[Seite 23↓]

3  Material und Methoden

3.1 Material

3.1.1 Geräte

Thermocycler

Biometra

Hybridisierungsofen

MWG BIOTECH

Stromversorgungsgeräte

Biometra, Consort, Biorad, Gibco BRL

Zentrifugen

Sigma, Sorvall, Heraeus, Eppendorf

Flüssigszintillationszähler

Wallac

Phosphorimager

Fuji

Transilluminator

AGS

Elektrophoresekammern

EMBL, Sigma, Biometra

Kamera

Polaroid

Laminarbox

Antair

Messerhomogenisator

Ultraturax T25, Janke & Kunkel, IKA-Labortechnik

Wasserbäder

MWG Biotech

Photometer

Shimadzu

UV-Lampe

VEB Quarzlampen

3.1.2 Chemikalien

Alle verwendeten Chemikalien besaßen den Reinigungsgrad pro analysi.

Acrylamid/Bisacrylamid-Lsg.

Roth

Agarose

Serva

AgNO3

Merck

Ampicillin

Roth

Bacto Agar

Difco

Bacto Trypton

Difco

Bacto Hefeextrakt

Difco

Borsäure

Merck, Roth

Chloroform

Merck, Roth

Coomassie-Brilliant-Blau

Merck

Dextransulfat

Merck

DTT

Sigma, Stratagene

EDTA

Roth

Ethanol

Roth, Baker

Ethidiumbromid

Roth

Essigsäure

Roth, Baker

Formaldehyd

Roth

Formamid

Merck

Glucose

Merck, Roth

Glycerol

Merck

Glycin

Merck, Roth

Harnstoff

Roth

HCl

Merck

Heparin

Sigma

HEPES

Sigma

IPTG

AppliChem, Roth

Isopropanol

Merck, Roth

KAcetat

Promega

Kanamycin

Sigma

KCl

Roth

LiCl

Roth

Methanol

Roth, Baker

MgCl2

Sigma

β-Mercaptoethanol

Sigma

MOPS

Roth

NaAcetat

Roth

NaCl

Merck

NaCitrat

Merck, Roth

NaOH

Roth

NH4OH

Roth

Phenol

Roth

SDS

Roth

TRIS

Merck, Roth

Trichloressigsäure

Roth

X-Gal

AppliChem

3.1.3 Radiochemikalien

32P]-rUTP (800 Ci/mmol)

ICN

32P]-dCTP (1000 Ci/mmol)

ICN

[35S]-Methionin (1000 Ci/mmol)

Amersham

3.1.4 Synthetische Oligonukleotide

Tabelle 1: Verwendete TCTP-Primer

Hinprimer Kaninchen

Rückprimer Kaninchen

Name

5’Sequenz 3’

Position

Name

5’Sequenz 3’

Position

P23 01H

CTTTTCCGCCCGCTCCCC

1 (5’UTR)

HMO-TAP-R2

TCTTGTAGATGTCGGAGAAC

375 (Exon 2)

P23 5`Nco

TACCAGCCGCCACCATGGTT

103 (5’UTR)

P23 98R

GATGGCGGCTGGTAGGAG

98 (5’UTR)

P23 636H

CAAAGTTGGCAATTTGGATC

636 (3’UTR1)

P23 635R

TTAACATTTTTCCATCTCTAA

615 (cod.)

P23 H4

GAGAGAATGCCTATTAGT

844 (3’UTR2)

P23 823R

GAATTTAAATGCATTTTATTT

823 (3’UTR1)

 

  

P23 R3

CAACTCAATCAGTCTCTC

1146 (3’UTR2)

Alle Oligonucleotide wurden von der Firma TIB Mol-Biol (Berlin) im Synthesemaßstab 0,2 μmol bezogen.


