3 Material und Methoden

3.1 Antikörper, Chemikalien und Kits

↓26

3.2 Instrumente, Software und Verbrauchsmaterial

3.3 Gele, Puffer und Lösungen

3.4 Zellinien und Zellkultur

↓27

Die Ovarialkarzinomzellinien OVCAR-3 und SKOV-3 wurden aus humanen serösen Adenokarzinomen des Ovars isoliert und von der American Type Culture Collection (ATCC) bezogen.

Die Zellen wuchsen unter sterilen Bedingungen bei 37°C in einer H2O-gesättigten, 5%igen CO2-Atmosphäre. Die Zellinien wurden in DMEM-Nährmedium, supplementiert mit 10% fötalem Kälberserum (FCS) und 2mM L-Glutamin, kultiviert. Mediumwechsel erfolgte dreimal pro Woche, Passagen ein- bis zweimal pro Woche.

3.5 XTT-Proliferationsassay

Bei dem XTT-Test handelt es sich um einen Assay zur Bestimmung von Zellproliferation und

↓28

-vitalität. Das Prinzip des Tests beruht auf der Metabolisierung eines gelben Tetrazoliumsalzes in den orangefarbenen Formazan-Farbstoff durch mitochondriale Dehydrogenasen stoffwechselaktiver Zellen. Der Farbstoff ist wasserlöslich und kann quantitativ im ELISA-Reader bestimmt werden. Die Menge an gebildetem Farbstoff ist direkt proportional zur Anzahl vitaler Zellen.

Konfluente Zellen wurden nach Trypsinierung in einer Dichte von 3000 Zellen/Well in eine 96-Well-Kulturschale ausgesät und wuchsen in Standardmedium. Nach 24h erfolgte ein Mediumwechsel mit FCS-freiem DMEM und anschließende Inkubation mit NS-398 in Konzentrationen von 0,1µM bis 500µM. NS-398 wurde als 100mM Stammlösung in DMSO gelöst. Als Kontrolle diente das Lösungsmittel DMSO in entsprechenden Konzentrationen. Gegebenenfalls wurden die Zellen 1h nach NS-398-Zugabe mit IL-1ß 10ng/ml stimuliert.

In gleicher Weise wurde eine Konzentrationsreihe für Indomethacin in Konzentrationen von 1µM bis 200µM angefertigt. Für die siRNA-Transfektion (siehe dort) wurden die Zellen in 24-Well-Platten kultiviert. 72h nach Stimulation/Transfektion erfolgte die Zugabe des XTT-Reagenzes (100µl/96Well, 300µl/24Well). Nach 4 Stunden Reaktionszeit schloß sich die Messung bei 490nm und einer Referenzwellenlänge von 690nm im ELISA-Reader an. Bei den 24-Well-Versuchen wurden zunächst von jedem Well 100µl Überstand nach 4h Inkubation mit dem XTT-Reagenz in 96-Well-Platten überführt und dann gemessen.

3.6 siRNA-Transfektion

↓29

Bei dem Prinzip der RNA-Interferenz handelt es sich um eine neue Methode der Gen-Ausschaltung auf der mRNA-Ebene. In die Zielzelle werden kurze doppelsträngige RNA-Fragmente eingeschleust, die sogenannten small interfering RNAs (siRNAs). Diese bringen Endonucleasen der Zelle dazu, die zur siRNA komplementäre zelleigene mRNA zu zerschneiden [92]. Dieser Vorgang ist selbstverstärkend und daher ca. 1000mal effektiver als z.B. eine Antisense-Strategie.

