[Seite 20↓]

3  Material

3.1  Substanzen, Puffer, Lösungen und Medien

Tabelle 6: Verwendete Puffer

Puffer

Zusammensetzung

Quelle

TBE

100 mM TrisHCl; 100 mM Borsäure; 2 mM EDTA; pH 8.3 mit NaOH eingestellt

s.u.

310 Genetic Analyzer Puffer

Enthält EDTA

Applied Biosystems

PBS Dulbecco's

Phosphatpuffer

Invitrogen

Tabelle 7: Getestete Medikamente

Substanz

Quelle

Abacavir, Amprenavir, Zidovudin

Glaxo Wellcome

Alprazolam, Delavirdin

Pharmacia & Upjohn

Didanosin , Stavudin

Bristol-Myers Squibb

Efavirenz

DuPont Pharmaceuticals

Indinavir

Merck

Kaletra (Lopinavir, Ritonavir), Ritonavir

Abbot Laboratories

Nelfinavir

Agouron Pharmaceuticals

Nevirapin

Boehringer Ingelheim

Rifampicin

Fatol

Saquinavir, Zalcitabin

Roche

Tabelle 8: Weitere Forschungschemikalien

Substanz

Quelle

2-Propanol, Chloroform, Diethylpyrocarbonat (DEPC), Dimethylsulfoxid (DMSO),
Ethanol, Ethidiumbromid-Lösung, Phenol, EDTA (Ethylendiamintetraacetat Dinatriumsalz)

Merck

Borsäure

Calbiochem

NuSieve-Agarosepulver; GelStar, Nukleinsäure Farbstoff

Biozym Diagnostik

ROX-konjugierte Längenstandards: GeneScan-350 und –500, POP 4 (Performance Optimized Polymer 4)

Applied Biosystems

Qualex Gold Agarose

Hybaid

TRIzol®Reagenz, RNase AWAY

Invitrogen

Minimales Essentiales Medium mit D-Glutamin (DMEM), Trypsin/EDTA,
RPMI 1640 Zellkulturmedium, Fötales Rinderserum, Penicillin/Streptomycin, Trypsin/EDTA-Lösung (0,5% / 0,2%)

Biochrom

Glykogen, RNase frei

Roche

100bp und 1kb DNA Marker

MBI Fermentas

dNTP-Na-Salz Lösung

Rapidozym

Tabelle 9: Verwendete Enzyme

Enzyme

Quelle

BseNI, EcoRI, SmaI

MBI Fermentas

BstNI,Msl L

New England Biolabs

M-MuMLV Reverse Transkriptase,
Platinum Taq DNA-Polymerase, Taq-DNA Polymerase

Invitrogen

Recombinanter RNasin® Ribonuclease Inhibitor,
RQ1 DNase, T4-DNA-Ligase, T7-RNA-Polymerase

Promega


[Seite 21↓]

