[Seite 20↓]

II  Material und Methoden

Puffergrundsubstanzen, Lösungsmittel und weitere Laborchemikalien wurden von den Firmen Roth (Karlsruhe), Sigma (Taufkirchen) und Life Technologies (Karlsruhe) bezogen.

1 Kultur eukaryotischer Zellen

1.1 Nährlösungen, Zusätze und Zelllinien

Für die Zellkultur wurden Eagle´s „minimal essential medium“ (MEM) von der Firma Sigma (Taufkirchen) und RPMI (nach dem Roswell Park Memorial Institute, in dem es entwickelt wurde), Phosphatpuffer („phosphate buffered saline“ (PBS) ohne Ca++ und Mg++) sowie Glutamax von Life Technologies (Karlsruhe) bezogen. Fötales Kälberserum (FCS), 2,5 % Trypsin, Na-Pyruvat und Gentamicin wurden von PAA Laboratories (Linz, Österreich) verwendet. In der vorliegenden Arbeit wurden die in Tabelle 1 gelisteten Zelllinien verwendet.

Tab. 1: Verwendete Zelllinien

Zellen

Herkunft

Humane Hepatomzelllinie HepG2

American Type Culture Collection (ATCC) No. HB-8065, Rockville USA [185]

Humane Hepatomzelllinie HuH-7

Dr. Raynes, London School of Hygiene and Tropical Medicine, London, Great Britain

Humane Lungenkarzinomzelllinie A-549

Deutsche Sammlung von Mikroorganismen und Zellkultur GmbH, Braunschweig [186]

1.2 Kultivierung

Die verwendeten Zelllinien wurden entsprechend den Angaben ihrer Hersteller bei 37 °C unter 5 % CO2 in MEM mit den Zusätzen 10% FCS, 1% Glutamin, 1 % Na-Pyruvat und 0,5 % Gentamicin kultiviert. FCS wurde zuvor 30 min bei 56°C im Wasserbad inaktiviert. Alle Arbeiten wurden an einer Zellkulturbank unter sterilen Bedingungen durchgeführt. Das Medium wurde vor Kontakt mit der Zellkultur auf 37°C erwärmt. Ca. alle 3 Monate wurden neue Chargen der Zelllinien in Kultur genommen und nach zwei Wochen Kultur mit den Experimenten begonnen. Die Zellen wurden zweimal pro Woche umgesetzt und gegebenenfalls expandiert.

1.3 Mycoplasmen

Mycoplasmeninfektionen stellen ein großes Problem in der Zellkultur dar. Die Stimulierbarkeit und das Muster der Genexpression verändern sich bei infizierten Zellen, Wachstum und Teilungsfrequenz sind herabgesetzt. Daher wurden die Hepatomzellen bei Verdacht auf eine Infektion einem Mycoplasmentest unterzogen. Der Test wurde mit dem „Mycoplasma Detection Kit" (Roche, Mannheim) durchgeführt, bei Kontamination wurde die Kultur über 6 Wochen mit „BM-Cyclin" (Roche, Mannheim) behandelt, oder die Zellen wurden verworfen. Der Behandlungserfolg wurde wiederum mit dem „Mycoplasma Detection Kit“ überprüft bevor „sanierte Zellen“ wieder verwendet wurden.


[Seite 21↓]

1.4  Stimulation der Zelllinien

Die Zytokine IL-6, IL-1β, TNF-α, TGF-β1 und IL-10 sind humanen Ursprungs und wurden rekombinant hergestellt. Sie wurden von R&D Systems (Wiesbaden-Nordenstadt) bezogen, Dexamethason (Dex) wurde von Sigma (Taufkirchen) erworben.

Die Zytokine und Dex wurden bei -20°C als Aliquots gelagert. Verwendete Zytokine wurden nur einmal aufgetaut, bei 4 °C im Kühlschrank gelagert und innerhalb von 4 Wochen aufgebraucht. Die Zellen wurden ein bis zwei Tage vor den Experimenten in Kulturplatten ausgesät. Bei der Stimulation wurde gleichzeitig das Kulturmedium gewechselt.

