2 Material und Methoden

2.1 Material

2.1.1 Chemikalien und Reagenzien

▼ 18 (fortgesetzt)

Alle im Folgenden nicht aufgeführten Chemikalien stammen von der Firma Merck.

▼ 19 

Chemikalien und Reagenzien

 Hersteller

1 kb Leiter

Invitrogen

10x MegaBACE™-LPA-Puffer

Amersham Pharmacia

 

Biotech Inc

10x NH4-Reaktion-Puffer incl 15 mM MgCl, pH 8,8

Invitek

10x NH4-Reaktion-Puffer ohne Mg, pH 8,8

Invitek

3730 „Running“-Puffer mit EDTA [10x]

Applied Biosystems

3730 POP-7™ Polymer

Applied Biosystems

Agarose

Invitrogen

Betain-Monohydrat

Fluka

Big Dye® Terminator v1.1,3.1 5xSequenzierungspuffer

Applied Biosystems

Dimethylsulfid (DMSO)

Stigma

Dithiothreitol (DTT)

Promega

DNase RNase frei

Roche

dNTP-Mix

Bioline

EDTA 0,5M pH 8

Roth

Essigsäure 96%

Merck

Ethidiumbromid

Serva

Ethylendiamintetraessigsäure (EDTA)

Roth

Exo

Biolabs

Ficoll

Sigma

Formamid

Amersham Biosciences

Hexamere

Pharmacia

Magnesiumdichlorid (MgCl)

Invitek

MegaBACE ET 400/550-R Size Standard

Amersham Biosciences

MegaBACE „Long-Read Matrix“

Amersham Biosciences

M-MLV Reverse Transkriptase

Promega

M-MLV RT 5x Puffer

Promega

Natriumhydroxid (NaOH)

Roth

Orange G

Sigma

Primer

Biotez

Proteinase K

Roche

„RNA later RNA Stabiliziation Reagent”

Qiagen

RNase-Inhibitor

Pharmacia Biotech

SAP

Promega

„Single stranded binding protein“ (SSBP)

Promega

„Smart Ladder“ Größenstandard

Eurogentec

Streptavidin Sepharose™ „High Performance“

Amersham Biosciences

Taq Polymerase

Invitek

Tris

Roth

Tween-20 (10%)

Pierce

β-Mercaptoethanol

Sigma

2.1.2 Puffer und Lösungen

 

Inhalt

AB-Puffer, (pH 7,6) 1x

20 mM Tris

 

2 mM Magnesium-Acetat-Tetrahydrat

  

BW-Puffer (pH 7,6) 2x

10 mM Tris

 

2 M NaCl

 

1 mM EDTA

 

0,1% Tween 20

  

Orange G Stoppmix

0,25% Orange G

 

15 g Ficoll

 

10 mM EDTA

  

TAE 1L

242 g Tris

 

57 ml Essigsäure 96%

 

100 ml EDTA 0,5M pH8

  

Waschpuffer (pH 7,6) 1x

10 mM Tris

2.1.3 Kits

Kits

 Hersteller

„Big Dye® Terminator v1.1 Sequencing Standart Kit”

Applied Biosystems

„Gene Clean III Kit“

Bio 101

„Invisorb Spin DNA Extraction Kit”

Invisorb

“Millipore Amicon®Microcon®-PCR Centrifugal Filter Devices”

Millipore

„Millipore Montage Seq96 Sequencing Reaction Cleanup Kit”

Millipore

„Millipore Ultrafree®-DA DNA Extraction from Agarose Gels“

Millipore

„PSQ HS 96 Nucleotide Dispensing Tips“

Pyrosequencing™

„PSQ HS 96 Reagent Dispensing Tips”

Pyrosequencing™

„PSQ HS 96 Sample Prep Thermoplate Kit”

Pyrosequencing™

„PSQ HS SNP Reagent Kit”

Pyrosequencing™

„RNeasy® Lipid Tissue Mini Kit”

Qiagen

„RNeasy® Protect Mini Kit“

Qiagen

„Triple Master™ PCR-System“

Eppendorf

2.1.4 Gebrauchsmaterialien

▼ 20 

 