[Seite 26↓]

3.1.5  Enzyme, Kits und Sonstiges

BioMax MR Filme

Kodak

Biotin-14-CTP

Gibco BRL

Chromaspin S100 Säulen in DEPC-H2O

Clontech

Desoxyribo-/Ribonukleotide

Biolabs, Promega, Roche

E. coli rRNA

Roche

Flexi Rabbit Reticulocyte Lysate System

Promega

Heringssperma-DNA

Roche

Hexalabel DNA Labeling Kit

MBI Fermentas

Micro BCA Protein Assay Kit

Pierce

Mini Complete Protease Inhibitor

Roche

Nucleasefreies H2O

Promega

Restriktionendonukleasen, Ligasen, Polymerasen

AGS, Biolabs, Boehringer, MBI, Promega, Stratagene, Gibco BRL

Polaroid Polapan PRO 100 Filme

Polaroid

Poly dA/ Poly dC

Sigma

Proteinase K

Promega

QIAEX II Gel Extraction Kit

QIAGEN

QIAGEN Plasmid Mini/ Midi/ Maxi Kits

QIAGEN

QIAquick Gel Extraction Kit

QIAGEN

QIAquick Nucleotide Removal Kit

QIAGEN

RNA Clean System

AGS

RNasin, RNA Guard

Promega, Pharmacia

RNase A, RNase T1

Roche, Gibco BRL, Sigma

RQ1 DNase

Promega

Streptavidin-Agarose-Partikel

Gibco BRL, Sigma Aldrich

Taq Polymerase

Invitek, Rapidozym

TOPO TA Cloning Kit

Invitrogen

Wheat Germ Extract

Promega

3.1.6 Software und Internetressourcen

Zum Analysieren von DNA-, RNA- und Proteinsequenzen wurden die Programme DNA-Strider [Seite 27↓]und DNA-Star verwendet. Auf folgende Internetressourcen wurde zurückgegriffen:

http://www.ebi.ac.uk

Sequenzvergleiche, Zugang zu EMBL- und GeneBank-Datenbanken

http://bighost.area.ba.cnr.it/BIG/UTRscan

Zugang zu UTR-Datenbanken, Suche nach potentiellen cis-Elementen in mRNAs

http://www.expasy.ch

Zugang zu Proteinsequenz-Datenbanken

http://www.ncbi.nlm.nih/BLAST

Homologie-Suche in Nukleotid- und Protein-Datenbanken

3.2 Methoden

3.2.1 Plasmidkonstruktionen

Um eine Beteiligung der untranslatierten Regionen der TCTP-mRNA an der Translationsregulation zu untersuchen, wurden Deletionsvarianten der mRNA1 und 2 für in vitro Translationsexperimente kloniert. Die vollständige TCTP-cDNA1 (843bp) und die vollständige cDNA2 (1163bp) des Kaninchens wurden zunächst aus zwei unvollständigen cDNA-Bank-Klonen (33/34, 31/1) und einem PCR-Fragment aus einem Klon, der das TPT1 Gen enthält, hergestellt. Den beiden unvollständigen Klonen fehlten jeweils 34 Nukleotide am 5’Ende. Aus dem genomischen TPT1 Klon (H2 EcoRI) wurde mittels PCR ein Fragment amplifiziert (Hinprimer: 01H, Rückprimer: HMO-TAP-R2) und in den Stratagene PCR-Script-Vektor kloniert. Die cDNA wurde dann durch Einfügen eines NheI/ApaI–Fragments aus den unvollständigen cDNA1- und cDNA2-Klonen komplettiert.

Nachfolgend wurden dann jeweils die mRNA1 (Hinprimer: 01H, Rückprimer: 823R), die mRNA2 (Hinprimer: 01H, Rückprimer: R3), die mRNA1 ohne 5’UTR (Hinprimer: 5’Nco, Rückprimer: 823R), die mRNA2 ohne 5’UTR (Hinprimer: 5’Nco, Rückprimer: R3), die mRNA ohne 3’UTR (Hinprimer: 01H, Rückprimer: 635R) und die mRNA ohne 5’UTR und ohne 3’UTR (Hinprimer: 5’Nco, Rückprimer: 635R) mittels PCR amplifiziert und anschließend nach dem Protokoll des TOPO TA Cloning Kits von Invitrogen in den PCRII-TOPO-Vektor kloniert.