2 Arbeiten mit E. coli Bakterien

2.1 Plasmide und Bakterienkultur

Tab. 2: Verwendete Plasmide

Plasmid

Insert

Quelle

pXP2 Luci (leer) (6,2 kB)

LBP-Promotor: wt, Trunkationen, Mutationen

Schumann, Charité, Berlin

pCMV-Vektor (3,3 kB)

hLBP-Gen

Schumann, Charité, Berlin

pUC19

GAPDH-Gen

Bauer, Universität Freiburg

pUC19

β-Galaktosidase-Gen mit RSV- oder CMV-Promotor

Schumann, Berlin Charité

pUC19

wt-Gene und Mutationen von: NF-IL-6, p64, C/EBP

Leutz, Max-Delbrück-Centrum (MDC), Berlin

pLTR His (K) (4,4 kB)

Gfi-1 Gen: wt, Fragmente

Möröy, Universitätsklinikum Essen

 

ELAM-1-Luciferase-Reporter Plasmid

[187]

Die Amplifikation der Plasmide und der Expressionsvektoren erfolgte in DH5-E.coli-Kulturen, die in Luria-Bertani (LB)-Medium angesetzt wurden. Alle Arbeiten wurden steril durchgeführt.

 

LB-Medium

10

g

Bacto-Trypton (Difco, Detroit, USA)

  

5

g

Hefeextrakt (Difco, Detroit, USA)

  

5

g

NaCl

  

ad 1

l

A. bidest., pH 7,0 mit NaOH einstellen

Zur Herstellung von Kulturplatten wurden dem LB-Medium 15 g/l Agar zugesetzt.

Nach dem Autoklavieren des LB-Mediums wurde sterilfiltriertes Ampicillin (50 µg/ml) zugesetzt. 200 ml LB-Medium wurden mit einer E. coli Kolonie von einer LB-Agarplatte oder 100 µl aus einem Bakterienglyzerinstock beimpft und über Nacht bei 37 °C und 170 U/min geschüttelt.

2.2 Transformation

Zur Transformation von Plasmid-DNA in E. coli wurden 50 µl kompetente Bakterien (Life Technologies, Karlsruhe) vorsichtig auf Eis aufgetaut, mit 10 ng DNA vorsichtig gemischt und für [Seite 22↓]30 min auf Eis inkubiert. Danach wurde der Ansatz für 45 s einem Hitzeimpuls von 42 °C ausgesetzt, für 2 min auf Eis gestellt, 0,5 ml LB Medium zugegeben und für 1 Stunden bei 37 °C geschüttelt. Schließlich wurde der Ansatz auf LB-Ampicillinplatten ausplattiert und über Nacht bei 37 °C inkubiert. Gewachsene Einzelkolonien wurden für die Bakterienkultur verwendet.

2.3  Präparation von Plasmid-DNA

Die Bakterienkultur wurde bei 4°C und 6000 x g zentrifugiert und aus dem Bakterienpellet die Plasmid-DNA isoliert. Dazu wurde der „Maxi-Kit" zur Präparation von Plasmid-DNA der Firma Life Technologies (Karlsruhe) verwendet.

2.4 Konzentrationsbestimmung von Nukleinsäuren

Zur Konzentrationsbestimmung wurde die DNA 1:100 in H20 verdünnt und in einer Quarzküvette im UV-Spektrometer bei 260 nm gemessen, wobei eine OD von 1 33 µg/ml Einzelstrang-DNA bzw. 50 µg/ml Doppelstrang-DNA entspricht. Zur Beurteilung von Salz- und Proteinverunreinigungen wurde zusätzlich bei 280 nm gemessen: Liegt der Quotient der Messwerte 260 / 280 nm unter 1,7, ist das ein Hinweis auf eine starke Verunreinigung der DNA.