 Hersteller

„96 Skirted Reaction plate“

Corning Incorporated Costar®

Pipettenspitzen

Greiner Bio-One

PSQ™ 96 – Platten und PSQ™ HS 96 - Platten

Pyrosequencing™

Reaktionsgefäße (500μl, 1000μl, 1500μl, 2000μl)

Eppendorf

Reaktionsgefäße (8-tube Strips 0,2 ml)

Biozym

„Strips“

Biozym

Thermodruckpapier (K65HM-CE / KP65HM- CE)

Mitsubishi

Thermo-Fast® 96 „Detection Plate“

ABgene

„Thermowell 96 well plate“

Corning Incorporated Costar®

2.1.5 Geräte

 

 Hersteller

 ABI PRISM 3730 DNA Analysierer

„96 well plate retainer, septa seal”

„96 well plate base, septa seal“

„3730 Capillary Array“

 Applied Biosystems

Dokumentationsystem, UV Photographie

 Herolab

„Electrophoresis Power Supply“ EPS 200

Pharmacia Biotech

Thermomixer Comfort

 Eppendorf

Finnpipette® 50-300l und 5-50

 Thermo Labsystem

Horizon ® 11.14 Elektrophoresekammer

 Life Technologies™

Megabase 1000 DNA „Analysis System“

Amersham&Lifescience

Mikrowelle M1712N

Samsung

MJ Research PTC 225 „Peltier Thermal Cycler”

Biozym

„Monoshake“; Schüttler

 Variomag®

„MS Minishake“r; Vortexer

 IKA®

Pipetten 2μl, 20μl, 200μl, 1000μl

ABI; Eppendorf; Gilson

PSQ HS 96A System Sequenzierautomat

Pyrosequencing ™

Thermodrucker Model P68E

Mitsubishi

Tischzentrifuge 5415C

Eppendorf

ULTRA-THURROX®T25 basic; Homogenisator

IKA®

UV Transluminator UVT-28MP

Herolab

„Vakuum Manifold“

Millipore

Vacuum Prep Workstation, Aufreinigungsstation

Pyrosequencing™

Vakuumpumpe Laboport

KNF Neuberger GmbH

Zentrifuge Biofuge Fresco

Heraeus Instruments

2.2 Methoden

2.2.1 Polymerasekettenreaktion (PCR)

Die Polymerasekettenreaktion (PCR) ist in der Molekulargenetik ein Standardverfahren zur Vervielfältigung (Amplifikation) eines bestimmten DNA-Abschnittes mittels Primer und DNA-Polymerase. Die PCR besteht aus drei sich wiederholenden Schritten: Zuerst wird in einem Denaturationsschritt der Doppelstrang getrennt, im folgenden Annealingschritt binden die Primer an die DNA. Im Elongationsschritt synthetisiert die DNA-Polymerase aus Nukleotiden (dNTPs) einen neuen Komplementärstrang.

2.2.1.1 Primerdesign

▼ 21 

Außer den bekannten Mikrosatellitenprimern D1S1653, D1S2771 und D1S2635 wurden die Primer mittels Primer 364 auf der Grundlage der in NCBI57 publizierten LOR-Sequenz ausgewählt. Nur zur Generierung des Sequenzprimer LOR_SNP für die Pyrosequenzierung wurde die SNP-Primer-Design-Software AB Version 1.0.1 verwandt. Um eine erfolgreiche Amplifikation der Primer zu ermöglichen, wurden die Primer nach folgenden Eigenschaften ausgewählt:

Die Primer wurden zur Kontrolle mit Blast (n) „Basic Local Alignment Search Tool“ 7 gegen die gesamte Datenbank abgeglichen. Alle Primer wurden bei Biotez bestellt.

