Material und Methoden

↓6

2.1  Material

2.1.1  Chemikalien und Reagenzien

Tab. 1: Verwendete Chemikalien und Herstellerangaben

Substanz

Hersteller / Zulieferer

Agar-Agar

Roth, Karlsruhe

Agarose

Roth

Ammoniumchlorid

Roth

Ammoniumperoxodisulfat

Sigma-Aldrich

Ampicillin (als Zusatz bei Klonierungsexp.)

Sigma-Aldrich

Ampicillin (zur Generierung gnotobiotischer Tiere)

Ratiopharm

Borsäure

Riedel-de Haen

Bromphenolblau

Bio-Rad, München

Ciprofloxacin

Bayer Vital

Desoxyadenosintriphosphat (dATP)

Roche, Mannheim

Desoxycytidintriphosphat (dCTP)

Desoxyguanosintriphosphat (dGTP)

Desoxythymidintriphosphat (dTTP)

Dimethylsulfoxid (DMSO)

Merck, Darmstadt,

CSPD: Dinatrium-3-(4-methoxyspiro{1,2-doxetan-3,2‘(5‘chloro)tricyclo[3.3.1.13,7]

decan}-4-yl)-phenylphosphat

Roche

Dextransulfat 40 kDa

ICN Biochemicals, Irvine, CA, USA

Eisessig (glacial)

Merck

Ethanol

JJ Baker, Deventer

Ethylendiamintetraessigsäure

Roth

Formaldehyd

Formamid deionisiert

Glycerin

Halothan

Eurim-Pharm, Mülheim

Harnstoff

Roth

Hefeextrakt

Imipinem

MSD

Isoamylalkohol

Sigma-Aldrich

IPTG: Isopropyl-β-D-thiogalactopyranosid

Sigma-Aldrich

Kaliumdihydrogenphosphat

Merck

Maleinsäure

Roth

Metronidazol

Fresenius

Natriumchlorid

Roth

Natriumcitratdihydrat

Roth

Natriumdodecylsulfat

Roth

Natriumjodid

Roth

Natriumlaurylsarkosin

Roth

N-(1-Naphthyl) ethylendiamindihydrochlorid

Sigma

Phenol (Roti-Phenol)

Roth

Rapid Gel XL 40%

USB, Cleveland

RNAlater

Qiagen, Hilden

Silbernitrat

Roth

Silika Matrix

Sigma-Aldrich

Sulfanilamid

Roth

SYBR Green I

Fluka

TEMED: N,N,N,N-Tetramethylethylendiamin

Roth

TMB: 3,3′,5,5′-Tetramethylbenzidin

Sigma-Aldrich

TRIzol Reagenz

Invitrogen

Trichloromethan (Chloroform)

Merck

Trypton / Pepton aus Casein

Merck

Vancomycin

Cell Pharm

Xylencyanol FF

Bio-Rad

X-Gal: 5-Brom-4-chlor-3-indoxyl-β-D-galactopyranosid

Sigma-Aldrich

Zirkonium-Silika-Perlen (0,1 mm)

Biospec

2.1.2 Geräte, kommerzielle „Kits“ und andere Materialien

↓7

Tab. 2: Verwendete Geräte und Materialien

Gerätebezeichnung

Hersteller

Horizontale Gel Elektrophorese

PeqLab

DCode Universal Mutation Detection System

Bio-Rad

DGene

Biofuge fresco

Heraeus Instruments

Eppendorf 5415C

Eppendorf, Hamburg

Eppendorf 5436

Eppendorf

Vacuum Zentrifuge

Heraeus Instruments

CEQ™8000 Genetic Analysis System

Beckman Coulter, Krefeld

T3 Thermocycler

Biometra, Göttingen

FastPrep FP120

Bio101

Power Supply Model200

Bio-Rad

HAT Multitron

Infors AG

GeneGenius

Syngene, Cambridge

Anthos BSK Bench

Anthos, Köln

Micro-4 Dot Blot Oven

MWG Biotech

Microprocessor pH meter ph3000

WTW

SpectraFluor Plus

Tecan

Anaerobier-Töpfe

Oxoid, Wesel

AnaeroGen-Beutel

Oxoid

Anaerotest

Merck

GelBond PAG Film

Biozym, Hessisch-Oldendorf

Tab. 3: Verwendete kommerzielle „Kits“

Kitbezeichung

Hersteller

QIAmp DNA Mini Kit

Qiagen

QIAmp DNA Stool Kit

Qiagen

QIAquick PCR Purification Kit

Qiagen

RNeasy Mini Kit

Qiagen

QIAquick Gel Extraction Kit

Qiagen

Invisorb Spin Plasmid Mini Kit

Invitek, Berlin

GFX™MicroPlasmidPrep Kit

Amersham Biosciences, München

DTCS™Quick Start Kit

Beckman Coulter

CleanSEQ®

Agencourt, USA

OptEIA Set Mouse IFN-gamma

B&D Biosciences, USA

TA Cloning® Kit

Invitrogen, Groningen

TOPO TA Cloning® Kit

Invitrogen

DIG Luminescent Detection Kit

Roche

API 32 A Rapid

bioMérieux, Nürtingen

API 10S

Api 50 CHL

2.1.3 Puffer und Lösungen

↓8

Tab. 4: Verwendete Puffer und chemische Lösungen

Puffer / Lösung

Zusammensetzung

Agarosegel Probenpuffer

1.5 g Ficoll, 25 mg Bromphenolblau, 25 mg Xylen Cyanol FF, Aqua dest. auf 10 mL

Anti DIG AP Konjugat

1% Blocking Reagenz, 9 mL Maleinsäurepuffer
2 μL Anti DIG AP (Anti Digoxigenin alkalische Phosphatase)

Blocking Reagenz

10% Blocking Reagenz [Roche, Mannheim] in Maleinsäure, pH 8.0

CSPD Substrat

12 μL CSPD / 10 mL Detektionspuffer

Lysis-Puffer

10 mM Tris pH 8.0 (Salzsäure),150 mM Natriumchlorid, 20 mM EDTA; 1% SDS, Aqua dest auf 100 mL

Färbelösung

1 g Silbernitrat, 3.5 mL 37% Formaldehyd, Aqua dest auf 1000 mL

Entwickler

67.4 g Natriumcarbonat-Decahydrat, 1 mL 2% Natriumthiosulfatlösung (w/v), 3.5 mL 37% Formaldehyd, Aqua dest auf 1000 mL

Detektionspuffer

0.1 M Tris-Salzsäure, pH 9.5
0.1 M Natriumchlorid

Maleinsäure-Puffer

0.1 M Maleinsäure, 0.15 M Natriumchlorid , pH 7.5

Phosphat gepufferte Salzlösung (PBS)

8 g Natriumchlorid, 0.2 g Kaliumchlorid,
1.44 g Natriumhydrogenphosphat, Aqua dest. auf 1000 mL, pH 7.4

PCR-Puffer (10x)

100 mM Tris-Salzsäure, pH 8.3, 500 mM Kaliumchlorid

Kaliumphosphat-Puffer

23.14 g Kaliumdihydrogenphosphat, 164.38 g Kaliumhydrogenphosphat , Aqua dest. auf 1000 mL

Polyacrylamidgel (für DGGE)

21 g Harnstoff, 5 mL Rapid Gel XL (40%), 6 mL 10x TBE , 500 μL DMSO, Aqua dest. auf 50 mL: Polymerisierung mit 292 μL APS (10%), 30 μL TEMED

Silika-Suspension

2.5 g Silika, 25 mL 6M Natriumjodid

Silika Wasch-Puffer

50 mM Natriumchlorid, 10 mM Tris, 2.5 mM EDTA, 50% Ethanol (v/v), pH 7.5

SSC Puffer (20x)

175.3 g Natriumchlorid, 88.2 g Natriumcitratdihydrat, Aqua dest. auf 1000 mL, pH 7.0

Stammlösung I (0%)

50 mL RapidGel XL (40%), 2.5 mL TAE (50x), 5 mL Glycerin, Aqua dest auf 250 mL

Stammlösung II (100%)

105.4 g Harnsoff, 100 mL Formamid, 50 mL RapidGel XL (40%), 2.5 mL TAE (50x), 5 mL Glycerin, Aqua dest auf 250 mL

Standard Hybridisierungs-Puffer

5x SSC, 0.1% Natriumlaurysarkosin, 0.02% SDS, 1% Blocking Reagenz

Stop Puffer

9.5 mL Formamid, 0.4 mL EDTA (500 mM), 5 mg Bromphenolblau, 5 mg Xylencyanol FF, 0.1 mL Aqua dest.