Für Proteinbindungsstudien wurden die 5’UTR (Hinprimer: 01H, Rückprimer: 98R), die 3’UTR1 (Hinprimer: 636H, Rückprimer: 823R), die 3’UTR2 (Hinprimer: H4, Rückprimer: R3) sowie die gesamte 3’UTR (Hinprimer: 636H, Rückprimer: R3) der TCTP-mRNA mittels PCR aus dem cDNA2-Klon amplifiziert und ebenfalls in den PCRII- TOPO-Vektor kloniert.


[Seite 28↓]

Die humane TCTP-cDNA wurde mittels RT-PCR aus Leukozyten-mRNA kloniert und dann wurden analog zu den Kaninchen-Konstrukten Subklone der verschiedenen UTRs hergestellt. Ich danke Irina Schmidt für die Überlassung dieser Plasmide.

Ein Standard-PCR-Ansatz setzte sich wie folgt zusammen: 18,75 μl H2O, 0,75 μl 50 mM MgCl2, 2,5 μl 10xPCR-Puffer, 1 μl 10 μM Hinprimer, 1 μl 10 μM Rückprimer, 0,25 μl dNTP Mix (je 20 mM), 0,5μl Template-DNA, 0,25μl Taq-Polymerase (1U/μl). Die Annealing-Temperaturen wurden unter Verwendung der Formel Tm=69,3°C+0,41x(GC%)–650/Primerlänge+3°C abgeschätzt. Die weiteren PCR-Bedingungen wurden angelehnt an das Protokoll von Kramer und Coen (Kramer und Coen, 1995).

3.2.2 Klonierung und Präparation der Plasmide

Die unter 3.2.1. beschriebenen Plasmidkonstruktionen wurden nach Standardmethoden kloniert (Sambrook et al. 1989). Die Ausgangsplasmide wurden mit geeigneten Restriktions-endonukleasen geschnitten, die Fragmente im Agarose-Gel aufgetrennt, ausgeschnitten und mit den Gelextraktions-Kits von QIAGEN isoliert. Anschließend wurden die kompatiblen Enden mit Hilfe der T4-DNA Ligase (1-2 U pro Ansatz mit 100-200 ng DNA) über Nacht bei 16°C ligiert.

In Eis aufgetaute kompetente Zellen E. coli DH5α ( Sambrook et al., 1989) wurden für 30 min auf Eis mit dem Ligationsansatz inkubiert. Nach einem kurzen Hitzeschock von 90 s bei 42°C wurden die Zellen für 1 h bei 37°C in 900 μl LB und 20 mM Glucose geschüttelt. Die auf LB-Agar mit dem entsprechendem Antibiotikum, IPTG und X-Gal gewachsenen Einzelklone wurden mittels PCR sowie Restriktionsspaltung nach Plasmidpräparation getestet. Die Konstrukte wurden durch Sequenzierung überprüft.

Die Plasmidpräparationen erfolgten mit den QIAGEN Plasmid-DNA-Mini/Midi oder Maxi-Kits, die auf dem Prinzip der Anionen-Austauschchromatographie beruhen.

3.2.3  In vitro Transkription

Zur Herstellung von in vitro transkribierter TCTP-mRNA für in vitro Translationsexperimente wurden die cDNA-Plasmide zunächst mit geeigneten Restriktionsendonukleasen linearisiert. Die DNA wurde daraufhin mittels Phenol/Chloroform-Extraktion isoliert, mit Ethanol gefällt und schließlich in 1x TE-Puffer aufgenommen. Danach folgte eine einstündige Behandlung mit Proteinase K mit einer Endkonzentration von 100 μg/ml in 0,5% SDS, 50 mmol NaCl, 5 mM EDTA pH 8, 10 mM Tris pH 8 sowie eine erneute Phenol/Chloroform-Extraktion, Alkoholfällung und Aufnahme in 1x TE-Puffer.