▼ 22 

Tabelle 1: verwendete Primer

Name

Sequenz

LOR_A_F

CAGGGGAATGAGGAACTCAA

LOR_B_F

AGTGGACTGCGTGAAGACCT

LOR_AC_F

TCGGTAGCAGCGGTTCTGG

LOR_P_F

GTGGGAGCGTCAAGTACTCC

LOR_C_F

TGGGAGCGTCAAGTACTCC

LOR_SNP

GGAGCGTCAAGTACTCC

LOR_AC_R

CCACCGCTGGAGAAACAG

LOR_3_F

CGGTCCAGTGCCAGAGCTA

LOR_P_Bio_R

CGTAGCTCTGGCACTGGAC

LOR_D_F

CGCAGCAGGTCACTCAGAC

LOR_7_R

CCTCCAGAGGAACCACCTC

LOR_A_R

CAAACCTCGGGTAGCATCA

2.2.1.2  PCR mit Temperaturgradienten

Mit Hilfe eines Temperaturgradienten von 53-63°C wurde versucht, die Annealingbedingungen zu optimieren, da sich diese bei den einzelnen Primerpaaren häufig unterscheiden.

Bedingungen Temperaturgradienten-Programm 53-63°C:

▼ 23 

  1. Aktivierung: 3 min bei 95°C
  2. Denaturierung: 30 sec bei 95°C
  3. Annealing: 45 sec mit einem Temperaturgradienten: 53°C; 53,3°C; 53,9°C; 54,7°C; 55,8°C; 57,3°C; 59°C;60,7°C; 61,5°C; 62,3°C; 62,8°C; 63°C
  4. Elongation: 45 sec bei 72°C
  5. Wiederholen der Schritte 2-4 für 35 Zyklen
  6. 20 min bei 72°C

2.2.1.3  Touchdown-PCR für die Feinkartierung

Zur Feinkartierung wurden bekannte Mikrosatelliten verwandt. Die Rückwärtsprimer von D1S1653 und D1S2771 waren mit dem Fluoreszenzfarbstoff FAM markiert und der Rückwärtsprimer von D1S2635 mit HEX.

Ein 10 μl Ansatz enthielt 8 ng DNA, 1x PCR-Puffer, je 250 pmol dATP, dCTP, dGTP, dTTP, 3,5 nmol von jedem Primer und 0,35 U Taq. Einem erstellten Mastermix aus dH20, Primern, NH4-Reaktionspuffer mit MgCl, dNTPs und Primern wurde erst unmittelbar vor dem Pipettieren auf die DNA die Taq-Polymerase hinzugefügt, um nicht frühzeitig unspezifische Bindungen zu erhalten. Der Primer D1S2771 wurde mit bewährter Annealing-Temperatur von 53°C mit einer Touchdown-PCR vervielfältigt. Für die Primer D1S2635 und D1S1653 ergab sich anhand einer Temperaturgradienten-PCR die optimale Annealing-Temperatur von 55°C, die als Grundlage der Touchdown-PCR diente.

▼ 24 

Bedingungen Touchdown-Programm x=53 oder 55°C

  1. Aktivierung: 3 min bei 95°C
  2. Denaturierung: 30 sec bei 95°C
  3. Annealing: 45 sec bei x+6/x+4/x+2/x°C in den ersten 4 Zyklen je 2°C abwärts
  4. Elongation: 45 sec bei 72°C
  5. Wiederholen der Schritte 2-4 mit x°C Annealing Temperatur für weitere 31 Zyklen
  6. 20 min bei 72°C

2.2.1.4  PCR zur Sequenzierung

Die PCR-Programme wurden selbst entworfen. Ein 12,5 μl Ansatz enthielt 8 ng DNA, 1x NH4- Reaktionspuffer mit MgCl, je 312,5 pmol dATP, dCTP, dGTP, dTTP, 2,5 nmol von jedem Primer, 5% DMSO und 0,325 U Taq. Einem Mastermix aus dH20, Primern, PCR-Puffer, 5%DMSO, dNTPs und Primern wurde erst unmittelbar vor dem Pipettieren auf die DNA die Taq-Polymerase hinzugefügt, um auch hier nicht frühzeitig unspezifische Bindungen zu erhalten.