2.5 Restriktionsspaltung von DNA

Zur Kontrolle der verwendeten Plasmide und der eingefügten DNA (Insert) wurde die DNA verdaut. Dazu wurden 2-5 U Restriktionsenzym pro µg DNA, 1 x Restriktionspuffer in A. bidest. und 1 µg DNA inkubiert, wobei das Volumen des Enzyms maximal 10 % des Gesamtansatzes betrug. Die Inkubation erfolgte für 1 Stunde nach den Temperaturangaben des Herstellers, in der Regel bei 37 °C.

2.6 Elektrophoretische Auftrennung der DNA

Plasmid-DNA und Fragmente wurden regelmäßig mit Hilfe der Elektrophorese untersucht (Probegel). Dazu wurde ein Agarosegel wie folgt hergestellt und die Elektrophorese im TBE-Puffer durchgeführt.


[Seite 23↓]

 

Agarosegel

20

ml

5x TBE Puffer

  

80

ml

A. bidest.

  

1

g

Agarose

  

2

µl

Ethidiumbromidlösung (18 µg/ml)

    

Agarose aufkochen, etwas abkühlen lassen, Ethidiumbromid zugeben, Gel gießen.

     
 

5x TBE Puffer

54

g

Trisbase

  

27,5

g

Borsäure

  

20

ml

0,5 M EDTA (pH 8,0)

  

ad 1

l

A. bidest.

     

6 x Ladepuffer

0.25

%

Bromphenolblau

  

0.25

%

Xylencyanol

  

30

%

Glyzerin in A. bidest., bei 4°C lagern

     

1 µg DNA wurde mit Ladepuffer und A. bidest. gemischt und bei 5 V/cm im Agarosegel aufgetrennt. Als Größenmarker diente die 100 bp- oder die 1 kb-Leiter von Life Technologies (Karlsruhe).

3 Luciferase Reportergen-Assay

Zur Bestimmung der LBP-Promotoraktivität wurden die Hepatomzelllinien mit LBP-Promotor/Luciferase-Konstrukten transfiziert, und im Regelfall wurde 48 Stunden später die Luciferaseaktivität gemessen. Dabei wird Luciferin unter Lichtfreisetzung durch Luciferase oxidiert. Das gemessene emittierte Licht entspricht dabei der Luciferaseaktivität, die der Luciferasemenge äquivalent ist, welche wiederum der Promotoraktivität entspricht. Zu jedem Versuchsansatz wurde ein β-Galaktosidaseplasmid mit konstitutivem Promotor kotransfiziert und die gemessene β-Gal-Aktivität zum Abgleich der Luciferasewerte verwendet.

3.1 Transfektion

Einen Tag vor der Transfektion wurden die Hepatomzellen in 12-Loch-Platten mit einer Dichte von 1 – 2 x 105 Zellen/Loch ausgesät. Pro Loch wurden 4 µl Lipofectamin (Life Technologies, Karlsruhe) mit 40 µl Kulturmedium ohne Zusätze gemischt. Parallel dazu wurden 1 µg LBP/Luciferase-Plasmid-DNA und 0,2 µg β-Galaktosidaseplasmid gemischt und mit Kulturmedium auf 40 µl aufgefüllt. Bei Kotransfektionen wurden 0,2 bis 1 µg des entsprechenden Plasmids zugegeben. Die beiden Ansätze wurden gemischt und für 30 min bei Raumtemperatur inkubiert. In der Zwischenzeit wurden die Zellen mit Kulturmedium ohne Zusätze gewaschen. Danach wurde der Ansatz mit Medium auf 400 µl aufgefüllt, vorsichtig gemischt und nach dem Absaugen der Überstände tröpfchenweise auf die Zellen pipettiert. Die Transfektion erfolgte nun für 4 Stunden. Sie wurde durch Ersetzen des Transfektionsmediums mit FCS-haltigem Kulturmedium abgestoppt. Die Stimulierung bzw. Inkubation der Zellen mit Zytokinen und Dex erfolgte am darauffolgenden Tag, im Normalfall für 48 Stunden.