[Seite 29↓]

Ein 75 μl-Transkriptionsansatz enthielt 15 μl 5x Transkriptionspuffer; ca. 2 νg linearisiertes Plasmid; 7,5 μl Ribonukleotidmix (je 10 mM); 5,6 μl 0,5 M DTT; ca. 40 U RNase-Inhibitor; ca. 50 U T7, T3 oder SP6-Polymerase sowie nucleasefreies Wasser. Nach einstündiger in vitro Transkription bei 37°C wurde die Reaktion durch Zugabe von 15 μl 0,2 M EDTA und fünfminütiger Inkubation bei Raumtemperatur gestoppt und die mRNA anschließend durch Zugabe von 15 μl 4 M LiCl und 250 μl 96% Ethanol über Nacht bei –20°C gefällt. Nach Aufnahme in 50μl nucleasefreiem Wasser wurden die Transkripte elektrophoretisch und UV-spektrophotometrisch analysiert. Auf diese Weise wurden auch die nicht radioaktiv-markierten Transkripte zur Kompetition in Electromobility Shift Assays hergestellt.

Für Proteinbindungsstudien wurden ca. 200 ng der linearisierten UTR-Subklone in 4 μl 5x Transkriptionspuffer, 2 μl 0,1 M DTT, ca. 40 U Ribonucleaseinhibitor, 4 μl Mix aus rATP; rCTP, rGTP (je 2,5 mM), 2,4 μl 100 mM rUTP, 4 μl [α32P rUTP, ca. 20 U T7 oder SP6-Polymerase und nucleasefreiem Wasser (Gesamtvolumen=20 μl) 1h bei 37°C in vitro transkribiert. Nach DNase-Behandlung (2 U) für 15 min bei 37°C wurden die markierten Transkripte mittels Phenol/Chloroform-Extraktion und Chromaspin-Säulen gereinigt. Die spezifische Aktivität der Transkripte wurde in einem Flüssigszintillationsmesser bestimmt und betrug nach Ethanolfällung ~70000 cpm/ng.

Für die Proteinisolierung mittels RNA-Affinitätschromatographie wurden Biotin-14-CTP markierte Transkripte wie folgt hergestellt: ~4 μg linearisiertes Plasmid, 20 μl 5x Transkriptionspuffer, 37,5 μl 0,1 M DTT, 10 μl rNTP-Mix (je 10 mM rATP, rGTP, rUTP); 5 μl 10 mM CTP, 5 μl 10 mM Biotin-14-CTP, ~80 U Ribonucleaseinhibitor; ~100 U T7 oder SP6-Polymerase sowie nucleasefreies Wasser (Gesamtvolumen=100 μl) wurden 1 h bei 37°C transkribiert, die Reaktion mit 20 μl 0,2 M EDTA gestoppt (25°C, 5 min) und die Transkripte anschließend mit 20 μl 4 M LiCl und 600 μl 96% Ethanol über Nacht bei –20°C gefällt. Nach Zentrifugation und Aufnahme in 50 μl nucleasefreiem Wasser wurden die Transkripte in einem Agarosegel analysiert.

3.2.4  In vitro Translation

Die Translation der in vitro transkribierten TCTP-mRNAs (~40-120 ng nach 3 min 65°C) erfolgte in einem mit Mikrokokken-Nuklease behandelten Kaninchen-Retikulozytenlysat oder Weizenkeimlysat der Firma Promega. Ein Ansatz (12,5 μl) enthielt 9,2 μl Flexi Rabbit Reticulocyte Lysate, 0,3 μl [35S]-Methionin, 0,5 μl proteinogene Aminosäuren ohne Methionin [Seite 30↓](1mM), 0,2 μl 2,5 M KCl (Endkonzentration=40 mmol/l) und 0,3 μl (~10 U) RNase-Inhibitor. Nach einer Inkubation der Ansätze für 60 min bei 30°C wurden die Proben in 2x Laemmli-Probenpuffer aufgenommen, 4 min in einem Wasserbad gekocht und anschließend in einem 15%igen SDS-Polyacrylamidgel elektrophoretisch aufgetrennt. Die Visualisierung der in vitro translatierten Proteine erfolgte mittels Autoradiographie bei –80°C.

Ein Translationsansatz (12,5 μl) mit 6,5 μl Weizenkeimextrakt enthielt: 1 μl proteinogene Aminosäuren ohne Methionin (1 mM), 0,5 μl 1 M KAc (Endkonzentration=40 mmol/l)), 0,25 μl (~10U) RNase-Inhibitor, 0,2 μl [35S]-Methionin, ~200 ng mRNA sowie nucleasefreies Wasser. Diese Ansätze wurden für 2 h bei 25°C inkubiert und anschließend analog zu den Proben mit Retikulozytenlysat analysiert.