▼ 25 

Bedingungen Progr5895:

  1. Aktivierung: 3 min bei 95°C
  2. Denaturierung: 30 sec bei 95°C
  3. Annealing: 1 min bei 58°C
  4. Elongation: 1 min bei 72°C zur
  5. Wiederholen der Schritte 2-4 für weitere 33 Zyklen
  6. 20 min bei 72°C

2.2.1.5  PCR zur cDNA-Testung (LOR_C)

Hier wurde der gleiche wie unter Abschnitt 2.2.1.4 aufgeführte Ansatz verwandt. Auch das PCR-Programm Progr5695 folgte wie unter Abschnitt 2.2.1.4 beschrieben. Allerdings wurde hier die Annealing-Temperatur des Schrittes 3 von 58°C auf 56°C geändert. Daher hieß dieses Programm Progr5695.

2.2.1.6  PCR zur RNA-Extraktionskontrolle (G6P)

▼ 26 

Die Primer, der Ansatz und die PCR-Bedingungen wurden einem Standardprotokoll für das Glukose-6-Phosphatase-Gen (G6P) entnommen. Ein 10 μl Ansatz enthielt 2 µl cDNA, NH4- Reaktionspuffer mit MgCl, je 625 pmol dATP, dCTP, dGTP, dTTP, 5nmol von jedem Primer, 5% DMSO und 0,5 U Taq. Einem Mastermix aus dH20, Primern, PCR-Puffer, 5% DMSO, dNTPs und Primern wurde erst unmittelbar vor dem Pipettieren auf die cDNA die Taq hinzugefügt, um nicht frühzeitig unspezifische Bindungen zu erhalten.

Bedingungen ProgrG6P:

  1. Aktivierung: 5 min bei 95°C
  2. Denaturierung: 30 sec bei 95°C
  3. Annealing: 45 sec bei 57°C
  4. Elongation: 1 min bei 72°C
  5. Wiederholen der Schritte 2-4 für weitere 32 Zyklen
  6. 20 min bei 72°C

2.2.1.7 PCR zur Pyrosequenzierung

▼ 27 

Ein 25 μl Ansatz enthielt 3 µl (12 ng) DNA oder 6 µl cDNA, 1x NH4- Reaktionspuffer ohne MgCl2, 75 nmol MgCl2, je 1,25 nmol dATP, dCTP, dGTP, dTTP, 3nmol von jedem Primer, 25 µmol Betain-Monohydrat und 1 U Taq. Einem Mastermix aus dH20, Primern, PCR-Puffer, MgCl2, Betain-Monohydrat, dNTPs und Primern wurde erst unmittelbar vor dem Pipettieren auf die cDNA die Taq Polymerase hinzugefügt.

Bedingungen Progr6495:

  1. Aktivierung: 5 min bei 95°C
  2. Denaturierung: 30 sec bei 95°C
  3. Annealing: 45 sec bei 64°C
  4. Elongation: 2 min bei 72°C
  5. Wiederholen der Schritte 2-4 für weitere 45 Zyklen
  6. 5 min bei 72°C

2.2.2 DNA-Nachweismethode

2.2.2.1  Agarose-Gele

▼ 28 

Gele mit 2% Agarose dienten der Überprüfung der PCR. Zur Aufreinigung des PCR-Produkts wurden Gele mit 1% Agarose verwandt. Dazu wurden 1 g (1%ige) oder 2 g (2%ige) Agarose in 100 ml TAE-Puffer in der Mikrowelle erhitzt und gelöst. Anschließend wurden 10 μl Ethidiumbromid (5mg/ml) hinzu pipettiert. Das flüssige Produkt wurde in vorgefertigte Kammern mit Kämmen gegossen. Nach Erstarren des Gels wurden die Kämme gezogen und die Kammer mit TAE-Puffer gefüllt. 2 μl des PCR-Produkts wurden mit 3 μl Orange-G-Stoppmix vermischt und in die entstandenen Taschen pipettiert. Als Standard liefen entweder 2,5 μl „Smart-Ladder“-Marker oder 3 μl KB-Leiter mit. Je nach Größe des Gels wurde die Kammer für etwa eine Stunde an eine Spannung von 100-130 Volt geschlossen. Anschließend wurde das Gel unter UV-Licht photographiert.

