Anhang

Tab. A: Entzündungs-assoziierte Expression bei Wildtyp BL10 und TLR-defizienten Tieren (Signal log Verhältnis als Increase >1,5)

Tab.B: Entzündungs-assoziierte Genexpression bei Wildtyp BL10 und TLR-defizienten Tieren (Signal log Verhältnis als Decrease < minus 3)

Tab. C: TLR4-abhängige entzündungs-assoziierte Expression (Signal log Verhältnis >1,5;< minus 3)

PCR-Protokolle zur Genotypisierung

Tab. D: PCR-Protokoll für die TLR2 -/- Typisierung

Tab. E: PCR-Protokoll für die TLR4 -/- Typisierung

Tab. F : PCR-Protokoll für die LBP -/- Typisierung

Tab. G: Primer für die Genotypisierung der Knockoutzustände

Primerbezeichnung

Sequenz

TLR4 Exon1 sense

CAGTCGGTCAGCAAACGCCTTCTTC

TLR4 Exon1 antisense

CAAGGCAGGCTAGCAGGAAAGGGTG

TLR4 CR sense

GCAAGTTTCTATATGCATTCTC

TLR4 CR antisense

CCTCCATTTCCAATAGGTAG

TLR 2-1

CTTCCTGAATTTGTCCAGTACAGGG

TLR 2-2

TCGACCTCGATCAACAGGAGAAGGG

TLR 2-3

GGGCCAGCTCATTCCTCCCACTCAT

LBP-f

AGAGGCATGGTGGCCAGA

LBP-r

CCCACTCCTGGGCTTTGT

Neo5

GCCGATTGTCTGTTGTGCCC


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
10.01.2008