3.2.5 Electromobility Shift Assays und UV-Crosslinking-Experimente

Für Electromobility Shift Assays (Konarska und Sharp 1986, Leibold und Munro 1988) wurden ~0,15 ng (~10000 cpm) des [a32P]-markierten in vitro Transkripts nach einer zehnminütigen Vorbehandlung bei 65°C mit 3,5 μl Zell- bzw. Gewebeextrakt (Proteinkonzentration=20-80μg/μl) oder 3,5 μl nucleasefreiem H2O für 15 min bei Raumtemperatur in 10 mM HEPES pH 7,2, 3 mM MgCl2, 5% Glycerol; 1 mM DTT; 100 mM KCl, E. coli rRNA in einer Endkonzentration von 50 μg/ml und ~20 U RNase- Inhibitor inkubiert. Nach Zusatz von Heparin in einer Endkonzentration von 5 mg/ml wurden die Ansätze für weitere 10 min bei Raumtemperatur inkubiert. Den Proben wurden jeweils 2 μl Ladepuffer (0,5 % Bromphenolblau; 0,5 % Xylencyanol; 48,5 % Glycerol) zugegeben und anschließend 4 μl jeder Probe in einem 4%igen nichtdenaturierenden Polyacrylamidgel in 0,5x TBE-Puffer elektrophoretisch getrennt und die Banden mittels Autoradiographie sichtbar gemacht.

In den Ansätzen für die UV-Crosslinking-Experimente (Leibold und Munro 1988) wurden ~1,5ng (~100000 cpm) wie bei den Electromobility Shift Assays beschrieben 15 min bei Raumtemperatur mit den Proteinextrakten bzw. mit H2O inkubiert. Nach der Zugabe des Heparins wurden die Proben dann 15 min auf Eis mit UV- Licht (254 nm, 25 W, Abstand: 4-5cm) bestrahlt. Daran schloss sich ein 15-minütiger RNase-Verdau mit 4 μl eines RNase-Mix bei 37°C an (RNase-Mix: 320 μl Aqua bidest, 40 μl 10x RNase-Puffer: 100 mM Tris, 10 mM MgCl2, 1 M KCl, pH 7,4, 40 μl RNase A c=10 mg/ml, 0,6 μl RNase T1 ~1400 U). Nach Zugabe von 15 μl 2x Laemmli-Probenpuffer wurden die Ansätze für 3 min bei 80 °C inkubiert und nachfolgend jeweils 10 μl pro Ansatz in einem 15%igen SDS-Polyacrylamidgel aufgetrennt. Die Analyse der Banden erfolgte wiederum mittels Autoradiographie.


[Seite 31↓]

3.2.6  RNA-Affinitätschromatographie

Das Protokoll für diese Versuche wurden angelehnt an die Beschreibungen von Rouault et al. und Ostareck et al. (Rouault et al. 1989, Ostareck et al. 1997). Die Streptavidin-Agarose-Partikel (600 μl) wurden zunächst für 2 min bei 4°C und 3500 rpm abzentrifugiert. Die verbleibenden ~300 μl dicht gepackten Partikel wurden dann zunächst mit 1 ml 1 M KCl-Elutionspuffer (1 M KCl, 1,5 mM MgCl2, 10 mM Tris-HCl pH 7,4, 0,5 mM DTT) voreluiert und dann viermal mit jeweils 1 ml Waschpuffer (150 mM KCl, 1,5 mM MgCl2, 10 mM Tris-HCl pH 7,4, 0,5 mM DTT) gewaschen.

Das in 3.2.3. beschriebene Biotin-14-CTP markierte Transkript (~10 μg) wurde daraufhin mit 50 μl Waschpuffer und 10 μl (~400 U) RNase-Inhibitor gemischt und während 100 min bei 4°C unter vorsichtiger Rotation an die Streptavidin-Agarose-Partikel gebunden. Nach kurzer Zentrifugation (2 min, 4°C, 3500 rpm) und großzügigem Abnehmen des Überstandes wurde dann 1 ml des mit 27 μl β-Mercaptoethanol und 4 μl (~160 U) RNase-Inhibitor für 10 min bei 4°C vorinkubierten Proteinextraktes zugegeben. Die Inkubation von den an die Streptavidin-Agarose gebundenen Biotin-Transkripten mit den Proteinextrakten erfolgte bei 4°C unter Rotation für 1 h.