2.2.2.2 MegaBACE

Zur Genotypisierung wurden 4 μl Verdünnung mit 4 μl Größen-Standard („MegaBACE ET 400/550-R Size Standart“) per Hand in eine „96-skirted-Reaction“-Platte pipettiert. Die sechs Röhrchen MegaBACE „Long-Read Matrix“ wurden vor Benutzung für 4 min bei 20°C bei 4000 x g zentrifugiert. Eine separate „96-skirted-Reaction“-Platte wurde mit 98 μl 1x MegaBACE™ LPA-Puffer auf Raumtemperatur erwärmt. Da nur die Farbstoffe FAM und HEX zur Anwendung kamen, wurde am MegaBACE nur das Filterset „Dye Set1“ und somit auch nur die Software „Genotyping 1“ verwendet. Die in der Software voreingestellten Parameter wurden nicht verändert. Die Proben wurden 50 sec bei 95°C denaturiert, und danach wurde den Anweisungen des Gerätes gefolgt. Die Ladeplatte wurde nach der Probeninjektion verworfen. Zur Auswertung erfolgte die Eingabe der auszuwertenden Marker mit Namen, Produktgröße und Motivlänge in eine Markerdatei des Programms „Genetic Profiler“. Die Rohdaten wurden mit der Software „Genetic Profiler“ sowie den zusätzlichen Informationen aus der Marker-Datei, des Big-Dye-Sets, der Matrix und der MegaBACE-Typisierung in Genotypen umgewandelt.

2.2.2.3 ABI 3730

3730-„Running-Puffer“ und 3730 POP-7™-Polymerwurden morgens für sämtliche Platten des Tages geladen. Die Thermo-Fast® 96 „Detection Plate“ wurde mit einem Septum bedeckt und in die Plattenvorrichtung gesetzt („plate base and plate retainer“). Das „Sample-sheet“ wurde als plt-file gesichert und in die ABI 3730-Software geladen. Es wurde in der Software angegeben, dass die Big Dye Version 1.1 verwandt wurde und dass es sich um lange Sequenzen handelte.

▼ 29 

Zur Auswertung wurden die Rohdaten mit der Software „DNA star“ Version 5.0 automatisch bearbeitet. Die vorgegebenen Daten wurden nicht verändert und anschließend wurden die gewonnenen Sequenzen in Seq Man™ II Version 5.05 ausgewertet.

2.2.3 Sequenzierung

Die Sequenzierung nach Sanger beruht auf der Kettenabbruchmethode. Die entstandenen Segmente verschiedener Länge werden im Kapillarsequenzierer aufgetrennt und die Fluoreszensfarbstoffe im Laserstrahlengang aufgezeichnet. Anschließend wird daraus die Nukleotidreihenfolge errechnet.

2.2.3.1 PCR – Aufreinigung

Das PCR-Produkt wurde anhand des Agarose-Gels überprüft, enzymatisch mit 1,8 U Exo I und 0,32 U SAP für 30 min bei 37°C und 15 min bei 72°C inkubiert und aufgereinigt.

2.2.3.2  Sequenzreaktion

▼ 30 

Das Programm zur Sequenzreaktion wurde selbst etabliert. Ein 10 μl Ansatz enthielt 0,5 μl Big Dye.1, 1x Big Dye® Sequenzierungspuffer, 1,25 nmol Primer und 2 μl aufgereinigtes PCR-„Template“.