3.2  Oligonukleotide

Tabelle 10: Sequenzen aller verwendeten Oligonukleotide

Primer

Position

Sequenz

Genbank

RT1

1521

5’ – CAGGAAGAGAAAGAC

NM_000499

1A1-1

1474 bzw. 6787

5’ – Fluorescein-GATACACTTCCGCTTGCCCATGC

NM_000499 bzw. X02612

1A1-2

1310 bzw. 6431

5’ – Fluorescein- GAAAGGCTTTTACATCCCCAAGG

NM_000499 bzw. X02612

1A1-F1

6494

5‘ – TATGAATTC CTCTGAACTTACTGG

X02612

1A1-F2

6666

5‘ – TATGAATTC CCCTCTGGTTACAGG

X02612

1A1-ISRT

6787

5’ – CAGGAAGAGAAAGAC GATACACTTCCGCTTGC CCATGC

X02612

1A1-IST7

6431

5’ – AGAGCGTAATACGACTCACTATAGGGTATCT GCAGA GAAAGGCTTTTACATCCCCAAGG

X02612

1B1-1

1312 bzw. 4745

5‘ – CGGCTGGATTTGGAGAACGTACC

NM_000104 bzw. U56438

1B1-2

1490 bzw. 7955

5’ – ATAGGGCAGGTTGGGCTGGTCAC

NM_000104 bzw. U56438

1B1-F1

4873

5’ – TATGAATTC GAGGAGAAAAGACCTG

U56438

1B1-F2

7882

5’ – TATGAATTC GTGCAGACTCGAGTGC

U56438

1B1-ISRT

7955

5’ – GCCTTCCTTTATGAA ATAGGGCAGGTTGGGC TGGTCAC

U56438

1B1-IST7

4745

5’ – AGAGCGTAATACGACTCACTATAGGGTATCT GCAGA CGGCTGGATTTGGAGAACGTACC

U56438

1B1-RT1

1519

5’ – GCCTTCCTTTATGAA

NM_000104

dT(15)

 

5’ – TTTTTTTTTTTTTTT

 

CYP3 FLU

1404

5' – AgTTTCAtgTTCAcgAgAgCAAACCTC Fluorescein

X12387

CYP3 LCR

1380

5' – LC Red640-TgCCAATgCAgTTTCTgggTCCA Ph

X12387

CYP3A4F

1375

5‘ – CCTTACATATACACACCCTTTGGAAG

X12387

CYP3A4R

1522

5‘ – GGTTGAAGAAGTCCTCCTAAGCT

X12387

Std RTPr

1522

5' – TTTTTTTTTTTTTTT GGTTGAAGAAGTCCTCCTA AGCT

X12387

Std T7Pr

1378

5' – AGAGCGTAATACGACTCACTATAGGGTATCT GCAGA CCTTACATATACACACCCTTTGGAAG

X12387

dmdr

3166

5’ – gAgCATACATATgTTCAAACTTC

NM_000927

umdr

3021

5’ – CCATCATTgCAATAgCAgg

NM_000927

MDR1 FLU

3103

5’ – TgggAAgATCgCTACTgAAgCAAT Fluorescein

NM_000927

MDR1 LCR

3133

5’ – LC Red640-AACTTCCgAACCgTTgTTTCTTTgA Ph

NM_000927

Mdr1Std RTPr

3166

5' – TTTTTTTTTTTTTTT gAgCATACATATgTTCAAAC TTC

NM_000927

Mdr1Std T7Pr

3021

5' – AGAGCGTAATACGACTCACTATAGGGTATCT GCAGA CCATCATTgCAATAgCAgg

NM_000927

ß2MGas

350

5’ – CATGTCTCGATCCCACTTAAC

NM_004048

ß2MGse

113

5’ – CCAGCAGAGAATGGAAAGTC

NM_004048

ß2M-705

140

5’ – LC Red705-ATGAAACCCAGACACATAGCAATTCAG Ph

NM_004048

ß2M-FL

170

5’ – TTCTTCAGTAAGTCAACTTCAATGTCGGA X

NM_004048

3A4*1B_F

705

5’– AGGACAGCCATAGAGACAAGG C CA

AF181105

3A4*1B_R

863

5‘– AATCACACACACACCACTCAC GGAC

AF181105

3A4*3_F

23184

5’– CGTGGAACCAGATTCAGC

AF280107

3A4*3_R

23452

5’– GGCCCAGAGAACAAATTAGTA

AF280107

3A5*3_F

260144

5‘– TAAAGAGCTCTTTTGTCTT CCA

NG_000004.2

3A5*3_R

260404

5‘– GGAGTTGACCTTCATACGTT

NG_000004.2

mep-f

19041

5’ – AATTACAACCAGAGCTTGGC

NT_030059

mep-r

19187

5’ – TATCACTTTCCATAAAAGCAAG

NT_030059

Kursiv und fett hervorgehoben sind die zusätzlich eingefügten Sequenzen
Ph Phosphorylierung
LC Red640 und LC Red705 Fluorescenz-Marker, Emission der Absorption bei 640 bzw. 705 nm


[Seite 22↓]