Stripping Solution

0.2 N Natronlauge, 0.1% SDS

TAE Puffer (50x)

242 g Tris-Base, 57.1 mL Essigsäure, 100 mL 500 mM EDTA, Aqua dest. auf 1000 mL

TBE Puffer (10x)

(für Agarosegele)

108 g Tris-Base, 27.5 g Borsäure, 7.3 g EDTA, Aqua dest. auf 1000 mL

TE Puffer

0.01 M Tris-Salzsäure, pH 7.6, 1 mM EDTA

Wasch Lösung 1

0.1 x SSC, 0.1% SDS

Wasch Lösung 2

6 x SSC, 0.1% SDS

2.1.4 Oligonukleotidprimer und –sonden

Tab. 5: M13-Primer, RAPD-PCR Primer und DIG-markierte Sonden

Primer-Name

Sequenz 5´-3´

Orientierung

M13 -20

GTAAAACGACGGCCAGT

F

M13 -40

gTTTTCCCAgTCACgAC

F

M13 reverse

AACAgCTATgACCATg

R

Sonden-Name

Sequenz 5´-3´

16S Position

Lac-141

DIG-gACTgggATAACACCTg

141-157

Hpy-1

DIG-CACACCTgACTgACTATCCCg

585-605

Primer-Name

Sequenz

10bp Nowruz

GTGATCGCAG

entfällt

Alle Oligonkleotidprimer oder Sonden wurden, sofern nicht anders angegeben, durch TIB MOLBIOL (Berlin) hergestellt.

Tab. 6: 16S rRNA PCR-Primer

Primer-Name

Sequenz 5´-3´

16S Position

( E.coli Zählung)

Orientierung

TPU1 / 8f

AgAgTTTgATCMTggCTCAG

8:27

F

TPU2

CCARACTCCTACGGGAGGCA

334:353

F

TPU3

cAGcKGccGcGGTAATWc

519:536

F

TPU4

ggATTAgATACCCTggTAgTCC

785:805

F

TPU5

AAACTYAAAKgAATTgACgg

907:926

F

TPU6

gggCMACACACgTgCTACAAT

1220:1240

F

RTU2

TGccTcccGTAGGAGTYTGG

353:334

R

RTU2a

cTGcTGccTcccGTAGGAGT

357:338

R

RTU2b

cTGccTcccGTAGGAGT

354:338

R

RTU3

gWATTACCgCggCKgCTg

536-519

R

RTU5

CCgTCAATTCMTTTRAgTTT

926:907

R

RTU6

ATTgTAgCACgTgTgTMgCCC

1240:1220

R

RTU7

ACAAgRCCCGGGAACgTATT

1393:1373

R

RTU8

AAggAggTgATCCANCCRCA

1541:1522

R

1513r/ rp2

ACggCTACCTTgTTACgACTT

1513:1492

R

1510r/1492r

GGTTACCTTGTTACGACTT

1510:1492

R

16S-1410r

CGGTGTGTACAAGACCC

1410

R

516f

TGCCAGCAGCCGCGGTA

516:532

F

16S Lac138+

AGAGATCGGGATAACACCTG

138-157

F

16S 968F

AACgCgAAgAACCTTAC

968-84

F

16S 1378R

CggTgTgTACAAggCCCgggAACg

1401-1378

R

16S 968F-GC

CgCCCggggCgCgCCCCgggCggggCgggggCACggggggAACgCgAAgAACCTTAC

F+GC

HDA1

ACTCCTACGGGAGGCAGCAGT

339-360

F

HDA2

GTATTACCGCGGCTGCTGGCAC

539-518

R

HDA1GC

CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAGT

F+GC

↓9

2.1.5  DNA-Längenmarker, Enzyme, Plasmide, Zellen

Tab. 7: Verwendete DNA Längenmarker, Enzyme, Plasmide, Zellen

Produktbezeichnung

Hersteller

Gene Ruler 50 bp DNA Ladder (0,5 µg/µl)

Fermentas, St. Leon-Rot

Gene Ruler 100 bp DNA Ladder Plus

(0,5 µg/µl)

Gene Ruler 1 kb DNA Ladder (0,5 mg/ml)

Lambda DNA/EcoRI+HindIII Marker 3

(0,5 mg/ml)

Ampli Taq DNA Polymerase

Applied Biosystems, PE

Pfu Turbo Cx DNA Polymerase

Stratagene

Proteinase K

Roth

Lysozym

Fluka

pCR 2.1 ® Plasmid

Invitrogen,Groningen, Niederlande

pCR 2.1 ® TOPO ® Plasmid

E.coli TOP10F´®

2.1.6 Mausstämme

Tab. 8: Verwendete Versuchstiere mit Bezeichnung

Bezeichnung

Wildtypstamm

Kreuzungsstatus Dezember 2003

LBP (-/-)

Balb/c

Inzucht 100%

Balb/c

Balb/c

Inzucht 100%

C57BL/10

C57BL/10 ScSn

Inzucht 100%

C57BL/6

C57BL/6J

Inzucht 100%

TLR4 (-/-)

C57BL/10 ScN

Inzucht 100%, natürlicher TLR4 Defekt

TLR2/TLR4 (-/-)

C57BL/10 ScSn/ScN

TLR2-KO 6x auf C57BL/10 ScN rückgekreuzt

TLR2 (-/-)

C57BL/10 ScSn

TLR2-KO 6x auf C57BL/10 ScSn rückgekreuzt

Alle Tiere mit Ausnahme C57BL/6 und Balb/c wurden freundlicherweise von Prof. Dr. Marina Freudenberg, MPI für Immunbiologie Freiburg i.Br. zur Verfügung gestellt.

2.1.7  Nährmedien und biochemische Leistungsprüfung

↓10

Tab. 9: Verwendete Fest- und Flüssigmedien zur Bakterienkultivierung

Name

Firma / Art.Nr.

Einsatzbereich

Columbia 5% SB-Agar

Oxoid, PB5039A

Nährreiches Grundsubstrat, das ein maximales Wachstum von Mikroorganismen ermöglicht

MacConkey Nr.3

Oxoid, PO5002A

Selektiv für Gram-negative Stäbchen, enthält Laktose: Bildung von Acetaldehyd durch laktosespaltende Bakterien:
→ rote Kolonien z.B. E.coli laktosenegative Bakterien:
→ helle, transparente Kolonien z.B. Proteus sp.

Columbia Agar für Anaerobier (Kanamycin/Vancomycin)

Heipha, Dr.Müller GmbH, 382e

Selektiv für Anaerobier; hemmt das Wachstum von aeroben Bakterien

Acid-Agar

Nährbodenküche der Med. Mikrobiologie, Charité CBF

Selektiv für Gram-positive Kokken, Äsculinspaltung → Schwarzfärbung

CNA 5% SB IMPRO

BD, 257306

Gram-positive Kokken

Rogosa-Agar

Merck, 1.05413.0500

Selektiv für Gram-positive LAB*

Hirn-Herz-Glucose Bouillon

Oxoid, CM0225B

Flüssigvollmedium (Anreicherungsmedium)

Thioglykolat Bouillon

Oxoid, CM0173T

Flüssigvollmedium

MRS Bouillon

Sigma, 69966

Flüssigmedium für Milchsäurebakterien

Luria Bertani Agar (LB)

Nährbodenküche der Med. Mikrobiologie, Charité CCM

Vollmedium
10 g Trypton, 5 g Hefeextrakt, 10 g Natriumchlorid, 15 g Agar Agar, ad 1000 mL Aqua dest

LAXI Agar
LB Agar mit Ampicillin, X-Gal und IPTG

Nährbodenküche der Abt. Med. Mikrobiologie, Charité CCM

Vollmedium mit Antibiotikum und X-Gal / IPTG; Blau-Weiss-Musterung transformierter E. coli Klone, wie LB: bei 50°C Zugabe +250 μL Ampicillin (200 mg/mL) +200 μL X-Gal (40 mg/ml)
+50 μL IPTG (100 mM)

2.2 Versuchstiere

2.2.1  Mausstämme und Genotypisierungen

Die TLR-defizienten und LBP-/- Tiere wurden freundlicherweise aus der Zucht vom Max-Planck-Institut für Immunbiologie (Prof. Marina Freudenberg, Freiburg im Breisgau) zur Verfügung gestellt. C57BL/10ScSn (Wildtyp, Poltorak et al. 1998, 2001), TLR2-/- (C57BL/10ScSn sechsmal rückgekreuzt mit den TLR2-/- von Tularik Inc., San Francisco, USA), C57BL/10ScN (C57BL/10ScN trägt eine natürliche homozygote Deletion im TLR4-Gen) und TLR2-/- + TLR4-/- doppeldefiziente Tiere, wobei C57BL/10ScN sechsmal auf TLR2-/- rückgekreuzt waren (Vogel et al. 1979; Merlin et al. 2001; Werts et al. 2001; Lembo et al. 2003). Die LBP-/- Tiere hatten einen Balb/c Hintergrund und trugen eine neo-Insertion im LBP-Gen (Jack et al. 1997). Der Balb/c-Mausstamm, der für die H. pylori-Vakzinierungsstudien verwendet wurde, stammte aus dem Bundesinstitut für Risikobewertung (BfR, ehemals BgVV, Berlin). Alle Mausstämme, die für die Untersuchung der Ileitis und Colitis (einschliesslich der Stämme C57BL/6 und NMRI) eingesetzt wurden, waren am Forschungsinstitut für Experimentelle Medizin (Berlin) gezüchtet worden. Alle Experimente wurden den Bestimmungen des deutschen Tierschutzgesetzes entsprechend durchgeführt. Die Genotypisierungen der TLR-defizienten Tiere, sowie der LBP-/- wurden durch PCR nach Angaben der Züchter bzw. Hersteller durchgeführt (Primersequenzen und PCR-Konditionen siehe Anhang Tabellen D-G;).