Bedingungen der Sequenzreaktion:

  1. 5 min bei 98°C
  2. 10 sec bei 96°C
  3. 5 sec bei 55°C
  4. 4 min bei 60°C
  5. Wiederholen der Schritte 2-4 für weitere 29 Zyklen

2.2.3.3  Aufreinigung des Sequenzierproduktes

▼ 31 

Zur Aufreinigung des Sequenzierproduktes kam das Millipore Montage Seq96 „Sequencing Reaction Cleanup Kit“ zur Anwendung. Hierbei wurde ein mitgelieferte „96 well SEQ plate“ auf das „Vakuumfold“ platziert und 5 µl Sequenzierprodukt in die „wells“ pipettiert. Nach der Zupipettierung von 20 µl „injection solution“ wurde für etwa 3 min ein Vakuum von 20 inHg angelegt. Weitere 25 µl „injection solution“ wurden hinzu gegeben und wieder für 3 min durch Anlegen eines Vakuums abgesaugt. Nach der Resuspendierung mit 25µl „injection solution“ wurde das Produkt in der vorhandenen Platte 5 min bei Raumtemperatur geschüttelt. Anschließend erfolgte die Überführung in eine Thermo-Fast® 96 „Detection Plate“, in die vorher 10 µl dH20 hinein pipettiert wurden.

2.2.4 RNA-Extraktion

2.2.4.1  Probengewinnung

Das Blut wurde venös gewonnen, sofort mit Trizol gemischt und in Eis transportiert.

Die Haarwurzeln entstammten der Kopfhaut. Sie wurden sofort in „RNA-later RNA Stabiliziation Reagent“ gegeben.

▼ 32 

Die Hautprobe zur Etablierung der Methode entstammte dem Überschuss der Nävuszellnävus-Extraktion der Autorin am Oberschenkel. Die Hautprobe der Patientin wurde nach erfolgtem Einverständnis am Handgelenk durch Abschürfen an der Epidermis-Dermis-Grenze gewonnen, damit keine Narben entstehen konnten. Auch die Hautprobe wurde nach Gewinnung sofort in RNA-later „RNA Stabiliziation Reagent“ gegeben.

2.2.4.2 RNA- Extraktionsprotokoll aus Blut

Zu 1 ml frischem EDTA-Blut wurden 10 ml Trizol gegeben und stark gevortext. Nach einer Inkubation bei Raumtemperatur von 5 min wurden 2 ml Chloroform hinzu gegeben und bei 4°C für 15 min bei 12,000 x g zentrifugiert. Nach vorsichtigem Abpipettieren der oberen Schicht und Mischung mit 5 ml Isopropanol erfolgte die Inkubierung für 10 min bei Raumtemperatur. Danach wurden die Proben bei 4°C für 10 min bei 12 000 x g zentrifugiert. Der Überstand wurde verworfen und das Pellet wurde mit mindestens 75% Ethanol gewaschen. Nach 5 min Zentrifugieren bei 4°C und 7500 x g wurde die Flüssigkeit abdekantiert und das Pellet getrocknet. Zum Auflösen fanden 50 μl DEPC-Wasser (RNase freies Wasser) Verwendung. Anschließend wurde die RNA sofort weiterverarbeitet und der Rest bei –20°C gelagert.

2.2.4.3 RNA-Extraktionsprotokoll aus Haaren

Zur RNA-Extraktion aus Haarwurzeln wurde das „RNeasy® Protect Mini Kit“ von Qiagen verwandt. Analog dem Protokoll wurden 10 μl β-Mercaptoethanol zu 1 ml der Lösung RTL pipettiert. In 350 μl dieses Gemisches wurden ca. 25 Haarwurzeln gegeben, intensiv gevortext und danach 3 min bei >8000 rpm zentrifugiert. Der Überstand wurde in 350 μl 70%igen Ethanol gegeben und anschließend auf eine Qiaquick Säule aufgebracht. Diese Säule wurde 15 sec bei >8000 rpm zentrifugiert. Der Ausfluss wurde verworfen, 700 μl RW1-Puffer auf die Säule gegeben und erneut für 15 sec bei > 8000 rpm zentrifugiert. Dieser Vorgang wurde zweimal mit 500 μl RPE-Puffer wiederholt und die Säule zum Trocknen für 2 min bei >8000 rpm zentrifugiert. Zur Eluation des Produkts wurden 30 μl RNase freies Wasser auf die Säule pipettiert und für 1 min bei >8000 rpm ebenfalls zentrifugiert. Danach erfolgte die sofortige Weiterverarbeitung der RNA und die Lagerung des Restes bei –20°C.

