und einem UV 418 cut-off-Filter (Schott Glaswerke, Mainz) verwendet.

Tab. 6: Verwendete Photodioden.

LED

Firma

LED-UV (373 nm), RLT 370-TO-18

Roithner Lasertechnik, Österreich

LED-blau (466 nm), TL HB5100

Conrad Electronic GmbH, Hirschau

LED-grün (565 nm), TLHG 5800

Conrad Electronic GmbH, Hirschau

LED-rot, LED-Scheinwerfer CLUSTER-52MM

Conrad Electronic GmbH, Hirschau

LED-dunkelrot (720 nm), ELD-720-524

Roithner Lasertechnik, Österreich

2.2.6.2 Aufnahme eines Aktionsspektrums der BL-gesteuerten Motilität

Für eine detailliertere Untersuchung des phototaktischen Verhaltens des Synechocystis-WTs im blauen Spektralbereich wurden Interferenzfilter eingesetzt, die Licht in einem eingeschränkten Wellenlängenbereich transmittieren. Die durchschnittliche Halbwertsbreite dieser Filter betrug 10 bis 20 nm. Die Lichtbedingungen dieser Experimente sind in Tab. 7 aufgelistet. Als Kontrolle wurde zusätzlich die cph2 - -Mutante aufgetragen. Die Lichtintensitäten lagen zwischen 1 und 3 µmol m-2 s-1.

↓49

Die Filter mit einem Transmissionsmaximum von 451 bis 504 nm wurden von der Arbeitsgruppe Schlodder von der TU Berlin bereitgestellt.

Tab. 7: Interferenzfilter mit Wellenlänge des Transmissionsmaximums und verwendeter Lichtquelle.

Wellenlänge (nm)

Firma

Lichtquelle

372a)

Schott Glaswerke, Mainz

Projektorlampeb)

405

Carl Zeiss Jena GmbH, Jena

Solux-Lampec)

436

Carl Zeiss Jena GmbH, Jena

Solux-Lampe

451

Schott Glaswerke, Mainz

Solux-Lampe

461

Schott Glaswerke, Mainz

Solux-Lampe

474

Schott Glaswerke, Mainz

Halogenscheinwerfer

484

Schott Glaswerke, Mainz

Halogenscheinwerfer

494

Schott Glaswerke, Mainz

Halogenscheinwerfer

504

Schott Glaswerke, Mainz

Halogenscheinwerfer

A9 Dieses Experiment wurde an der Philipps-Universität Marburg durch Dr. Tatjana Kleine ausgeführt.
B9 Prado Universal 31047 (Ernst Leitz GmbH, Wetzlar)
C9 Eiko Europe GmbH, Germersheim

2.2.6.3 Untersuchung der TypIV-Pili mittels Transmissionselektronenmikroskopie

Die elektronenmikroskopische Analyse der TypIV-Pili fand in Zusammenarbeit mit Herrn Dr. G. Tischendorf (FU Berlin, Institut für Biologie/ Pflanzenphysiologie) statt. Die Pili wurden mittels Metallbedampfung kontrastiert. Hierfür wurden aus Phototaxisexperimenten stammende Zellen von dem WT und der cph2 - -Mutante verwendetund zwar jeweils unter WL gelaufene sowie nichtmotile Zellen von WT und der Phytochrommutante. Genauso wurde mit der cph2 - -Mutante unter BL-Bedingungen verfahren. Im Fall des BL-bestrahlten WT wurden Zellen von der lichtzugewandten sowie von der lichtabgewandten Seite genutzt. Die genannten Zellen wurden mittels EM-Objektträgern (Kupfernetze von 3 mm Durchmesser) von der Agarplatte in der vorgegebenen, meist stark konzentrierten Form abgetupft und unmittelbar in ein Fixativ (6 % Formaldehyd in 100 mM Natrium-/Kalium-Phosphatpuffer, pH 7,0) übertragen. Nach vorsichtiger Vereinzelung der Zellen in diesem Medium wurden sie dort für 15 minbei Raumtemperatur belassen. Die chemisch fixierten Zellen wurden dann in einem Stufen-Gradienten (obere Phase: 6 % Formaldehyd in 100 mM Phosphatpuffer, pH 7; untere Phase: 0,1 M Saccharose, 6 % Formaldehyd in 100 mM Phosphatpuffer, pH 7) aufgetrennt und als Fraktionen gesammelt. Die Zellen aus den verschiedenen Fraktionen wurden auf negativ-geladene EM-Trägernetze (mit Pioloform beschichtete und mit Kohle bedampfte Kupfernetze) übertragen. Diese EM-Trägernetze wurden in einem Siemens-Bedampfungsgerät (Siemens AG, Berlin) mit Platin-Palladium in einem Winkel von 45° bedampft. Die elektronenmikroskopische Aufnahme der schräg beschatteten Pili erfolgte mit einem Siemens TEM 101 (Siemens AG).

2.2.7 Computeranwendungen

↓50

Tab. 8: Liste der verwendeten Computerprogamme und Internetanwendungen.

Programm bzw. Internetadresse

Beschreibung

Gene Amp® 5700 SDS Software (Version 1.3; PE Applied Biosystems, Weiterstadt)

Erfassung und Auswertung der Daten aus der Quantitativen real-time RT-PCR

Quantity One (BioRad Labratories, Richmond, USA)

Software des Phospho-Imagers

SeqEd™ (Version 1.0.3; PE Applied Biosystems, Weiterstadt)

Auswertung von Sequenzierungsdaten

CLUSTALX (Version 1.8)

Erstellen eines Sequenz-Alignments

GENEDOC (Version 2.6.002)

Bearbeitung eines Sequenz-Alignment

http://www3.ncbi.nlm.nhi.gov

Allgemeine Datenbank für Genom- und Proteinforschung

http://www.kazusa.or.jp/cyano/cyano.html

Cyanobase: Synechocystis-Datenbank

http://smart.embl-heidelberg.de

Vorhersage der Domänenarchitektur von Proteinen

http://www.firstmarket.com/cgi-bin/cutter

Auffinden von Erkennungsstellen von Restriktionsendonukleasen in einer DNA-Sequenz


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
01.11.2005