Die Partikel wurden dann wiederum abzentrifugiert und fünfmal mit jeweils 1 ml Waschpuffer für 5 min bei 4°C unter Rotation gewaschen. Die Elution der an das Transkript gebundenen Proteine erfolgte zweimal mit je 100 μl 1 M KCl- Elutionspuffer (1 M KCl, 1,5 mM MgCl2 , 10 mM Tris-HCl pH 7,4, 0,5 mM DTT) und einmal mit 100 μl 3 M KCl-Elutionspuffer (3 M KCl, 1,5 mM MgCl2 , 10 mM Tris-HCl pH 7,4, 0,5 mM DTT) für 10 min bei 4°C unter Rotation. Ein weiteres Mal wurde mit 100 μl 8 M Harnstoff-Elutionspuffer (8 M Harnstoff, 1 M KCl, 10 mM Tris-HCl pH 7,4) für 20 min bei Raumtemperatur unter Rotation eluiert.

Von den Waschschritten und Eluaten wurden jeweils 20 μl mittels SDS-PAGE (15%iges Gel) und nachfolgender Silberfärbung (Wray et al. 1981) analysiert. Nach Auftragen von 80 μl der Eluate wurden die SDS-Gele mit Coomassie-Brilliant-Blau gefärbt. Banden wurden zur Identifizierung mittels Massenspektrometrie ausgeschnitten.

3.2.7 Proteinidentifizierung mittels MALDI-TOF-Massenspektrometrie

Diese Daten wurden in einer Kooperation mit der Arbeitsgruppe von Dr. Thilo Kähne, Universitätsklinikum Magdeburg, erhoben. Die Proteinbanden wurden aus den mit Coomassie-Brilliant-Blau gefärbten Gelen ausgeschnitten und jeweils mehrmals mit 0,1 M NH4HCO3 und [Seite 32↓]Acetonitril gewaschen bis kein Farbstoff mehr sichtbar war. Anschließend wurden die Gelpartikel in einer Vakuum-Zentrifuge eingedampft und schließlich in 0,1 M NH4HCO3 mit 10 mM DTT resuspendiert. Es folgte eine 45-minütige Inkubation bei 56°C. Nach Abkühlung auf Raumtemperatur wurde der Überstand durch 0,1 M NH4HCO3 mit 55 mM Jodacetamid ersetzt. Nach 30-minütiger Inkubation in Dunkelheit wurden die Gelpartikel nochmals dreimal in 0,1 M NH4HCO3: Acetonitril (1:1 v/v) gewaschen und wiederum in der Vakuumzentrifuge eingedampft. Die Proben wurden in frisch angesetzter 50 mM NH4HCO3-Lösung mit 12,5 ng/μl Trypsin (Roche) aufgenommen und über Nacht bei 37°C inkubiert.

Die entstandenen Peptide wurden durch jeweils mehrmaliges Waschen mit 25 mM NH4HCO3 und Acetonitril, unterstützt durch Ultraschallbehandlung, aus dem Gel gelöst. Die Extrakte wurden zusammengeführt und durch Vakuumzentrifugation getrocknet. Für die Massenspektrometrie wurden die Peptide in 5 μl 0,1% TFA resuspendiert und mit einer 200 nl „reversed-phase (C18)-nanocolumn“ aufgereinigt. Die Peptide wurden in 5 μl 70% Acetonitril eluiert und anschließend mit α-Cyano-4-Hydroxy-Zimtsäure (20 mg/ml) in 70% Acetonitril an einem SCOUT 384-600 μm Anchor-Target cokristallisiert. Die Massenspektrometrie wurde in einem MALDI-TOF-MS (Reflex III, Bruker Daltonics, Deutschland) mit externer Kalibrierung durchgeführt. Die Analyse der tryptischen Fragmente erfolgte mit der BioTools 2.0 Software (Bruker Daltonics, Deutschland), und für die Datenbanksuche wurde die Mascot-Software (Matrix Science, USA) verwendet.