2.2.2 Haltungsbedingungen

Die TLR-/-- und Wildtyp-Mäuse wurden im Forschungszentrum für Experimentelle Medizin in Berlin-Steglitz unter spezifisch-pathogenfreien (SPF) Bedingungen gehalten. Je nach Gruppengröße wurden Makrolonkäfige der Typen Typ II und III verwendet. Als Einstreu und Futter kamen ssniff 3/4 Faser und jeluxyl 300/500 und ssniff-V1120M-Z, ssniff-V1530R/M-H (ssniff Spezialdiäten GmbH, Soest, D) in Pelletform als Trockenfutter zum Einsatz. Die Tiere erhielten einmal wöchentlich sterilisiertes Trockenfutter und frisches Leitungswasser. Die Käfige wurden einmal wöchentlich gewechselt. Die abiotischen Faktoren in den Räumen waren: 55-60% relative Luftfeuchte bei 21°C und 12/12-Stunden Hell/Dunkelrhythmus.

2.3  Tierversuche

2.3.1  Induktion einer Ileitis durch orale T. gondii-Infektion

↓11

Die für die Induktion der Ileitis notwendigen T. gondii-Zysten wurden zunächst in NMRI-Mäusen generiert, die keine Ileitis entwickelten, und welche die akute Phase der Infektion überlebten. Nach intraperitonealer Infektion mit 10 Zysten von T. gondii (Stamm ME49) entwickelten die NMRI-Mäuse eine chronisch-progrediente Enzephalitis. Die Parasiten gelangten ins zentrale Nervensystem und in die quergestreifte Muskulatur. Sie verbleiben dort lebenslang als Bradyzoiten in Zysten. Nach etwa zwei bis drei Monaten konnten aus den Gehirnen dieser Tiere Zysten für die Ileitis-Induktion bei suszeptiblen Tieren entnommen werden. Am Tag der Infektion der C57BL-Mäuse wurden die Gehirne der NMRI-Tiere entnommen, in PBS suspendiert, die Anzahl der Zysten ermittelt und auf das gewünschte Volumen von 0,3 mL PBS eingestellt Für die Induktion einer T. gondii-induzierten Ileitis wurden suszeptiblen C57BL/6-Mäusen bzw. C57BL/10 oder TLR2-/--, TLR4-/--, TLR2+4-/--Mäusen 100 Zysten von T. gondii (Stamm ME49) in 0,3 mL PBS oral per Gavage verabreicht. Diese Infektion löste eine akute terminale Ileitis aus (nach Liesenfeld 2002).

2.3.2 Induktion der Colitis mit DSS

Für die Induktion der Colitis erhielten die Versuchstiere im Trinkwasser gelöstes DSS (3,5% w/v) über einen Zeitraum von sieben Tagen. Dies verursachte eine akute Colitis. Die Probennahme erfolgte am Tag acht, einen Tag nach Absetzen des DSS. Die Trinkmengen wurden täglich kontrolliert.

2.3.3  Salmonella enterica als orale Lebendvakzine gegen H. pylori

Im Rahmen einer präklinischen Studie über Vakzinierungsstrategien gegen H. pylori wurde in Kooperation mit dem Max-Planck-Institut für Infektionsbiologie (Dr. Toni Aebischer, Prof. T.F. Meyer, Berlin) die Magenflora in Balb/c-Mäusen mittels molekulargenetischer Methoden untersucht. Es wurde eine prophylaktische perorale Immunisierung mit dem attenuierten Salmonella enterica serovar typhimurium Stamm SL3261 durchgeführt, der die H. pylori Urease-Untereinheiten UreA und UreB von dem Plasmid pYZ97 überexprimiert. Für die Immunisierung wurden einmalig ca. 5x109 KBE Salmonella, suspendiert in 100 µL PBS, peroral verabreicht. Die so immunisierten Tiere wurden nach vier Wochen mit dem Streptomycin-resistenten H. pylori Stamm P76 infiziert (1x109 KBE) oder mit PBS behandelt (nach Gomez-Duarte et al. 1998; Lucas et al. 2001). Acht bis neun Wochen nach der H. pylori-Infektion wurden die Mägen entnommen und eine molekulargenetische Analyse der Magenflora durchgeführt. Die Daten wurden ergänzt durch kulturelle Bestimmungen der H. pylori-Last, histologische Untersuchungen der mukosalen Gewebeintegrität und Messungen des gastrischen pH (Aebischer et al. 2006).

2.3.4 Übersicht zum Ablauf der Probennahme bei Ileitis und Colitis

↓12

Im Verlauf der Ileitis wurden die Tiere täglich gewogen und Aussehen und Verhalten beurteilt. Bei der DSS-Colitis wurden täglich Beurteilungen mehrerer klinischer Parameter durchgeführt (nach Siegmund et al. 2001). Am Sektionstag wurden die Mäuse mittels Inhalationsnarkose mit dem Narkotikum Halothan® getötet. Nach einer Ganzkörperdesinfektion im Ethanolbad wurde das Bauchfell steril eröffnet. Durch den noch verschlossenen Situs erfolgte eine kardiale Blutentnahme mit steriler Spritze. Aus dem Blut wurde eine Blutkultur (Thioglykolatmedium) zur Überprüfung von ins Blut translozierten Bakterien angelegt. Der Rest des kardialen Vollblutes wurde der Gewinnung von Serum zugeführt. Das Serum wurde zur Bestimmung von Immunmediatoren gewonnen. Nach der Eröffnung des Bauchraumes durch einen Y-förmigen Schnitt wurden zunächst Stücke von der Leber und Milz sowie die mesenterialen Lymphknoten unter sterilen Bedingungen entnommen und in eine Organkultur zur Bestimmung von Immunmediatoren überführt. Danach erst erfolgte die Präparation des Intestinums. Für die Analyse der ilealen Darmflora wurde (meist flüssig-halbfester) Darminhalt des terminalen Ileums (ca. 1 cm Länge) in ein 2 mL Eppendorfgefäss gefüllt mit 1.5 mL PBS überführt. Beim Colon hingegen wurde eine geformte Fäzeskugel oder flüssiger Fäzes aus einem möglichst entzündeten Abschnitt entnommen oder von dort, wo Fäzes zu gewinnen war. Aus diesem Material wurden Bakterien für eine qualitative sowie quantitative Analyse auf Festmedien ausgebracht und die Gesamt-DNA-Extrakte dienten als Basis für die nachfolgenden molekulargenetischen Analysen. Weiteres Gewebe vom terminalen Ileum bzw. Colon wurde für Organkultur, für Gewebeschnitte und zur RNA-Isolierung gewonnen. Unter der Sektion erfolgte eine Beurteilung der Organe bezüglich morphologischen Aspekten, Volumen-/Grössenänderungen, Einblutungen, Stenosen sowie Stuhlkonsistenz. Als Marker für den Entzündungsgrad wurde die relative Verkürzung der Darmlänge gewählt. Dabei wurde die Dünndarmlänge von Magenausgang bis zum Caecum gemessen und das Colon vom Caecumende bis zum Anus. Die relative Verkürzung des Dünndarms bzw. Dickdarms wurde wie folgt kalkuliert: Relative Verkürzung in Prozent = Mittelwert Darmlänge am Tag null minus Mittelwert der Darmlänge am Tag acht p.i.(bzw. nach Absetzen des DSS) X 100 / Mittelwert Darmlänge Tag null.

Abb. 5: Versuchsvorbereitung, Probennahme und Auswertung bei der T. gondii-induzierten Ileitis und DSS-Colitis (Modifiziert nach Julia Niebergall, medizinische Dissertationsschrift).

