2 Material

↓14

Alle verwendeten Chemikalien wurden, sofern nicht anders vermerkt, in Analysequalität (p.a.) von den Firmen Becton, Dickinson and Company (BD), Miltenyi Biotec, Invitrogen, Merck, Renner, Roth, Falcon und Sigma bezogen. Enzyme und Nukleotide stammen von den Firmen Amersham Biosciences, MWG Biotech, New England BioLabs, Promega und Roche. Nitrozellulosemembranen und Radiochemikalien wurden bei Amersham Biosciences erworben. Die Verwendung der Radiochemikalien erfolgte unter Berücksichtigung von Kalibrierungsdatum und Halbwertszeit.

2.1 Stammlösungen, Puffer und Medien 

↓15

Soweit nicht anders erwähnt, wurden die Lösungen, Puffer und Medien mit sterilem A. bidest angesetzt und die pH- Werte durch Verwendung von 2 N Natronlauge (NaOH) bzw. Salzsäure (HCl) eingestellt. Hitzestabile Lösungen und Puffer für DNS- Arbeiten wurden 20 Minuten, RNS- Lösungen eine Stunde autoklaviert.

2.1.1  Allgemeine Lösungen

2.2 Lösungen und Medien für die Bakterienkultur

Medien werden zur Sterilisation 20 min bei 120 °C autoklaviert, hitzelabile Stoffe steril filtriert und den Medien nach Abkühlen auf 50 – 55 °C zugegeben. Zur Herstellung von LB- Platten wird LB- Medium vor der Sterilisation mit 1,5 % (w/v) Agar versetzt. Nach dem Abkühlen des LB- Agars auf 50 – 55 °C werden gegebenenfalls Selektionsantibiotika zugegeben und die Platten gegossen.

2.2.1  Kultivierung von Bakterien

↓16

2.3 Lösungen zur Analyse von Nukleinsäuren

2.3.1  Präparation von DNS

↓17

2.3.2  Gelelektrophorese

2.3.3  Transfer von Nukleinsäuren

↓18

2.4 Lösungen und Medien für die Zellkultur

Alle Medien und Lösungen, sowie A. bidest sind zellkulturgetestet. Selbst anzusetzende Lösungen wurden autoklaviert bzw. steril filtriert. Die Kulturmedien werden bei Invitrogen gekauft.

2.4.1  Kultivierung

↓19

2.5 Nukleinsäuren

2.5.1  Klonierungsvektoren

Tabelle 1: Klonierungsvektoren, ausführliche Vektorkarten siehe Anhang

Name

Eigenschaft

Quelle/Referenz

pBluescript II SK (+/-)

Ampicillin- Resistenz, MCS, Blau- Weiß- Selektion, T7/T3- Promoteren

Stratagene

pGL3- Basic Vektor

Ampicillin- Resistenz; MCS, Luciferasegen, SV40 late poly (A)

Promega

pGL3- Promoter Vector

Ampicillin- Resistenz, MCS, Luciferasegen, SV 40 late poly (A), SV 40 Promoter

Promega

pRL- TK Vector

Ampicillin- Resistenz, HSV TK Promoter, Renilla Reportergen, SV 40 late Poly (A), T7 Promoter

Promega

2.5.2  Rekombinante Plasmide

Folgende nicht selbst hergestellte Plasmide wurden im Verlauf der vorliegenden Arbeit genutzt.

↓20

Tabelle 2: Verwendete rekombinante Plasmide

Name

Vektorgerüst

Passagier- DNS

Referenz

pBSK:frt-NEO/KAN-frt

pBluescript II SK (+/-)

frt-PGK-NEO/Kan-frt

M. Gierl; MDC, Berlin

pMCV1.4-GFP

pMCV1.4

eGFP Reportergen

H. Duong; DRFZ, Berlin

IRES-eYFPpA-l2neo

pSP73

eYFP Reportergen, loxP-PGK-NEO-loxP; IHRES-K11

M. Mohrs (SN Lake, USA)

2.5.3  Bakterielle, artifizielle Chromosomen (engl. Bacterial artificial chromosoms; BAC)

Alle in dieser Arbeit verwendeten BACs wurden vom RZPD (Deutsches Ressourcenzentrum) bezogen und entstammen der Library Nummer 731.