3.2.8 Northern Blots

Zur RNA-Extraktion wurden die etwa 100mg schweren Melanomzell-Pellets mit 1 ml RNA Clean versetzt und die weiteren Schritte gemäß des Protokolls des Herstellers ausgeführt.

In einem formaldehydhaltigen Agarose-Gel (Laufpuffer=1x MOPS) wurden je 10 μg Melanomzell-RNA elektrophoretisch aufgetrennt. Nach Photographie des Gels wurde die RNA über Nacht in 20x SSC mittels Kapillartransfer auf eine Nylon-Membran übertragen. Die Quervernetzung von RNA und Membran erfolgte bei 80°C für 2 h.

Aus dem Plasmid, das die vollständige humane TCTP-cDNA2 enthält, wurde zunächst mit EcoRI das Insert herausgeschnitten und das Fragment dann mit dem Hexalabel DNA Labeling Kit von MBI Fermentas mit [a32P]-dCTP markiert. Das Abtrennen der verbliebenen freien Radioaktivität erfolgte mit dem Nucleotide Removal Kit von QIAGEN.

Der Blot wurde mit 10 ml Prähybridisierungslösung (50 % Formamid; 5x SSC; 5x Denhardt`s, [Seite 33↓]250 μg/ml Heringssperma-DNA, 10 μg/ml Poly dA, 10μg/ml Poly dC) für 4 h bei 42°C prähybridisiert. Zu 10 ml Hybridisierungslösung (50 % Formamid, 10 % Dextransulfat, 5x SSC, 1x Denhardt`s, 100 μg/ml Heringssperma-DNA, 10 μg/ml Poly dA, 10 μg/ml Poly dC) wurde markierte Sonde mit einer spezifischen Aktivität von ~107cpm nach zehnminütiger Inkubation bei 99°C zugegeben und die Membran über Nacht bei 42°C hybridisiert. Der Blot wurde anschließend mehrmals (50°C, 55°C) in Waschpuffern mit absteigender Salzkonzentration (2x SSC, 0,2x SSC/2% SDS) von unspezifisch gebundener Radioaktivität befreit. Die Anzahl der Waschschritte richtete sich nach der detektierbaren Hintergrundaktivität. Die Membran wurde dann über Nacht bei –80°C auf einen Röntgenfilm exponiert.

3.2.9 Western Blots

Je 20 μg der Melanomzell-Proteinlysate wurden in einem 15%igen SDS-Polyacrylamidgel elektrophoretisch getrennt. Die Proteine wurden nach einem Semi-Dry-Verfahren (Biometra) auf hydrophobe PVDF-Membranen (Immobilon P, Millipore) geblottet (15 min, 15 V). Die Membran wurde mit 5%igen Magermilchpulver in 1xTBS-T-Puffer (20 mM TRIS, 137 mM NaCl, 0,1% Tween 20) über 1 h blockiert.

Der Blot wurde 1 h bei Raumtemperatur mit einem Kaninchen-Anti-Maus-TCTP-Antikörper, Verdünnung 1:2000 in TBS-T/2% Magermilchpulver (D 24, überlassen von Dr. U. Bommer, London), der mit humanem TCTP kreuzreagiert, inkubiert. Nicht gebundener Primär-Antikörper wurde durch mehrmaliges Waschen mit 1x TBS-T entfernt. Es folgte eine einstündige Inkubation mit einem POD-markierten Schwein-Anti-Kaninchen-Immunglobulin-Ak, Verdünnung 1:10000 in TBS-T/2% Magermilchpulver (Dako, Deutschland). Die Detektion der positiven Proteinbanden erfolgte nach erneuten Waschschritten mit dem „ECL Western Blotting Detection Reagent“ der Firma Amersham Pharmacia Biotech. und anschließender Röntgenfilm-Exposition über 5-10 min.