2.3.5 Beurteilung von Histopathologie in Ileum und Colon

Die Histopathologie und die Parasitenlast wurden in Gewebestücken aus dem terminalen Ileum bzw. Colon ermittelt, die in 5% Formalin fixiert und in Paraffin eingebettet worden waren. Zur Beurteilung der Histopathologie im Ileum oder Colon wurden Mikrotom-Schnitte (5 µm) mit Hämatoxylin und Eosin (HE) gefärbt, im Lichtmikroskop untersucht und ein standardisiertes histologisches Punktesystem von null bis sechs angewandt. Bezüglich des Entzündungsprozesses wurden folgende Punktwerte vergeben: null = normal; eins = ödematös, Veränderungen in den Zotten; zwei = intraluminale Exkretion von Transsudat, aber intaktes Epithel; drei = intraluminales Abschilfern von Epithelzellen; vier = beginnende Epithelauflösung; fünf = Mukosazerstörung <50% der Ileumlänge; sechs = transmurale Zerstörung >50% Ileumlänge, schwere Nekrose). Die Analyse erfolgte in einer geblindeten Untersuchung durch zwei Untersucher (MMH und DF). Bei der DSS-Colitis wurde zusätzlich zur Histopathologie ein klinischer Index erhoben (nach Siegmund et al. 2001), der von null bis zwölf reichte. Es wurden Gewichtsverlust, Blut im Stuhl und die Stuhlkonsistenz beurteilt. Die Punktwerte für Gewichtsverlust waren (Gewichtsverlust in % / Punktwert): 0-5% / 0; 5-10% / 1; 10-15% / 2; 15-20% / 3; > 20% / 4. Die Punktwerte für Blut im Stuhl (Hämoccult): negativ / 0; positiv / 2; makroskopisch / 4. Für die Stuhlkonsistenz wurden folgende Punkte vergeben: normal oder hart / 0; weich / 2; am Anus klebend oder flüssig / 4.

2.3.6 Beurteilung der Parasitenlast

↓13

Zur Beurteilung der Parasitenlast im Ileum wurden parasitenhaltige Vakuolen mit T. gondii-Tachyzoiten oder Tachyzoiten-Antigen immunhistologisch über T. gondii-Antiserum in 2 Feldern eines zufällig gewählten Darmstücks einer Darmrolle (1 cm) mit PAP-Färbung (Peroxidase-Antiperoxidase) sichtbar gemacht und gezählt. Die Angabe erfolgte in Anzahl der Tachyzoiten pro Zentimeter Darmrolle. Die Auswertung der Gewebeschnitte erfolgte durch MMH und DF.

2.3.7 Kulturelle Analyse der Bakterienflora

Der Darminhalt des terminalen Ileums (ca.1 cm) wurde in PBS resuspendiert und gewogen. Nach einer seriellen Verdünnung wurden 100 µL Aliquots auf Agarmedien (Oxoid) bei 37°C für 48 Stunden aerob und für fünf Tage anaerob kultiviert. Die Gesamtzahl der Kolonien wurde auf Columbiablut-Agar ermittelt. Gallensalz-Aesculin und McConkey-Agar wurden zur quantitativen Analyse von Enterokokken bzw. Enterobakterien benutzt. Die Anzahl der Milchsäurebakterien wurde auf Rogosa-Agar (Merck) bestimmt. Zur differenzierten Analyse der anaeroben Flora wurden Columbia-Festmedien mit Kanamycin-Vancomycin eingesetzt. Die Anzahl von Gram-positiven und Gram-negativen Bakterien wurde über das Auszählen verschiedener Koloniemorphotypen auf Columbiablut-Agar bestimmt. Die Bakterien wurden subkultiviert und durch Gram-Färbung und biochemische Leistungsprüfung mit den API-Systemen API20E für die Enterobakterien, API50CH für die Laktobazillen und API Rapid ID32A für obligate Anaerobier (Biomerieux) weiter untersucht. Die Ergebnisse wurden als koloniebildende Einheiten (KBE) pro Gramm Darminhalt dargestellt. Die kulturellen Analysen wurden in Kooperation mit MMH, David Fuchs und Julia Niebergall (beide cand. med.) duchgeführt.

2.3.8 Antibiotische Behandlung der Ileitis

Zur prophylaktischen oder therapeutischen Behandlung der T. gondii-induzierten Ileitis erhielten die Mäuse die Antibiotika Ciprofloxacin und / oder Metronidazol (50 mg/kg KG/Tag in PBS) peroral über Gavage zweimal am Tag. Zur prophylaktischen oder therapeutischen Behandlung der T. gondii-Ileitis wurde zum anderen der nicht resorbierbare LPS-Antagonist Polymyxin B (Euro OTC Pharma, Kamen) eingesetzt. Die Gabe erfolgte in der Dosierung 50 mg/kg KG/Tag (in PBS) peroral über Gavage zweimal am Tag. Um direkte Wechselwirkungen der Antibiotika mit den Parasiten zu vermeiden, wurden diese 24 Stunden vor und nach der Parasitengabe abgesetzt. Bei der prophylaktischen und therapeutischen Behandlung wurden Antibiotika entweder fünf Tage vor bzw. nach der Parasiteninfektion verabreicht.

2.3.9 Herstellung gnotobiotischer Mäuse, definierte Rekolonisierung und Gabe von E. coli Lipid A

↓14

Um die kultivierbare Darmflora vollständig zu eradizieren, wurden mindestens acht Wochen alte Mäuse in sterile Käfige transferiert. Sie erhielten einen Cocktail aus Ampicillin (1g/l, Ratiopharm), Vancomycin (500 mg/l, Cell Pharm), Ciprofloxacin (200 mg/l, Bayer Vital) Imipenem (250 mg/l, MSD) und Metronidazol (1 g/l, Fresenius) im Trinkwasser ad libitum über einen Zeitraum von sechs bis acht Wochen (nach Rakoff-Nahoum et al. 2004, modifiziert). Die Abwesenheit kultivierbarer Bakterien wurde wöchentlich und nach Sektion durch Inkubation von Fäzesproben über mindestens sieben Tage bei 37°C in den Flüssigmedien Hirn-Herz-Bouillon und Thioglykolat (Oxoid) mit anschliessender Trübungsmessung beurteilt. Die Abwesenheit kultivierbarer Bakterien wurde auch mikroskopisch in Gram-gefärbten Fäzesproben und Darminhalt überprüft. Bei sichtbarer Trübung der Anreicherungsmedien wurden diese auf Agarmedien aerob und anaerob kultiviert und mikroskopisch und biochemisch beschrieben. Die so generierten gnotobiotischen Mäuse ohne kultivierbare Darmflora wurden definiert rekolonisiert mit: luminalem Ileuminhalt von Tieren mit Ileitis, E. coli, einer Mischung von strikt anaeroben Bakterien, bestehend aus Bacteroides/Prevotella spp., oder Lactobacillus johnsonii durch orale Gavage von 0,3 mL Suspension an drei aufeinanderfolgenden Tagen. Vier Tage vor den Rekolonisierungsexperimenten wurde der Antibiotikacocktail abgesetzt und durch steriles Trinkwasser ersetzt. Vier Tage nach der dritten Gabe von Ileuminhalt oder Bakteriensuspension wurden die Tiere mit T. gondii infiziert, um eine Ileitis zu induzieren. Zur Gewinnung von Darminhalt aus kranken Tieren wurde der Ileuminhalt von fünf C57BL/6-Tieren am Tag acht p.i. an drei aufeinanderfolgenden Tagen gewonnen. Der Ileuminhalt wurde in 2,5 mL PBS gepoolt und jeweils 0,3 mL pro Versuchstier peroral verabreicht. E. coli und Bacteroides/Prevotella spp. wurden aus dem Darminhalt Ileitis-kranker Tieren isoliert, L. johnsonii aus einem gesunden Kontrolltier. Alle Isolate wurden biochemisch und über vergleichende 16S rRNA Analyse identifiziert. E. coli und L. johnsonii wurden in Hirn-Herz-Bouillon kultiviert. L. johnsonii und E. coli wurden nach Zentrifugation in sterilem PBS gewaschen und in 5 mL PBS resuspendiert (0,3 mL / Tier perorale Gavage). Eine Mischung aus obligat anaeroben Gram-negativen Stäbchen Bakterien Bacteroides uniformis, B. ovatus, B. thetaiotaomicron, Prevotella buccae, P. oralis wurde in Thioglykolat-Medium kultiviert. Die Isolate wurden auf einen McFarland-Wert von sechs eingestellt (ca. 109–1010 KBE/mL). Um oxidativen Stress für die anaeroben Bakterien zu vermeiden, wurden die Flüssigkulturen hier nicht zentrifugiert, sondern in einem Endvolumen von 5 mL gepoolt und verabreicht, wie oben beschrieben. Die Bakterienkonzentrationen wurden durch quantitative Kultivierung auf Agarmedien bestimmt. Für die Behandlung mit E. coli LPS erhielten die gnotobiotischen Mäuse ab Tag sechs vor der T. gondii-Infektion 15 µg/mL Lipid A des E. coli-Stamms R515 (Nr. ALX-581-200-L002, Axxora Life Sciences, Grünberg) im autoklavierten Trinkwasser (bis Tag neun p.i.).