Tabelle 3: Verwendete BACs

Bezeichnung

Referenz

RPCIB731D08143Q2

RZPD

RPCIB731H05147Q2

RZPD

RPCIB731H08362Q2

RZPD

2.5.4  Oligonukleotide

↓21

Die in dieser Arbeit verwendeten Oligonukleotide wurden bei den Firmen TIB MOLBIOL und Operon bestellt. Sie wurden lyophylisiert geliefert und anschließend in dem vom Hersteller empfohlenen Volumen A. bidest oder TE- Puffer gelöst. Die Lagerung erfolgte bei –20 °C.

2.5.4.1  Primer für PCR

Tabelle 4: Übersicht über die in dieser Arbeit für die PCR verwendeten Primer

Name

Länge (bp)

Sequenz 5´

Bindungs stelle

Orientie rung

5`Fragment hin

24

GATCGGTACCCAGCAAAGACTATG

homologe Region FoxP3

Sinn

5`Fragment rück

24

GATCCCATGGGGTTCTTGTCAGAG

homologe Region FoxP3

Gegensinn

3`Fragment hin

24

GATCGGATCCAAGCCTATGGCTCC

homologe Region FoxP3

Sinn

3`Fragment rück

24

GATCACTAGTCCACAGTAAAGGTC

homologe Region FoxP3

Gegensinn

Prom Foxp3-5`

28

GATCGGTACCTTGTCCCAGGAGAGCGGG

Intron 1 Start TSDR

Sinn

Prom Foxp3-3`

32

GATCCTCGAGGGGATAACAGTGGAATGGAGTC

Intron 2 ATG Foxp3

Gegensinn

FoxP3AS1XmaI

30

GATCCCCGGGCCCATATGGCTGGACCATGG

Intron 1 Ende TSDR

Gegensinn

FoxP3S2XmaI

30

GATCCCCGGGTTAAGCCAATATAGTGGAAA

Intron 1 Ende TSDR

Sinn

FoxP3AS2XhoI

31

GATCCTCGAGCTTGGATGGAGGAGATGAGAG

Intron 1 Start Exon -1

Gegensinn

CN3neu_fow

20

GGCGTTCCTGTTTGACTGTT

konservierter Bereich TSDR

Sinn

CN3neu_rev

20

GGACGTCACCTACCACATCC

konservierter Bereich TSDR

Gegensinn

P1fowdel

28

GATCGGTACCAAGTTGTCCCAGGAGAGC

Start TSDR

Sinn

P1143revdel

28

GATCCCCGGGCATATGGCTGGACCATGG

Ende TSDR

Gegensinn

P285fowdel

28

GATCGGTACCAATGGAGCTCAGGAGGGA

erste Deletion TSDR

Sinn

P637fowdel

28

GATCGGTACCTAGCCAGATGGACGTCAC

zweite Deletion TSDR

Sinn

P894fowdel

28

GATAGGTACCGTCCCAGAAACAACCTCC

dritte Deletion TSDR

Sinn

2.5.4.2  Primer für Auftragssequenzierungen

Neben den Standardprimern T7 und T3 wurden individuelle Primer für die Auftragssequenzierungen bei der Firma AGOWA verwendet. Diese Startermoleküle wurden direkt von der Firma AGOWA synthetisiert.

↓22

Tabelle 5: Startermoleküle für Auftragssequenzierungen

Name

Orientierung

Bindungsstelle

Sequenz

Int_hin

Sinn

Neo/Kan- Kassette

5`-CCAGATCATCCTGATCGACAAGAC

Int_rück

Gegensinn

Neo/Kan- Kassette

5´-CTATTCCAGAAGTAGTGAGGAGGC

Die Orientierungen beziehen sich auf die kodierende Region von eYFP in den jeweiligen Vektoren.

2.6 Größenstandard für Agarose- Gelelektrophorese

Tabelle 6: verwendete Nukleinsäure- Größenstandards

Verwendete DNS- Größenstandards

Fragmentgrößen (kb)

1 kb DNS- Leiter (Invitrogen)

12,216; 11,198; 10,180; 9,162; 8,144; 7,126; 6,108; 5,090; 4,072; 3,054; 2,036; 1,636; 1,018; 0,517; 0,506; 0,396; 0,344; 0,298; 0,220; 0,201; 0,154; 0,134

2.7 Bakterienstämme

↓23

Tabelle 7: In dieser Arbeit verwendeter Bakterienstämme

E. coli Stamm

Genotyp

Eigenschaft

Referenz

XL I blue

recA1, endA1, gyrA96, thi-1, Δ(mcr)A183, Δ(mcrCB-hsdSMR-mrr) 173, supE44, relA1, lac[F’proAB lacIqZΔM15, Tn10 (Tetr 12,5 µg/ml)].