SiRNAs gegen COX-1 und COX-2 wurden nach Anleitung von Tuschl et al. [93] konstruiert und chemisch synthetisiert. Die Targetsequenz für die COX-2-siRNA sind die Basen 291-313 von NM000963.1 (5’aactgctcaacaccggaattttt 3’). Die Targetsequenz für die COX-1-siRNA sind die Basen 1533-1555 von M59979.1 (5’aagtgccatccaaactctatctt 3’). Für einige Experimente wurde eine weitere COX-1-siRNA benutzt, die gegen die Zielsequenz 1719-1741 (5’ aagacctgtccctacgtttcctt 3’) von M59979.1. gerichtet war. Alle benutzten siRNAs wurden mittels einer BLAST-Suche auf ihre Sequenzspezifität hin untersucht. Sie zeigten keine Homologien zu anderen bekannten humanen Genen. Als unspezifische Kontrolle für siRNA-Transfektionen gilt die Lamin A/C-siRNA [94]. Diese siRNA sowie eine (non-silencing) siRNA ohne Homologien zu bekannten Genen gegen die Zielsequenzen 5’aattctccgaacgtgtcacgttt 3’ wurden in den Transfektionen der vorliegenden Arbeit als Kontrollen benutzt.

Konfluente OVCAR-3-Zellen wurden nach Trypsinierung in einer Dichte von 20000 Zellen/Well in eine 24-Well-Kulturschale in DMEM ausgesät. Nach 24h erfolgte ein Mediumwechsel, ebenfalls mit DMEM, daraufhin die Transfektion. Dazu wurden pro Ansatz zunächst 3µl Oligofectamin mit 12µl OPTIMEM 7-10min in einem Eppendorfröhrchen inkubiert. 3µl der jeweiligen siRNA vermischte man in einem weiteren Röhrchen mit 50µl OPTIMEM. Dann wurden die Inhalte beider Röhrchen vorsichtig miteinander vermengt und 20min bei Raumtemperatur inkubiert. Anschließend pipettierte man 32µl OPTIMEM zu dem Mix, vortexte und gab den Ansatz (100µl) in das entsprechende Well.

↓30

Bei Transfektionen mit Verwendung zweier siRNAs wurden von jeder siRNA nur 1,5µl eingesetzt, um die Toxizität der Transfektion nicht zu erhöhen. Des weiteren war in vorangegangenen Western Blots die Ausschaltung bereits bei der halben siRNA Konzentration (30pM) erfolgreich gezeigt worden [95].

3.7 PGE2-ELISA

Der verwendete PGE2-ELISA (enzyme-linked immuno sorbent assay) basiert auf dem Prinzip der kompetitiven Bindung, wobei zwischen dem Proben-PGE2 und einem Alkalische-Phosphatase-gekoppelten PGE2 um die Bindung an den auf einer Platte fixierten PGE2-Antikörper konkurriert wird. Nach Inkubation und Abwaschen des ungebunden PGE2 wird durch Substratgabe die Aktivität der mit dem PGE2 an den Antikörper gebundenen Enzyme durch Messung der Absorption bestimmt. Daher ist die Farbintensität umgekehrt proportional zur Konzentration von PGE2 im Überstand der Zellen. Anhand einer Standardkuve wird die Konzentration des PGE2 ermittelt.

Konfluente Zellen wurden nach Trypsinierung in 24-Well-Kulturschalen in einer Dichte von 20000 Zellen/500µl in serumhaltigem Medium ausgesät. 24h später erfolgte nach Mediumwechsel die Inkubation mit NS-398 (1µM-50µM) bzw. die Transfektion mit siRNA. Bei den NS-398-Versuchen wurden die Zellen 1h nach NS-398-Gabe mit IL-1ß stimuliert und nach weiteren 24h wurden aus jedem Well Mediumüberstände abgenommen, zentrifugiert (5000U/min, 10min) und bei -20°C gelagert.

↓31

Bei siRNA-Transfektion wurde nach 24h Inkubation mit dem Transfektionsreagenz die

IL-1ß-Stimulation vorgenommen und nach weiteren 24h die Überstände gewonnen.

Die Konzentration von PGE2 in den Überständen konnte mittels eines spezifischen ELISAs nach Anleitung des Herstellers bestimmt werden. Die Extinktion wurde im ELISA-Reader bei 405nm und einer Referenzwellenlänge von 590nm gemessen. Die Konzentration von PGE2 wurde anhand von korrespondierenden Absorptionen der kalkulierten Standardkurve berechnet und in pg/ml angegeben.