2.3.10 Statistik

Soweit nicht anders angegeben erfolgte die statistische Signifikanzberechnung von Mittelwerten und Standardabweichungen mit dem T-Test (Students t-Test). Die Signifikanzniveaus sind mit Sternen gekennzeichnet, * p<0.05, ** p<0.01 und *** p<0.001.

2.4  DNA-Isolierung und Polymerasekettenreaktion

2.4.1  Isolierung von DNA

Für die Extraktion bakterieller Gesamt-DNA aus unterschiedlichen Probenmaterialien kamen Standard-DNA-Verfahren zum Einsatz. Die kommerziellen Verfahren wurden je nach Probeneigenschaften gezielt ausgewählt.

↓15

Tab. 10: Methoden für die Extraktion von DNA aus verschiedenen Probenmaterialien

Probenmaterial

Kitbezeichung / Extraktionsmethode

QIAmp DNA Stool Kit

QIAmp DNA Mini Kit

Phenol-Chloroform

Invisorb Spin Plasmid Kit

GFX™Micro Plasmid Prep Kit

Fäzes

x

Darminhalt

x

Darmgewebe

x

Bakterienisolate

x

x

Plasmid DNA

x

x

Mausschwanz

x

Mausmagen

x

Enzymatisch-mechanische Extraktion von DNA mit Phenol-Chloroform

Nach Sektion der inneren Organe (siehe 2.3.4; Abb.6) wurde der Darminhalt aus Ileum oder Colon in 1 mL PBS resuspendiert. Die Suspensionen wurden zentrifugiert (20 min bei 16.000 x g), der Überstand entfernt und das „Pellet“ in 500 µL Lysispuffer resuspendiert. Die enzymatische Lyse erfolgte nach Zugabe von 20 µL Proteinase K (20 mg/mL) durch einstündige Inkubation bei 56°C. Um auch Zellwände Gram-positiver Bakterien aufzuschliessen, wurde das Lysat mit 150 µL Phenol, 150 µL CI-Lösung (Chloroform:Isoamylalkohol 24:1; v/v) und 0,3 g Zirkonium-Silika-Perlen versetzt. Nach der mechanischen Behandlung (3 x 30 s auf Stufe 5,5) im Homogenisator (FastPrep FP120) folgte eine Zentrifugation (5 min bei 16000 x g). Die DNA-haltige wässrige Phase wurde anschliessend mit CI-Lösung zweimal gewaschen. Nach DNA-Fällung mit 0,1 Volumenteilen Natriumacetat (3 M) und 2,5 Volumenteilen Ethanol (-20°C über Nacht) erfolgte eine Zentrifugation (20 min bei 16000 x g). Das DNA-Pellet wurde zweimal mit Ethanol (70% v/v) gewaschen, in einer Vakuumzentrifuge getrocknet und anschließend in 300 µL TE-Puffer resuspendiert. Die Lagerung der extrahierten DNA erfolgte bei -20°C.

Thermische Lyse von Bakterien

Für die Freisetzung von DNA aus anaeroben Gram-negativen Bakterienisolaten wurde eine Kolonie vom Festmedium abgenommen und in 250 µL PBS suspendiert. Nach dreimaligem Aufkochen (98°C/10 min) und Tiefkühlen (-20°C) wurden die Lysate kurz anzentrifugiert. Die DNA im Überstand wurde direkt für die Amplifikation im PCR-Reaktionsansatz verwendet (1 µL).

Isolierung von DNA mit dem QIAmp-DNA-Stool-Kit

↓16

Für die molekulare Analyse der Bakterienflora aus Fäzesproben wurde das „QIAmp-DNA-Stool-Kit“ verwendet. Mögliche PCR-Inhibitoren, die im Fäzes in hoher Konzentration enthalten sein können, sollen durch dieses „Kit“ reduziert werden. Die Extraktion erfolgte nach dem Protokoll des Herstellers.

2.4.2 Amplifikation der bakteriellen 16S rRNA-Gene

Für die spezifische Amplifikation von DNA des 16S rRNA-Gens von Bakterien wurde die Polymerase-Ketten-Reaktion (PCR; Mullis & Faloona, 1987) verwendet. Da die hitzestabile Taq-DNA-Polymerase aus Thermophilus aquaticus (AmpliTaq DNA Polymerase, Applied Biosystems) keine „Proofreading“-Aktivität hatte, wurde den Reaktionsgemischen für die PCR Pfu-DNA-Polymerase (im Verhältnis 10 (Taq) / 1 (Pfu)) beigemischt, die bei identischem Temperaturoptimum (72°C) „Proofreading“ katalysiert. Die Amplifikation der 16S rRNA-Gene unter Standardbedingungen wurde in 50 μL Reaktionsgemisch (2 mM MgCl2; 1,25 mg BSA; 0.5 µM Primer TPU1; 0.5 µM Primer (RTU8); 200 µM dNTPs; 5.0 U AmpliTaq DNA Polymerase, 0.5 U Pfu Turbo Cx DNA Polymerase, Stratagene) im T3 Thermocycler durchgeführt. Nach einer initialen Denaturierung bei 98°C für 3 min wurde die Amplifikation (29mal: 93°C/1 min; 56°C/1 min; 72°C/3 min) durchgeführt. Nach einer abschliessenden Elongation für 7 min bei 72°C wurden die PCR-Produkte elektrophoretisch aufgetrennt.

2.4.3 Klonierung der amplizierten 16S rRNA

Die durch PCR amplifizierten 16S rRNA-Gene der Bakterien, die aus dem Mausmagen oder dem Mausdarm isoliert worden waren, wurden mit dem „TOPO-TA-Cloning®-Kit“ und dem „TA-Cloning®-Kit“ gemäß den Angaben des Herstellers kloniert. Die zu klonierenden PCR-Produkte wurden durch eine präparative Agarosegelelektrophorese gereinigt und mit dem „QiaQuick-Gel-Extraction-Kit“ aus dem Gel eluiert. Die PCR-Produkte wurden mit den Plasmid-Vektoren pCR®2.1 / pCR®2.1-TOPO® ligiert und in E. coli TOP10F’ transformiert. Die transformierten Zellen wurden auf LAXI-Agar kultiviert (37°C, ü.N.) und im Anschluss einem Blau-Weiss-„Screening” unterzogen. Nach einmaliger Überimpfung und Kultivierung weißer, positiver Kolonien auf LAXI-Agar wurde mit 1 µL Zellysat einer weissen Kolonie die Insertlänge in den rekombinanten Plasmiden mittels PCR durchgeführt. Dazu wurde die in die Plasmide inserierte bakterielle DNA mit den zu den flankierenden Plasmidbereichen komplementären Primern M13(-20) und M13 Reverse in 25 µL Reaktionsgemisch unter Standardbedingungen (siehe 2.4.2) amplifiziert.

2.4.4 Isolierung der bakteriellen Plasmid-DNA

↓17

Für die Präparation der Plasmid-DNA wurden die transformierten Bakterien aus je einer weissen Kolonie auf LAXI-Festmedium in 1 mL LB-Medium mit Ampicillin (50 μg/mL) bei 37°C über Nacht kultiviert. Die Isolierung und Aufreinigung der Plasmid-DNA erfolgte mit dem „Invisorb Spin Plasmid Mini Kit“ oder dem „GFX™Micro Plasmid Kit“ gemäß der Herstellerangaben. Die isolierten Plasmide wurden elektrophoretisch aufgetrennt und im UV-Licht analysiert.

2.4.5 Reinigung und Überprüfung der PCR-Produkte

Silika-Reinigung

Die Menge der verwendeten Reagenzien für die Silika-Aufreinigung (Boyle & Lew, 1995) wurde proportional an das Volumen des PCR-Reaktionsgemischs angepasst. Einem Standard-PCR-Volumen von 50 µL wurden 90 µL Natriumjodidlösung (6M) und 7 µL Silika-Suspension zugegeben und 10 min bei RT geschüttelt. Nach einminütiger Zentrifugation bei 16.000 x g wurde der Überstand verworfen. Das Pellet wurde zweimal mit Silika-Waschpuffer gewaschen. Die Elution der DNA erfolgte mit 50 µL TE-Puffer bei 50 °C für 10 Minuten. Nach Zentrifugation für 1 min bei 16.000 x g wurde die DNA-haltige Überstand abgenommen. Die gereinigten PCR-Produkte wurden anschließend in einem Agarose-Gel auf die erwartete Grösse hin überprüft.

Photometrische Bestimmung der DNA-Konzentration

Zunächst wurden von der zu bestimmenden DNA-Lösung Verdünnungen in Wasser oder Elutionspuffer hergestellt. Durch Absorptionsmessung bei 260 und 280 nm sowie durch Berechnung des Verhältnisses OD260/OD280 waren Rückschlüsse auf die Reinheit der Nukleinsäurelösungen möglich.