Alle benutzen Primer wurden mit Hilfe der „Oligo“-Software ausgesucht, auf die Spezifität mit dem „BLAST“-Programm geprüft und durch die Firma TibMolbiol synthetisiert. Design und Synthese der Hybridisierungssonden für den LightCycler erfolgten bei TibMolbiol. In Tabelle 10 sind die verwendeten Primer mit der Positionsangabe in der entsprechenden Sequenz (cDNA bzw. genomische DNA) aus der EMBL-Genbank aufgelistet

3.3 Zelllinien

Die Tabelle 11 veranschaulicht die Charakteristika der benutzten Zelllinien humanen Ursprungs. Bei allen Zelltypen handelt es sich um adhärent wachsende Monolayer. Alle Zellen wurden über die Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, bezogen.

Tabelle 11: Charakteristika der verwendeten Zellkulturen

Zelllinie

Gewebe

Morphologie

Ursprung

HeLa

Adenokarzinom, Zervix

Epithelial

1951, 31jährige Schwarze

HepG2

Hepatozelluläres Karzinom, Leber

Epithelial

1975, 15jähriger Kaukasier

Caco-2

Kolorektales Karzinom, Darm

Epithelial

1974, Kaukasier

COLO-320

Kolorektales Adenokarzinom, Darm

Epithelial

1977, 55jähriger Kaukasier

3.4 Verwendete Kits

BCA Protein Verfahren Kit

Pierce Chemicals Co.

BigDye Terminator cycle sequencing kit

Applied Biosystems

SNAP™ Total RNA Extraction Kit

Invitrogen

3.5 Computerprogramme

310 Data Collection Software

Applied Biosystems

BLAST

http://www.ncbi.nlm.nih.gov/BLAST/

Chromas

http://technelysium.com.au/chromas.html

DNASIS für Windows 2.1

Hitachi

GeneDoc

http://psc.edu/biomed/genedoc

Genescan Analysis Software

Applied Biosystems

LightCycler Analysis Software 3.1

Roche

LightCycler Run Software 3.5

Roche

Magellan

Tecan

Oligo 6.50, Primer Analysis Software

Molecular Biology Insights

Sequencing Analysis Software 3.1

Applied Biosystems

SPSS für Windows 10.0

SPSS

3.6 Datenbanken

Aniretrovirale Mittel und Interaktionen

http://www.hiv-druginteractions.org/

ATP-bindende Proteine

http://nutrigene.4t.com/humanabc.htm

CYP Arzneimittel- Interaktionen

http://medicine.iupui.edu/flockhart/

CYP3A4 Allele

http://www.imm.ki.se/CYPalleles/cyp3a4.htm

REBASETM, Restriktionsenzym-Datenbank

http://rebase.neb.com/rebase/rebase.html

3.7 Geräte

ABI310 Prism Sequenziergerät

Applied Biosystems

Biophotometer

Eppendorf

EagleEye Photoimager

Stratagene

Elektrophoresammern

BioRad und Pharmacia

Elektrophoresenetzgerät

Renner

Gewebe-Homogenisierer Potter

Braun

LightCycler™

Roche

Megafuge 1,0R

Heraeus

Mikroskope

Leitz

Mikrowellengerät

Siemens


[Seite 23↓]

SLT ELISA Reader

Tecan

Sterilwerkbank Laminair und Brutschrank

Heraeus

Thermocycler PE9700

Applied Biosystems

Tischzentrifuge, 5415C

Eppendorf

3.8 Sonstiges Zubehör

Kapillaren für ABI310, 47 cm x 50 µm

Applied Biosystems

Sterile, gefilterte Pippetenspitzen

Biozym und Greiner

Kapillaren für LightCycler

Roche

Ultrafree®-Säulen

Millipore Corporation

UV-Küvetten

Eppendorf

Vacutainer®cpt System

Becton Dickinson, Heidelberg

Kulturflaschen und Zellkulturplatten

BD Falcon

Einfrierröhrchen, 1.8 ml

Greiner

Übliches Verbrauchsmaterial (Eppendorfgefäße, PCR-Platten, Pipettenspitzen...)

 


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
20.10.2004