3.8 Durchflußzytometrie

↓32

Bei der Durchflußzytometrie handelt es sich um ein Meßverfahren, bei dem einzelne Zellen, die auf bestimmte Art und Weise markiert sind, in einer Flüssigkeit schwimmend gescannt werden. Durch Färbung mit fluoreszierenden Substanzen lassen sich dadurch antigene, biochemische oder biophysikalische Eigenschaften von Zellen oder auch Zellkernen quantifizieren. Die quantitative Analyse wurde in dieser Arbeit mit dem FACScan Durchflußzytometer und der Software CellQuest vorgenommen.

3.8.1 Annexin V/PI

In apoptotischen Zellen wird relativ früh im Apoptoseprozeß das Membranphospholipid Phosphatidylserin (PS) von der inneren zur äußeren Seite der Plasmamembran transloziert. Annexin V bindet an PS und somit an Zellen, die PS exponieren. Durch Kopplung von Annexin V an den Fluoreszenz-Farbstoff FITC können die apoptotischen Zellen direkt im FACScan gemessen werden. Da auch nekrotische Zellen PS exponieren, wird die Annexin V-Färbung mit einer Propidiumiodid (PI)-Färbung kombiniert. Bei Verlust der Membranintegrität als Zeichen von Nekrose bzw. später Apoptose kann PI in die Zelle eindringen. Das PI-Signal wird ebenfalls im FACScan gemessen.

Somit läßt sich unterscheiden (Abb.3) zwischen vitalen Zellen (Annexin V-negativ, PI-negativ im unteren linken Quadranten), frühapoptotischen Zellen (Annexin V-positiv, PI-negativ im unteren rechten Quadranten) und nekrotischen (bzw. spätapoptotischen) Zellen (Annexin V-positiv, PI-positiv in den beiden oberen Quadranten).

↓33

Abbildung 3: Darstellung der Inhalte der Quadranten bei der Annexin V-FITC/PI-Messung

Konfluente Zellen wurden nach Trypsinierung in einer Dichte von 1x105 Zellen/Well in 6-Well-Kulturschalen ausgesät. Nach 24h erfolgte die jeweilige Stimulation mit NS-398 bzw. die siRNA-Transfektion (siehe oben). Je nach Meßpunkt 24h, 48h oder 72h später wurden die Zellen geerntet, zentrifugiert (1100Upm, 5min), mit 1xPBS gewaschen und erneut zentrifugiert. Nach Absaugen vom PBS wurden auf jedes Pellet 2µl Annexin-V-FITC, 100µl Annexin-Bindungspuffer und 10µl Propidiumiodid gegeben, 15min bei Raumtemperatur im Dunkeln inkubiert und anschließend am FACS gemessen.

3.8.1.1 Der Zellzyklus in der Durchflußzytometrie

Der Zellzyklus gliedert sich in die beiden Hauptphasen: Interphase und Teilungsphase. Die Interphase ist durch die Replikation der DNA gekennzeichnet. Sie wird in folgende Phasen unterteilt: In der Ruhephase G0 und während der präsynthetischen G1-Phase besitzen die Zellen einen diploiden Chromosomensatz. Auf G1 folgt die Phase der DNA-Verdopplung – die Synthese-Phase (S). Sie geht in die postsynthetische G2-Phase über, in der alle Zellen einen reduplizierten Chromosomensatz haben. Die nun folgende Teilungsphase M ist vergleichsweise kurz. Bei der Mitose kommt es zur gleichmäßigen Aufteilung der Chromosomen auf zwei Tochterzellen, die sich dann wiederum in G0/G1 befinden. Durch Anfärbung mit einem DNA-spezifischen Farbstoff, dem Propidiumiodid, der an die DNA in einem genauen (stöchiometrischen) Verhältnis bindet, wird der DNA-Gehalt der Einzelzelle durchflußzytometrisch anhand der Fluoreszenzintensität quantifizierbar. Aus der Messung einer Vielzahl von Zellen entsteht das DNA-Histogramm (Abb.4):

↓34

Abbildung 4: Phasen des Zellzyklus im DNA-Histogramm

3.8.2 DNA-Färbung nach Nicoletti

Ein Zeichen der Apoptose ist die DNA-Fragmentierung in oligonukleosomale Einheiten durch spezifische Endonukleasen. Im Histogramm erscheinen diese Zellen mit vermindertem DNA-Gehalt im sogenannten SubG1-Peak (Abb.5). Bei der Nicoletti-Methode [96] werden die Zellen durch eine hypotone Lösung lysiert, so daß die DNA der Zellkerne der Anfärbung mit Propidiumiodid (PI) direkt zugänglich gemacht wird. Im FACScan Durchflußzytometer werden schließlich die DNA-Gehalte der Zellkerne gemessen.