Plasmidvermehrung

Stratagene

DH10B

F- mcrA, Δ(mrr-hsdRMS-mcrBC), φ80lacZΔM15, ΔlacX74 recA1, endA1 araD139; Δ(ara, leu)7697 galU galK λ- rpsL nupG

elektrokompetent; Plasmidvermehrung

Invirtogen

EL250

DH10B [λcI857(cro-bioA)<> araC-PBADflpe]

Hitzeinduzierte Rekombination

[121 ]

2.8 Zelllinien

Tabelle 8: Verwendete Zelllinien

Bezeichnung

Genetischer Hintergrund

Referenz

RLM-11

murine T- Zelllinie (CD3+ CD4+ CD8- J11d ) heterogeneous

DennisY. Loh, Washington University School of Medicine, St. Louis.

EL4

murine T- Zelllinie, C57BL/6 Hintergrund

[122 ]

3DO

murine T- Zell Hybridoma, Ovalbumin- spezifisch, BALB/C Hintergrund

[123 ]

DO11-10

murines T- Zell Hybridoma, Ovalbumin spezifisch, Antigen I-Ad, IgG, BALB/C Hintergrund

[124 ]

2.9 Antikörper und Fluorochrome

Die in der Tabelle aufgeführten Antikörper gegen murine Antigenewurden für die Sortierung von Zellen und für die Durchflusszytometrie verwendet. Eingesetzte Fluorochrome sind in Tabelle 2-9 dargestellt.

↓24

Tabelle 9: Verwendete Antikörper

Spezifität

Klon

Spezies

Isotyp

Herkunft

CD4

GK1.5

Ratte

IgG2b

Deutsches Rheuma- Forschungszentrum (DRFZ), Berlin

CD4

L3T4

Ratte

IgG2b

Becton Dickinson, Heidelberg

CD25

PC61.5

Ratte

IgG1

Becton Dickinson, Heidelberg

CD62L

MEL-14

Ratte

IgG2a

Becton Dickinson, Heidelberg

Foxp3

FJK-16s

Ratte

IgG2a

eBioscience, San Diego, USA

Tabelle 10: Eingesetzte Fluorochrome und Farbstoffe

Fluoreszenzkonjugat bzw. Farbstoff

Extinktionsmaximum
(λ in nm)

Emissionmaximum
(λ in nm)

APC (Allophycocyanin)

650

660

Cy5 (Indodicarbocyanin)

650

670

FITC (Fluoreszein- Isothiozyanat)

495

519

PE (R- Phycoerythrin)

480; 565

613

PerCP (Peridinin Chlorophyll Protein)

490

675

PI (Propidium Iodid)

550

650

2.10 Reagenzien- Sätze (Kits)

ECL+Plus

Amersham

NEBlot® Phototope® Kit

New England Biolabs

Phototope®- Star Detection Kit

New England Biolabs

QIAGEN® Plasmid Midi Kit (50)

Qiagen

Endofree® Plasmid Maxi Kit 10

Qiagen

QIAquick®Gel Extraction Kit 50

Qiagen

Qiaprep® Spin Miniprep Kit 50

Qiagen

DNeasy® Tissue Kit (50)

Qiagen

RNeasy® Mini Kit (50)

Qiagen

LightCycler® FastStart DNA Master YBR Green I

Roche

Chromatin Immunprecipitation (ChIP) Assay Kit

Upstate

Foxp3 Staining Kit

eBioscience

NucleofectionTM Protocol

Amaxa

2.11 Allgemeine Labormaterialien

↓25

2.12 Fertige Lösungen

2.13 Geräte

↓26

2.14 Versuchstiere

Es wurden ausschließlich Mäuse als Versuchstiere bzw. zur Organentnahme verwendet. Alle Mäuse wurden unter spezifisch Pathogen- freien (specific pathogen free, SPF) Bedingungen gezüchtet. Für die Experimente wurden weibliche und männliche Mäuse im Alter von sechs bis acht Wochen verwendet. Die Wildtyp- (WT) Stämme BALB/c und C57BL/6 wurden vom Bundesinstitut für Risikobewertung (BfR, Berlin) bezogen. Die transgenen DEREG- Mäuse wurden an der Forschungsanstalt für experimentelle Medizin (FEM, Berlin) gezüchtet.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
09.04.2009