3.2.10 Melanomzellkulturen

Die Melanomzelllinien wurden in Kooperation mit der Arbeitsgruppe von Dr. Hermann Lage, Charité Berlin, kultiviert. Verwendet wurde die Zelllinie MeWo, die aus einer Lymphknotenmetastase eines Patienten mit malignem Melanom im Sloan Kettering Krebszentrum, New York, etabliert wurde.

Die Zellen wuchsen in Leibovitz L 15 Medium, dem 10% fetales Kälberserum, 1 mM L-Glutamin, 6,25 mg/l Fetuin, 80 IE/l Insulin, 2,5 mg/l Transferrin, 1 g/l Glucose, 1,1 g/l NaHCO3, 1% essentielle Vitamine und 20000 kIE/l Trasolyl zugefügt wurde, in einer [Seite 34↓]Atmosphäre von 5% CO2 bei 37°C. Die Zellen wurden mit TBS/EDTA von den Schalen geerntet.

Durch Zugabe von Etoposid (0,1 und 1,0 μg/ml) oder Cisplatin (0,01 und 1,0 μg/ml) wurden die gegen diese Chemotherapeutika resistenten Zelllinien selektiert. Die Bezeichnungen der resistenten Zelllinien ergeben sich jeweils aus dem zugesetzten Cytostatikum und dessen Konzentration. Eine Übersicht der verwendeten Zelllinien und ihrer Bezeichnungen ist in Tab. 2 enthalten.

Tabelle 2 Übersicht der verwendeten Melanomzelllinien

Bezeichnung der Zelllinie

Resistenz

Konzentration des Cytostatikums

MeWo

Keine Resistenz

Kein Zusatz eines Cytostatikums

MeWo+CIS 1

Keine Resistenz

Zusatz von 1μg/ml Cisplatin

MeWo+ETO 1

Keine Resistenz

Zusatz von 1μg/ml Etoposid

CIS 0,01

Resistenz gegen Cisplatin

Zusatz von 0,01μg/ml Cisplatin

CIS 1

Resistenz gegen Cisplatin

Zusatz von 1μg/ml Cisplatin

ETO 0,1

Resistenz gegen Etoposid

Zusatz von 0,1μg/ml Etoposid

ETO 1

Resistenz gegen Etoposid

Zusatz von 1μg/ml Etoposid

3.2.11 Präparation von S10-Lysaten aus Kaninchengeweben und Melanomzellkulturen

Um Gewebeextrakte für Proteinbindungsstudien zu gewinnen wurden die Kaninchengewebe (Leber, Niere, Lunge) in flüssigem Stickstoff zermörsert und nach Aufnahme in zweifachem Volumen Puffer A (10 mM HEPES, pH 7,2, 1,5 mM MgCl, 10 mM LiCl, 0,56 mM DTT) mit einem Messerhomogenisator homogenisiert. Um den Abbau der Proteine zu verhindern, wurde dem Puffer A der Mini Complete Protease Inhibitor von Roche zugesetzt. Durch zweimalige Zentrifugation von 10 min bzw. 30 min bei 4°C bei 10000x g wurden Membranen und Organellen entfernt, so dass schließlich die Proteinfraktion S10 gewonnen wurde, die sowohl Polysomen als auch mRNP-Komplexe enthält.

Für Proteinbindungsstudien wurden die Pellets der Melanomzellen in einem zweifachen Volumen Puffer A (mit Mini Complete Protease Inhibitor) lysiert, ebenfalls mit einem Messerhomogenisator homogenisiert und anschließend zweimal 10 min bei 4°C und 10000x g zentrifugiert.

Für die Western Blots wurden die Melanomzell-Pellets in Lyse-Puffer (10 mM TRIS, pH 7,5; [Seite 35↓]140 mM NaCl, 1mM EDTA, 25% Glycerol, 0,5% SDS, 0,1 mM DTT, Mini Complete Protease Inhibitor) aufgenommen. Nach Homogenisation wurden die Überstände durch einmalige Zentrifugation für 10min 10000x g bei 4°C gewonnen.

Zur Bestimmung der Proteinkonzentrationen wurde der Micro BCA Protein Assay Kit von Pierce mit BSA als Proteinstandard verwendet.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
27.11.2003