Abbildung 5 : SubG1-Peak als Ausdruck von apoptotischer DNA-Fragmentierung

↓35

Konfluente Zellen wurden nach Trypsinierung in einer Dichte von 1x105 Zellen/Well in 6-Well-Kulturschalen ausgesät. Nach 24h erfolgte die jeweilige Stimulation mit NS-398 bzw. die siRNA-Transfektion (siehe oben). Je nach Meßpunkt wurden die Zellen 24h, 48h oder 72h später geerntet, zentrifugiert (1100Upm, 5min), und der Überstand wurde abgesaugt. Das Pellet versetzte man nach kurzem Vortexen mit 200µl Nicoletti-Reagenz. Die Proben inkubierten 24h bei 4°C im Dunkeln und wurden dann am FACScan gemessen.

3.8.3 BrdU/PI-Labeling

Diese Methode ermöglicht es, durch Bestimmung des Anteils der Zellen, die sich in der DNA-Synthese-Phase (S-Phase) befinden, Aussagen über die Verteilung der Zellen im Zellzyklus zu treffen. Die Zellen werden in Kultur mit Bromodeoxyuridin (BrdU) versetzt, welches bei DNA-Neusynthese in der S-Phase des Zellzyklus anstelle von Thymidin in die DNA eingebaut wird. Ein Fluoreszenfarbstoff-gekoppelter Antikörper bindet an das BrdU. Danach werden alle Zellen mit Propidiumiodid (PI) angefärbt, um die Gesamtpopulation zu bestimmen. Beide Signale werden im FACScan Durchflußzytometer gemessen (Abb.6).

Abbildung 6 : Darstellung der S-Phase des Zellzyklus mittels BrdU-Färbung

↓36

Konfluente Zellen wurden nach Trypsinierung in einer Dichte von 1x105 Zellen/Well in 6-Well-Kulturschalen ausgesät. Nach 24h erfolgte die jeweilige Stimulation mit NS-398 bzw. die siRNA-Transfektion (siehe oben). 30min vor der Ernte (je nach Meßpunkt 24h, 48h oder 72h) wurden die Zellen mit 10µM BrdU versetzt, dann geerntet, zentrifugiert (immer bei 1500Upm, 5min) und der Überstand abgesaugt. Daraufhin wurde das Pellet mit 1xPBS gewaschen, erneut zentrifugiert, abgesaugt und mit Ethanol (-20°C) fixiert. Zwischen allen nun folgenden Schritten wird jeweils das Pellet zuerst zentrifugiert und dann der Überstand abgesaugt. Man resuspendierte das Pellet in 200ml Pepsin (0,4mg/ml in 0,1M HCl) und inkubierte 30min bei Raumtemperatur. Zur DNA-Denaturierung wurden 200µl 2M HCl zu den Zellen gegeben und 30min bei 37°C inkubiert. Danach wurde das Pellet mit 200µl Borax-Puffer (0,1M Natriumtetraborat, pH 8,5) resuspendiert und sofort zentrifugiert, wiederum der Überstand abgesaugt und 20µl Anti-BrdU-Antikörper auf das Pellet gegeben. Nach 45minütiger Inkubation im Dunkeln bei Raumtemperatur wurde das Pellet mit PBS (200µl) gewaschen, zentrifugiert, der Überstand abgesaugt. Schließlich wurden die Zellen in Propidiumiodid (10mg/ml PI in 1xPBS) aufgenommen, in ein FACS-Röhrchen überführt und sofort am FACScan gemessen.