Agarosegel-Elektrophorese für DNA und PCR-Produkte

↓18

Die qualitative Kontrolle der PCR-Produkte und DNA-Extrakte erfolgte durch Auftrennung eines Gemisches aus je 5 μL Amplifikat oder 1 µL DNA-Extrakt und 3-5 μL Agarosegel-Probenpuffer in einem horizontalen Agarosegel (0.8% – 4% je nach Amplikongrösse variierend). Zur Anfärbung der Nukleinsäuren wurde 1 μL Ethidiumbromidlösung (10 mg/mL) zu 100 mL heißer, flüssiger Agarose-Lösung gegeben. Die Trennung erfolgte bei 10 V/cm in 1x TBE. Die DNA-Banden in den Gelen wurden anschließend im UV-Licht sichtbar gemacht und mit dem „GeneGenius“-System ausgewertet und dokumentiert.

2.5 Denaturierende Gradienten-Gel-Elektrophorese

Mit Hilfe der DGGE kann die bakterielle Diversität komplexer Habitate dargestellt werden. Wenn die durch PCR amplifizierten 16S rRNA-Gene aus einem Bakteriengemisch in einem denaturierenden Polyacrylamidgel mit Harnstoff-Formamid-Gradienten elektrophoretisch aufgetrennt werden, dann ist die Anzahl der resultierenden Banden zur Komplexität der Population proportional. Das Trennprinzip beruht auf sequenzabhängigen Unterschieden in den Schmelzpunkten der 16S rRNA-Gene. Die Primer 16S 968F-GC und 16S 1378R (modifiziert nach Nübel et al. 1996; Tab.6) binden unabhängig von der Bakterienart in hochkonservierten Sequenzabschnitten des 16S rRNA-Gens und flankieren die variablen Regionen 6 bis 8 (V6-V8). Das resultierende Amplikon ist 400 Basenpaare (Bp) groß. Die Primer HDA1GC (Walter et al. 2000, 2001) und HDA2 binden in Sequenzabschnitten, welche die variablen Regionen V2-V3 des 16S rRNA-Gens flankieren. Die Amplifikate sind hier 200 Basenpaare gross. Die Primer 16S 968F-GC und HDA1GC tragen am 5'-Ende eine GC-reiche Sequenz, die 40 Bp lang ist. Diese wirkt wie eine Klammer und hält die denaturierten Amplifikate an einem Ende zusammen. Dadurch wird die Bremswirkung der Denaturierung auf die Laufgeschwindigkeit verstärkt. Für die PCR-basierte DGGE-Analyse der Bakterien in der Magen- oder Darmflora der Maus wurden Teile der bakteriellen 16S rRNA-Gene aus 20-100 ng Gesamt-DNA in 50 µL PCR-Puffer mit 2,5 mM MgCl2, 200 mM dNTPs, 0,3 µM GC-Klammer-Primer 1, 0,3 µM Primer 2, 400 ng BSA, 5 Units Taq-DNA-Poymerase und 0,5 Units Pfu-Polymerase amplifiziert. Die Reaktionsbedingungen für die unterschiedlichen Amplikons sind in Tabelle 11 zusammenfassend dargestellt.

Tab. 11: 16S rRNA PCR-DGGE Reaktionsbedingungen (T3 Thermocycler)

Primerkombination

PCR Schritt

Zeitdauer

Temperatur

16S 968F-GC /

16S 1378R

Initiale Denaturierung

7 min

95 °C

Denaturierung

30 s

93 °C

Primeranlagerung

1 min

60 °C

Strangverlängerung

1 min

72 °C

Finale Strangverlängerung

30 min

72 °C

HDA1GC / HDA2

Initiale Denaturierung

2 min

94 °C

Denaturierung

30 s

94 °C

Primeranlagerung

1 min

61 °C

Strangverlängerung

1 min

72 °C

Finale Strangverlängerung

30 min

72 °C

2.5.1  Herstellung der Gele für die DGGE

↓19

Der denaturierende, chemische Gradient aus Harnstoff und Formamid wurde mit einem Gradientenmischer Model 475 nach Angaben des Herstellers (Bio-Rad, München) hergestellt. Die Gele wurden auf eine Trägerfolie gegossen (GelBond®). Die jeweilige Gradientengebrauchslösungen wurden aus den Stammlösungen I (0%) und II (100%) hergestellt. StammLösung I hat 0% und Stammlösung II (40% Formamid, 7M Harnstoff) 100% denaturierende Eigenschaften. Die Fragmente wurden in dem 8%igen Polyacrylamidgel in 0,5x TAE Puffer aufgetrennt. Die Elektrophorese erfolgte entweder in einer „DCode“ oder in der „DGene“ Apparatur bei 60°C. Amplikons, die mit den Primern 16S 968F-GC und 16S 1378R (Tab. 6) hergestellt worden waren, wurden in einem Gradienten von 35-60% bei 80V für 16 Stunden aufgetrennt. Amplikons, die mit den Primern HDA1GC-HDA2 hergestellt worden waren, wurden in einem Gradienten von 35-50% bei 130V für 5,5 Stunden aufgetrennt.

2.5.2 Färbung von DNA

Nach der Elektrophorese wurden die aufgetrennten 16S rRNA-Teilgene der Bakterien durch Silberfärbung als Banden im Gel sichtbar gemacht. Bei der Silberfärbung wurden die Gele 30 min in Ethanol / Essigsäure (30% / 10% v/v) fixiert. Nach einer Sensitivierung mit Ethanol (30%) zweimal für 30 min, erfolgten fünf Waschschritte (10 min) mit Aqua dest. Nach Einwirkung der Färbelösung für 30 min erfolgte die manuelle Entwicklung und das Abstoppen der Färbereaktion mit Essigsäure (30%). Nach Abtropfen der Essigsäure wurden die Gele in Folie eingeschweisst und bei Raumtemperatur dunkel gelagert. Zur Auswertung der Banden wurden die Gele digitalisiert.

2.5.3 DGGE-Bandenisolierung und direkte Sequenzierung

Um die aufgetrennten 16S rRNA-Teilgene Bakterienarten zuordnen zu können, wurde eine Sequenzanalyse der DNA aus den DGGE-Banden durchgeführt. Die Elution von Amplifikaten aus silbergefärbten DGGE-Gelen erwies sich als wenig praktikabel und führte oft zu negativen Ergebnissen bei der darauf folgenden Reamplifikation. Aus diesem Grund wurden die Gele stattdessen für 20 min mit SYBR Green I (10 µL 10.000fach Konzentrat auf 100 mL Aqua dest.) gefärbt. Unter UV-Licht wurden Gelbanden mit einem sterilen Skalpell ausgeschnitten und in 100 µL Aqua dest. über Nacht bei 37°C geschüttelt, so dass die Amplifikate in Lösung gehen konnten. Diese eluierten Amplifikate dienten als Vorlage für die Reamplifikation unter Standardbedingungen mit den Oligonukleotiden 16S 968F und 16S 1378R (Tab. 6). Die resultierenden Amplifikate wurden mit dem Primer 16S-968F sequenziert. Waren in einer DGGE-Bande 16S rRNA-Gene von mehreren Bakterienarten vorhanden, war eine eindeutige phylogenetische Zuordnung nur nach einer Klonierung der Reamplifikate möglich (siehe 2.4.3).

2.6  DNA Sequenzierung

2.6.1  Identifizierung von Bakterienisolaten

↓20

Ausgewählte Bakterienisolate: E. coli; Bacteroides/Prevotella sp., Enterococcus sp., Lactobacillus sp. u.a. wurden zusätzlich zu der biochemischen Leistungsprüfung (siehe 2.3.7) anhand ihrer 16S rRNA Sequenzen phylogenetisch identifiziert. Dazu wurden die kompletten 16S rRNA-Gene mittels PCR mit den Primern TPU1/RTU8 (Tab.6) aus isolierter DNA oder aus Lysaten amplifiziert und sequenziert. In der Regel wurde der Primer TPU1 für die Sequenzierung verwendet. Üblicherweise reichte eine Teilsequenz von ca. 500 Bp für die Identifizierung der Bakterienarten durch Vergleich mit Sequenzen in Datenbanken aus (siehe 2.6.3). In einzelnen Fällen wurden auch Sequenzen der kompletten 16S rRNA-Gene (ca. 1500 Bp) generiert.