2.2.4.4 RNA-Extraktionsprotokoll aus Haut

▼ 33 

RNA-Extraktion aus Haut mit „RNeasy® Protect Mini Kit“ von Qiagen

Teil 1:

In 297 μl RTL-Puffer mit 3 μl β-Mercaptoethanol wurden ca. 30 mg Gewebe homogenisiert und 590 μl ddH20 und 0,2 mg Proteinase K hinzu pipettiert. Nach 10-minütiger Inkubation bei 55°C wurde der Ansatz für 3 min bei 10000 x g bei 22°C zentrifugiert. Anschließend konnten 900 μl des Überstandes abpipettiert und mit 450 μl 96% Ethanol aufgefüllt werden.

▼ 34 

Teil 2:

700 μl des Ansatzes wurden auf ein Säule gegeben und 15 sec bei >10000 rpm zentrifugiert, der Überstand verworfen und eine Wiederholung des Schrittes mit dem restlichen Ansatz durchgeführt. Danach wurden 700 μl RW1-Puffer auf die Säule gegeben und wieder 15 sec bei >10000 rpm zentrifugiert. Es erfolgte eine zweimalige Wiederholung des Vorgangs mit 500 μl PRE-Puffer. Nur bei der letzten Wiederholung dauerte die Zentrifugation 2 min. Zum Eluieren wurden 30 μl RNase freies Wasser direkt in die Silica-Gel-Membran der Säule pipettiert und 1 min bei > 10000 rpm zentrifugiert. Die Wiederholung des Schrittes erfolgte in einem zweiten Gefäß. Danach wurde die RNA sofort weiterverarbeitet und der Rest bei –20°C gelagert.

RNA Extraktion aus Haut mit „RNeasy® Lipid Tissue Mini Kit“ von Qiagen

▼ 35 

Bis zu 100 mg Gewebe wurden in 1 ml „QIAzl Lysis Reagent“ homogenisiert und 5 min bei Raumtemperatur inkubiert. Nach dem Hinzufügen von 200 μl Chloroform wurde der Ansatz 15 sec intensiv geschüttelt und für weitere 3 min bei Raumtemperatur inkubiert. Anschließend erfolgte das Zentrifugieren des Ansatzes bei 4°C bei 12000 x g für 15 min. Die wässrige Phase (ca. 600 μl) konnte abpipettiert und mit 600 μl 70% Ethanol aufgefüllt werden. Das weitere Vorgehen folgte dem Teil 2 des obigen Haut-Extraktionsprotokolls.

2.2.4.5  Reverse-Transkriptase-PCR (RT – PCR)

Mittels RT-PCR ließ sich aus mRNA durch Reverse Transkriptase cDNA herstellen. Die „Random“-Hexamere dienten als Primeräquivalent. In einer anschließenden PCR wurde der spezifisch zu untersuchende Nukleinsäure-Abschnitt der cDNA amplifiziert. Teilweise wurde die RNA vor Benutzung mit 1U „DNase RNase free“ sowie 6,25 U RNase-Inhibitor für 30 min bei Raumtemperatur inkubiert. Ansonsten wurde die RNA sofort weiterverarbeitet. Ein 10 μl Ansatz enthielt nach Möglichkeit 100-150 ng RNA, 2,5 nmol je dATP, dCTP, dGTP und dTTP, 97 pmol Hexanucleotidmischung, 6,25 U RNase-Inhibitor, 100 pmol DTT und 200 U Reverse Transkriptase mit RT-Reaktions-Puffer. Der Ansatz wurde mit dem doppelten Volumen durchgeführt und für 5 min bei 56°C inkubiert, um Sekundärstrukturen aufzulösen. Danach erfolgte die Abkühlung des Ansatzes mittels Eisbad und dessen Halbierung. Der einen Hälfte wurde 200 U Reverse Transkriptase und der anderen Hälfte als Kontrolle 1 μl DEPC-Wasser hinzugefügt. Diese Kontrollprobe diente in den folgenden Schritten als Kontrolle einer möglichen DNA-Kontamination der Probe. Beide Ansätze wurden für 10 min bei 20°C, für 40 min bei 42°C und für 6 min bei 98°C inkubiert.