3.9 Western Blot

Beim Western Blot handelt es sich um eine Methode zur Proteinanalyse. Nach gelelektrophoretischer Auftrennung der durch Zellyse gewonnenen Proteine, werden diese durch das sogenannte Blotten auf Nitrozellulose-Membranen gebracht. Die Blots werden zunächst mit in Puffer verdünnten Primärantikörpern inkubiert, die an das entsprechende Protein binden. Nach mehrmaligem Waschen werden die Blots in Alkalische-Phosphatase-konjugierten Antikörpern getränkt, die an den Primärantikörper binden. Durch Reaktion der Alkalischen Phosphatase mit Substrat kommt es zur Bildung eines lumineszierenden Stoffes, der einen Film belichtet. Dadurch werden die Proteinbanden sichtbar.

Die Zellen wurden auf Eis in 24-Well-Kulturschalen nach einmaligem Spülen mit 1xPBS mit 25µl Proteinlysispuffer/Well lysiert. Mittels einer Insulinspritze wurde das Zellysat mehrmalig mechanisch zerkleinert und danach bei -20°C gelagert. Die Bestimmung der Proteinkonzentrationen erfolgte mit dem BCA Protein Assay Kit nach Anleitung des Herstellers. Die Proteinproben (100µg) wurden mit Proteinladungspuffer auf 20 µl aufgefüllt und für 10min im Thermomixer bei 95°C inkubiert. Anschließend wurden die Proben in einem 10%igen Polyacrylamidgel aufgetrennt durch SDS-PAGE-Gelelektrophorese bei 90-100V mit einer Laufzeit von ca. 90min. Es erfolgte das „Blotten“ der Proteine auf eine Nitrozellulosemembran in einem Semi-Dry-System bei 100mA für 90min. Zur Blockierung unspezifischer Bindungsstellen inkubierte der Blot für 2h bei Raumtemperatur in Blocking-Puffer. Die monoklonalen Primärantikörper wurden in Blocking-Puffer verdünnt (COX-1, COX-2, ß-Aktin: 1:1000) für 24h bei 4°C auf die Membran gegeben. Nach anschließendem dreimaligen Waschen mit Waschpuffer erfolgte die 45-minütige Inkubation mit dem 1:5000 in Blocking-Puffer verdünnten sekundären anti-mouse Antikörper, gekoppelt mit Alkalischer Phosphatase, für 45min. Nach nochmaligem Waschen und 2x2min Inkubation mit Assay-Puffer reagierten die Banden für 5min mit dem CDP-Star RTU Lumineszenzsystem und belichteten einen Hyperfilm.

3.10 Signifikanztestung

↓37

Die Signifikanz wurde mit dem t-Test nach Student überprüft. Als Signifikanzschwelle wurde 5% Irrtumswahrscheinlichkeit (p<0,05) gewählt.

Zusätzlich wurde die Signifikanz mit dem Lord-Test [97] überprüft. Dieser Test ist besonders geeignet für Versuche mit sehr kleinen Stichproben, wie es oft in Zellkulturexperimenten üblich ist. Die Verwendung des t-Tests ist dafür eher weniger geeignet, da er sich auf die Standardabweichung bezieht, welche erst bei größerer Anzahl an Meßwerten sinnvoll bestimmt werden kann. Der Lord-Test dagegen nimmt die Spannweite (Differenz aus Maximum und Minimum einer Meßreihe) als Fehlermaß. Die Normalverteilung wird vorausgesetzt. Für den Vergleich zweier unabhängiger Meßreihen gleichen Umfangs bestimmt man die Prüfgröße als den Quotienten aus der Differenz der Durchschnitte (,) und dem arithmetischen Mittel der Spannweiten (,) beider Reihen. Nach Lord kann dann anhand einer Tabelle [98] bestimmt werden, ob die Nullhypothese abgelehnt werden kann. Bei zweiseitiger Fragestellung und einem Stichprobenumfang von n=3 kann auf dem 5%-Niveau die Nullhypothese abgelehnt werden, wenn und bei einseitiger Fragestellung, wenn .


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 2.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
17.01.2005