2.6.2 Sequenzanalyse von 16S rRNA-Genbibliotheken

Als Sequenziervorlage dienten entweder Plasmid-DNA, oder die 16S rRNA „Inserts“ wurden zunächst mit Hilfe der vektorspezifischen Primer M13(-20) und M13 Reverse unter Standardbedingungen amplifiziert (siehe 2.4.2). Als Amplifikationsvorlage wurden jeweils 0,5 μL der jeweiligen Plasmid-Präparation bzw. 1 µL PCR- Produkt verwendet. Die PCR-Produkte (siehe 2.6.1), die als Vorlage für die Sequenzierung dienten, wurden mit dem „QIAquick PCR Purification Kit“ nach Angaben des Herstellers gereinigt. Für die Sequenzierung der 16S rRNA kamen die vektorspezifischen Primer M13(-20) und M13-Reverse sowie bakterienspezifische Primer (siehe Tab.5/6) zum Einsatz. Alle Reaktionen wurden mit dem „DTCS™ Quick Start Kit“ durchgeführt. Ein Reaktionsansatz (20 μL) enthielt 4 µL Master Mix, 100 fmol aufgereinigtes PCR-Produkt bzw. aufgereinigte Plasmid-DNA, 1,6 µM Primer und Aqua dest ad 20 µL. Nach einer initialen Denaturierung bei 95°C für 5 min wurden die Sequenzierreaktionen (29mal: 95°C/20 s; 58°C/30 s; 72°C/1 min) im T3 Thermocycler durchgeführt. Die Produkte wurden mit dem „CleanSEQ® Kit“ gereinigt und in Formamid resuspendiert. Die Sequenzierung erfolgte im CEQ™8000-Gerät bei einer Kapillartemperatur von 50°C. Einer initialen Denaturierung (90°C für 120 Sekunden) folgte die Injektion bei 2.0 kV für 15 Sekunden und einer Separation bei 4.0 kV für 110 Minuten. Die Separation erfolgte in LPA I Gel (GenomeLab™).

2.6.3 Phylogenetische Einordnung der bakteriellen 16S rRNA-Sequenzen

Für die Auswertung der Sequenz-Rohdaten wurde die CEQ™8000-Software verwendet. Nach qualitativer Überprüfung der Chromatogramme wurden die 16S rRNA-Gensequenzen im FASTA-Format mit den in öffentlichen Datenbanken (http://www.ncbi.nlm.nih.gov/BLAST; http://rdp.cme.msu.edu/seqmatch) hinterlegten Sequenzen verglichen Bei unsicherer taxonomischer Zuordnung wurden die nächsthöheren Taxa angegeben.

2.7 Identifikation von 16S rRNA-Genen in Klonbibliotheken durch Hybridisierung

↓21

Aufgrund der abundanten Kolonisierung des Mausmagens durch Lactobacillus-Arten sollte zur Redundanzvermeidung in der anschliessenden Sequenzierung der 16S rRNA-Gene eine Vorauswahl der Klonsequenzen getroffen werden. Analog zur bereits beschriebenen Vorgehensweise bei den Klonbibliotheken (siehe 2.6.2) wurde zum Durchmustern der Klonbibliotheken die Plasmid-DNA der betreffenden klonierten 16S rRNA-Gene mit Hilfe des GFX™Plasmid-Präparationskits präpariert. Nach Amplifikation mit vektorspezifischen Primern M13(-40) und M13 reverse wurden die Amplifikate, welche die 16S rRNA-Gensequenzen beinhalteten, auf positiv geladenen Nylon-Membranen durch Bestrahlung mit UV-Licht (250nm, 5 min) immobilisiert. Die Hybridisierung erfolgte bei 55°C mit der Digoxigenin-(DIG)-markierten Sonde Lac-141 (5´DIG-GACTGGGATAACACCTG-3´ (siehe Tab.5), welche für die 16S rRNA von Lactobacillus gasseri/johnsonii spezifisch ist. Die Spezifität wurde durch Hybridisierung der 16S rRNA aus Referenzstämmen (L. gasseri, L. johnsonii und andere Lactobacillus-Arten) überprüft. Die Sonde hybridisierte nicht mit den 16S rRNA anderer Bakteriengattungen (Abb.7; Kontrollblot). Als Dot-Blot-Spezifitätskontrollen wurden Referenz-16S rRNA PCR-Produkte von L. gasseri DSM 20243, L. gasseri Klon C5-4, L. acidophilus DSM 20079, L. johnsonii DSM 10533, L. delbrückii DSM 20074, L. reuteri Klon B6-62, L. murinus Klon C5-65, Klebsiella planticola DSM 3069, Bifidobacterium longum DSM 20219, Clostridium xylanolyticum DSM 6555, Bacteroides vulgatus DSM 1447, H. pylori (Klinisches Isolat), H. pylori, Helicobacter sp. und H. hepaticus (aus Klonbibliothek identifiziert) verwendet. Klone, die 16S rRNA-Sequenzen von H. pylori enthielten, wurden mit der Digoxigenin-markierten Sonde Hpy-1 (5´DIG-CACACCTGACTGACTATCCCG-3´ (Trebesius et al. 2000) detektiert. Die 16S rRNA-Gensequenzen, die mit keiner der beiden Sonden detektiert werden konnten, wurden mit den Primern 1513r und RTU5 ansequenziert, deren Bindestellen die variablen Regionen V6 und V8 der 16S rRNA flankieren.

Abb. 6: Kontrollhybridisierungen mit der für Lactobacillus gasseri/johnsonii-spezifischen (DIG)-markierten Sonde Lac-141 (Tab.5). Die Spezifität wurde durch Hybridisierung von 16S rRNA aus Referenzstämmen nachgewiesen (L. gasseri, L. johnsonii und andere Lactobacillus Arten, s. o.). Die Sonde hybridisierte nicht mit der 16S rRNA anderer Lactobacillus-Arten (5-7, Klonsequenzen identifiziert als L. delbrückii, L. reuteri, L. murinus) oder anderer nicht-Lactobacillus Arten (9-16, DSMZ Referenzstämme).


Die Hybridisierung wurde, wie in Tabelle 12 dargestellt, durchgeführt. Modifikationen des Protokolls hinsichtlich Waschpuffer und -temperatur wurden für beide Sonden empirisch ermittelt. Für Hpy-1 wurde die Waschpufferkombination 1/2 (Tab.4) bei einer Waschtemperatur von 65°C verwendet. Bei Hybridisierung mit der Sonde Lac-141 kam die Waschpufferkombination 2/2 zum Einsatz, und die Waschtemperatur betrug 68°C. Der Nachweis der gebundenen DIG-markierten Oligonukleotide erfolgte mit Hilfe des „DIG-Luminescence-Detection-Kits“. Um eine erneute Hybridisierung der Membranen zu ermöglichen, wurden gebundene Oligonukleotide durch Waschen mit Stripping-Lösung (2 x 30 min bei 37°C) entfernt.

↓22

Tab. 12: Durchführung der Dot-Blot-Hybridisierung

Schritt

Reagenz/Puffer

Temperatur °C

Zeit min

Prähybridisierung

Prähybridisierungspuffer

54

30

Hybridisierung

Sonde (100µM) in Prähybridisierungspuffer

55

90

Waschen

Waschpuffer 1

Variabel

15

Waschen

Waschpuffer 2

Variabel

15

Spülen

Maleinsäurepuffer

37

3

Blockieren

Blockierungs-Reagenz 1%

37

30

Blockieren +Antikörper

Blockierungs-Reagenz 1% + 2µL Antikörper Anti-DIG AP

37

30

Spülen

Maleinsäurepuffer

37

15

Spülen

Maleinsäurepuffer

37

15

Detektion

Detektionspuffer + 10 µL Substrat CSPD

37

15

2.8 Quantitative Echtzeit-PCR der Lactobacillus-16S rRNA

Populationsänderungen der Lactobacillus-Arten wurden mit einer quantitativen Echtzeit-PCR (q-RT PCR; SYBR Green) in einem LightCycler™ Instrument quantitativ erfasst. Dazu wurden die 16S rRNA-Gene von Lactobacillus-Arten mit dem Primer 8f in Kombination mit einem Lactobacillus-spezifischen Primer 16S-Lac-138+ (siehe Tab.6) amplifiziert. Der Gehalt an eubakterieller 16S rRNA-Gene in den Proben wurde durch Amplifikation mit den Primern 8f und RTU2b (Tab.6) ermittelt, die unspezifisch an die 16S rRNA-Gene aller Bakterienarten binden. Der relative Anteil der Lactobacillus-16S rRNA-Gene in der Probe wurde über die Signalintensitäten der beiden Amplikons berechnet. Dabei wurde die Signalintensität des eubakteriellen rDNA Amplikons auf 100% gesetzt. Das PCR-Protokoll am LightCycler startete mit Denaturierung bei 95°C für 10 s, gefolgt von 30 Zyklen mit Hybridisierung bei 56°C/10 s und Elongation bei 72°C für 45 s. Die Datenauswertung erfolgte mit der LightCycler Software Version 3.5.3.