2.2.5 Pyrosequenzierung

Pyrosequenzierung ist eine DNA-Sequenzierungstechnik, die zur SNP-Genotypisierung benutzt werden kann. Aufgrund der Sensitivität der Methode eignet sich diese besonders zur Quantifizierung zweier Allele eines Gens. Für die quantitative Analyse der Expression der beiden Allele des Loricrin-Gens wurde hier das PSQ™ HS 96A System von „Pyrosequencing“ verwendet (Abschnitt 1.6.3).

2.2.5.1 Aufreinigung der PCR-Produkte aus einem Agarose-Gel

▼ 36 

Die Gelaufreinigung erfolgte mit einem 1%igem Agarose-Gel. Das gesamte PCR-Produkt wurde mit 6 µl Orange G versetzt und elektrophoretisch aufgetrennt (siehe Abschnitt 2.2.2.1). Unter UV-Licht wurde die Produktbande sichtbar gemacht, mit einem Skalpell ausgeschnitten und in das Millipore Ultrafree®-DA Aufreinigungsgefäß gegeben. Bei der Zentrifugation für 10 min bei 5 000 x g wurde das Agarose-Gelstück vernebelt und das PCR-Produkt gereinigt.

2.2.5.2 Einzelstrangisolierung für die Sequenzreaktion

Nach der Kontrolle der PCR mittels Agarose-Gel-Elektrophorese (Abschnitt 2.2.2.1) erfolgte die Immobilisierung der Biotin-markierten PCR-Produkte. Dazu wurden ein Gemisch aus 38 μl ddH2O, 2 μl Streptavidin Sepharose™, 40 μl 2x BW-Puffer in eine PSQ™96 – Platte gegeben und mit 20 μl PCR-Produkt versetzt. Die Platte wurde 5 min bei Raumtemperatur auf einem Schüttler inkubiert. Die Separation der Einzelstränge erfolgte mit der Vakuum-Aufreinigungsstation von Pyrosequencing. Mittels eines „Vakuum Prep Tool“ mit 96 Filtersonden wurden nun die „Sepharose-Beads“ mit den daran immobilisierten PCR-Strängen aus dem PCR-Ansatz gefiltert und blieben während der folgenden Reinigungsschritte an diese Filterstation gebunden. Zur Separation der Einzelstränge wurden die Produkte zuerst 5 sec in 70% Ethanol gewaschen, dann 5 sec in 0,2 M NaOH denaturiert und 7 sec im Wasch-Puffer gespült. Nach Abschalten des Vakuums lösten sich die DNA-Einzelstränge in einer PSQ™ HS 96-Platte in 12 μl Sequenzierpuffer und 3,6 nmol Sequenzierprimer von den Filtersonden. Dieser Ansatz wurde 2 min bei 85°C inkubiert und anschließend zur Primeranlagerung auf Raumtemperatur abgekühlt.

2.2.5.3 Pyrosequenzierung

Zur Quantifizierung der beiden Allele des Loricrin-Gens ließ sich das PSQ™ HS 96A-System verwenden. Die Sequenzreaktion erfolgte mit den „PSQ HS 96 Nucleotide“ und „PSQ HS SNP Reagent Kits“. Proben, die nicht mittels Agarose-Gel-Extraktion aufgereinigt worden waren, wurden mit 900 ng „Single stranded binding protein“ (SSBP) versetzt. Die Eingabe der Reihenfolge der Zugabe der Desoxynukleotide „Dispensation order“ während der Reaktion erfolgte zuvor manuell in die PSQ HS 96A-Software Version 1.1. Diese Software berechnete ebenfalls nach der Reaktion die Häufigkeiten, mit der die beiden Allele des Gens vorlagen.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
XDiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
22.06.2006