2.9  Typisierung von E. coli

2.9.1  Typisierung von Bakterienisolaten mittels RAPD-PCR

Ausgewählte E. coli-Isolate aus C57BL/6, BL/10 und TLR-/--Mäusen wurden mit der RAPD-PCR genotypisiert. In den RAPD-PCR-Analysen werden kurze Zufalls-Primer (meist 10 Nukleotide lang) als Startermoleküle in der PCR eingesetzt. Das Verfahren wird auch willkürlich gestartete PCR „Arbitrarily primed PCR“ (AP-PCR) genannt (Welsh & McClelland 1990). In der PCR wird in der Regel nur ein Primer eingesetzt. Die Differenzierung der E. coli-Isolate erfolgte mit dem Primer 10bp Nowruz (siehe Tab.5; Nowrouzian et al. 2003). Der PCR-Ansatz für die Genotypisierung aus 50 ng E. coli-DNA erfolgte in 50 µl PCR Puffer, 25 mM MgCl2, 10 mM dNTP Mix, 25 µM 10 bp Nowruz und 5U/0,5U AmpliTaq/Pfu Turbo Cx DNA Polymerase. Die PCR Bedingungen für die RAPD-PCR waren wie folgt: Nach initialer Denaturierung (94°C 5 min) folgten 4 Zyklen (94°C/45 s, 30°C/120 s, 72°C/60 s). Darauf folgten 26 Zyklen bei 94°C über 5 s, 36°C/30 s und 72°C/30 s. Nach einer Endelongation bei 72°C für 10 min wurden die Produkte elektrophoretisch aufgetrennt. Die Elektrophorese erfolgte in einem 8%igen Polyacrylamid-Gel in 1x TAE Puffer bei 60°C, 130 V für 5,5 Stunden. Die RAPD-Bandenmuster wurden mit Silberfärbung sichtbar gemacht.

2.9.2 Pathotypisierung

↓23

Ausgewählte E. coli-Isolate aus dem Ileum von gesunden und von erkrankten Tieren mit Ileitis wurden auf das Vorhandensein von pathogen-assoziierten Genen untersucht. DNA-Extrakte aus E. coli-Isolaten wurden mit dem „QIAmp-DNA-Mini-Kit“ hergestellt und in die Medizinische Mikrobiologie der Medizinischen Hochschule Hannover (Dr. Florian Gunzer) versandt. Die Präsenz der Gene für die Shigatoxine (stx1 und stx2) wurde dort mittels LightCycler™ untersucht (Pulz et al. 2003), die anderen pathogen-assoziierten Gene (eaeA, hlyA, espA, katP, astA) mit konventioneller PCR. Die E. coli DNA Integrität wurde mit Primern für die E. coli-Gene tolC und recA überprüft.

2.10 Analysen der RNA-Expression durch Hybridisierung von Microarrays

Ileumstücke von C57BL/10 ScSn Wildtyp- und TLR2-/-- oder TLR4-/--Mäusen im gesunden Zustand und mit Ileitis (Tag acht p.i.) wurden mit der „Microarray“-Technik auf krankheits- und / oder TLR-abhängige spezifische Assoziationen hin untersucht. Für die Extraktion der Gesamt-RNA von ca. 1 cm Ileum kam der „RNeasy Mini Kit“ (Qiagen) zum Einsatz. Die Ileumstücke wurden nach der Sektion sofort in „RNAlater“ Stabilisierungsreagenz (Qiagen) überführt und bei -20°C gelagert. Die RNA-Isolierung erfolgte nach Protokoll des Herstellers und die RNA wurde bei minus 80°C eingefroren. Der Versand zum Helmholtz-Zentrum für Infektionsforschung (AG Mukosale Immunität) erfolgte auf Trockeneis. Die Analyse der RNA wurde in der „Array Facility“ der AG Mukosale Immunität (Prof. Dr. Jan Buer) mit freundlicher Unterstützung durch Herrn Dr. Robert Geffers durchgeführt. Die Daten wurden im CCM Mitte ausgewertet. Die Qualität und Integrität der isolierten RNA wurde mit dem Agilent Technologies 2100 Bioanalyzer (Agilent Technologies; Waldbronn, Deutschland) überprüft. Für die Biotin-markierte Synthese ausgehend von 3 µg Gesamt-RNA wurden die Reaktionsgemische nach Standardprotokollen des Herstellers angesetzt (Affymetrix; Santa Clara, CA). 3 µg RNA wurde mit 100 pmol T7T23V Primer (Eurogentec; Seraing, Belgium) in doppelsträngige DNA umgeschrieben. Die cDNA wurde direkt in die in vitro-Transkriptionsreaktion in Anwesenheit von biotinylierten Nukleotiden eingesetzt. Die Konzentration der Biotin-markierten cRNA wurde über UV Absorption bestimmt. Es wurden stets 12,5 µg cRNA fragmentiert und mit einem Hybridisationsgemisch versehen, das vier biotinylierte Hybridisationskontrollen enthielt (BioB, BioC, BioD und Cre) wie vom Hersteller vorgeschlagen. Die Proben wurden auf einem „Affymetrix GeneChip“ für 16 Stunden hybridisiert, gewaschen und mit Streptavidin-Phycoerythrin (SAPE) gefärbt. Das Auslesen der Signale erfolgte mit einem „Affymetrix GeneChip Fluidic Station / Scanner“. Die Analyse der „Microarray“-Daten wurde mit dem Affymetrix GCOS 1.2 und dem „Data Mining Tool“ 3.1 Software Paket durchgeführt. Zur Normalisierung aller „Array“-Experimente wurde die Zielintensität auf 150 skaliert, ansonsten wurden die Standardeinstellungen der GCOS 1.2 benutzt. Die Auswertung der Daten erfolgte nach folgenden Kriterien: die Expressionsänderungen dargestellt als Signal log Verhältnis entweder als Anstieg der Expression „Increase“ (I) bzw. Abstieg der Expression „Decrease“ (D). Bei der Analyse der entzündungs-assoziierten regulierten Genexpression im Wildtyp BL10 wurden die korrespondierenden Werte für die TLR2- bzw- TLR4-defizienten Tiere mit angegeben (s. 3.1.6, Gesamttabellen A-C; Anhang). Für die TLR4-abhängige entzündungs-assoziierte Regulation wurden die Werte für Wildtyp und TLR2-/- mit der Bedingung: „No Change“ (NC; keine Änderung) gefiltert. Die Expressionsänderung wurde als Signal log Verhältnis (engl.: signal log2 ratio) dargestellt. Das bedeutet, dass bei einer Änderung um ±log21 die Expression im Vergleich zur Grundlinie um den Faktor 2 erhöht oder erniedrigt war. Es wurden die Expressionsdaten am Tag acht (mit T. gondii-induzierter Ileitis) gegen Tag null (gesunder Zustand) von je einem Wildtyp,TLR2- bzw. TLR4-defizienten Tier analysiert.

2.11 Konzentrationsmessung von Immunmediatoren

Darmabschnitte (ca. 1 cm2, 50-100 mg) wurden steril entnommen, längs aufgeschnitten, in PBS gewaschen und in Zellkulturschalen (24, Flachboden, Nunc) mit 500 µL serumfreiem RPMI-Medium unter Zugabe von 1% Penicillin/Streptomycin (1640, Gibco) für 18 Stunden bei 37°C inkubiert. Nach 24 Stunden wurde der Kulturüberstand abgenommen und bei -80°C gelagert. Die Interferon (IFN)-gamma- und Stickstoffmonoxid (NO)-Konzentrationen wurden mittels ELISA (BD Biosciences) bzw. mit der Griess-Reaktion (Green et al. 1982) bestimmt. Bei der Griess-Reaktion wurden 50 µL Überstand (Medium) mit 50 µL 1,5% Sulfanilamid (Roth) in 1M HCl plus 0,15% N-(1-Naphthyl)ethylendiamindihydrochlorid (Sigma) gemischt. Nach 10 Minuten wurde die Absorption bei 540 nm photometrisch bestimmt. Die NO-Konzentrationen wurden über eine Standardkurve errechnet und auf Organgewicht und/oder Proteingehalt bezogen. Der ELISA (enzyme-linked immunosorbent assay) ist ein immunologisches Verfahren, mit dem einzelne Proteine über eine Antikörper-Antigen-Reaktion sensitiv und spezifisch nachgewiesen werden können. Soll ein bestimmtes Protein nachgewiesen werden, müssen die dazu passenden Antikörper bekannt sein und zuvor mit verschiedenen gentechnischen oder zellbiologischen Verfahren hergestellt worden sein. Hier kam das „Sandwich“-Verfahren zur Anwendung: Hierbei bindet ein spezifischer erster Antikörper („Capture Antibody“) am Boden einer Mikrotiterplatte (ImmunoMaxi, Biochrom). Nach dem Binden der Zielantigene im Probenmaterial wird ein zweiter Peroxidase-gekoppelter Antikörper hinzugefügt. Die Detektion erfolgt nach Umsetzung des Substrats (TMB) bei 450 nm im SpectraFluor Plus (Tecan). Die Messwerte wurden auf Gesamtproteingehalt und soweit verfügbar auf Organgewicht bezogen. Die Proteinbestimmung erfolgte nach der TCA-Methode (Sambrok et al. 1989).


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
10.01.2008