3.2 Luciferase- und β-Galaktosidasemessung

Die Luciferase- und β-Galaktosidaseaktivität wurden mit dem Luciferase Reporter Gene-Assay und dem β-Gal Reporter Gene-Assay von Roche (Mannheim) gemessen. Diese Assays enthalten auch einen Lysepuffer, der für beide Tests geeignet ist. Die Zellen wurden zuerst 2 x mit PBS [Seite 24↓]gewaschen, anschließend wurden 150 µl Lysepuffer auf die Zellen gegeben und der Ansatz für 15 min bei Raumtemperatur leicht geschüttelt. Danach wurden die restlichen Zellen durch Klopfen abgelöst, in 96-Loch-Platten überführt und für 10 min bei 3000 U/min zentrifugiert. Für die sich anschließende Luciferasemessung wurden 20 µl Überstand abgenommen und 50 µl Luciferase Reaktionspuffer dazugegeben. Die Messung erfolgte sofort nach Zugabe des Reaktionspuffers für 0,3 bis 3 sec in weißen 96-Loch-Platten (NUNC, Wiesbaden) mit dem Multifunktions-Spektrometer „SPECTRA Fluor plus“ von Tecan (Crailsheim). Bei der β-Gal-Messung wurden zu 25 µl Lysat 50 µl Substrat-Reagenz gegeben, 15-40 min unter leichtem Schütteln bei Raumtemperatur inkubiert, 25 µl Initiationsreagenz zupipettiert und ebenfalls sofort im Multifunktions-Spektrometer gemessen.

3.3 Auswertung

Die Messzeit betrug in der Regel 1 Sekunde, wurde aber laufend angepasst. Dabei wurde die größte Differenz zwischen den niedrigsten Probemesswerten und dem Hintergrund (leeres Loch der Platte) angestrebt, ohne dass von den hohen Probemesswerten der Messbereich des Instruments nach oben überschritten wurde. Anschließend wurde der Quotient aus Luciferase-Wert und β-Gal-Wert gebildet (β-Gal normalisiert), der in der vorliegenden Arbeit als relative Luciferaseaktivität (RLA) bezeichnet wird. Dieser Quotient bietet gegenüber den reinen Luciferasewerten („relative light units“, RLU) den Vorteil, dass Unregelmäßigkeiten in der Zellzahl und bei der Transfektionseffizienz ausgeglichen werden. Alle Versuchsansätze wurden parallel 3-fach durchgeführt und daraus der Mittelwert und die Mittelwertabweichung errechnet. Alle Experimente wurden mehrfach wiederholt und mit den beiden Hepatomzelllinien HuH-7 und HepG2 durchgeführt.

4 Mutation des LBP-Promotors

Zur Aktivitätsbestimmung potentieller TF-Bindungsstellen im LBP-Promotor wurden die Bindungsstellen durch Mutation verändert und anschließend im Luciferaseassay überprüft, ob sich die Promotoraktivität unter den spezifischen Versuchsbedingungen verändert hat. Die komplette Sequenz des LBP-Promotors und der untersuchten potentiellen TF-Bindungsstellen ist in Tabelle 3 dargestellt.

4.1  Auswahl der zu mutierenden DNA-Sequenzen

Mögliche TF-Bindungsstellen wurden in erster Linie an Hand der im Internet verfügbaren TF-Datenbank TRANSFAC 4.0 (Transcription Factor Database, http://transfac.gbf.de/) und der Auswertungssoftware MatInspector durchgeführt [188]. Sie gibt für jede potentielle Bindungsstelle einen Faktor an, der dem Grad der Übereinstimmung mit der Konsensussequenz entspricht. Dieser Faktor wird für die besonders wichtige Kernregion und für die weniger wichtige Randregion [Seite 25↓]angegeben („core similarity“ und „matrix similarity“). Es kann gezielt nach „starken“ Bindungsstellen gesucht werden, die eher eine direkte Wirkung auf den Promotor haben oder nach „schwächeren“ Sequenzen, die oft bei der Kooperation mit benachbarten Bindungsstellen wichtig sind. Zusätzlich wurde noch weitere Auswertungssoftware verwendet:

TFSEARCH

http://molsun1.cbrc.aist.go.jp/research/db/TFSEARCH.html

WWW SigScan

http://bimas.dcrt.nih.gov/molbio/signal

Tfsitescan

http://www.ifti.org/

Bei neueren TF, deren Bindungsstellen noch nicht in die Datenbanken aufgenommen waren, wurde manuell gesucht und bewertet.

Die Auswahl der untersuchten Bindungsstellen erfolgte nach der Qualität der Bindungsstellen, der Lage auf dem Promotor und der Entfernung vom Transkriptionsstart sowie nach benachbarten Bindungsstellen.

4.2 Kriterien der Mutation und Übersicht

Virtuell wurden einzelne Basen ausgetauscht oder kleinere Deletionen eingefügt und danach die Qualität der Mutation, wenn möglich, im MatInspector geprüft. Dadurch wurde versucht, mit geringer Veränderung an der Wildtypsequenz des Promotors die jeweilige Bindungsstelle auszuschalten (siehe Tabelle 4). Zusätzlich wurde die Mutation so gewählt, dass eine neue Restriktionsenzym-Schnittstelle entstand, an Hand derer das erfolgreiche Einfügen der Mutation überprüft werden konnte.

4.3  Mutationsassay

Ursprünglich wurde zur Einfügung der Mutationen der Morph Site-Specific Plasmid DNA Mutagenesis Kit (Eppendorf/5 Prime Inc, Hamburg) verwendet. Für diesen Kit sind Oligonukleotide mit 30 Basen ausreichend. Nach dessen Produktionseinstellung wurde der QuikChange Site-Directed Mutagenesis Kit von Stratagene (La Jolla, Kalifornien, USA) verwendet und die Mutagenese nach Herstellerangaben durchgeführt. Hierbei muss die Schmelztemperatur der Oligonukleotide genau eingestellt werden, was zu Längen der Oligonukleotide von 45 und mehr Basenpaaren führt (siehe Tabelle 5). Die Oligonukleotide, in deren Mitte sich die Mutation befindet, dienen als Primer, und über mehrere PCR-Schritte werden Strang und Gegenstrang des mutierten Plasmids generiert. Durch einen anschließenden Verdau mit dem Restriktionsenzym Dpn I, das die methylierten Ausgangsstränge schneidet, wird das nicht mutierte Plasmid zerstört. Die mutierten Plasmide wurden anschließend in E. coli transformiert und auf Selektionsmedium ausplattiert.


[Seite 26↓]

Tab. 3: Sequenz des LBP-Promotors und untersuchter TF-Bindungsstellen


[Seite 27↓]

Tab. 4: Mutierte, potentielle TF-Bindungsstellen auf dem LBP Promotor

Name1

TF-Bindungs-stelle2

Position3

Orien-tierung

wt

 

Mutation

Sequenz4

Qualität5

 

Sequenz4

Qualität5

AP I

AP-1

-1638

+

TGTGACCTATT

1/0,97

 

TGGTACCTATT

0

AP II

AP-1

-1628

-

TGGGAGTCACC

1/0,97

 

TGGGAGTCGAC

0,75/0,73

AP III

AP-1

-819

+

CATGACTCCTT

1/0,92

 

CATGGTACCTT

0,52/0,53

AP IV

AP-1

-493

-

TCCTGGGTCACAgg

1/0,93

 

TCCC gg

 

AP V

AP-1

-130

-

TAGGAGTCAGG

1/0,93

 

TAGGAGTCGAC

0,50/0,560

AP VI

AP-1

-68

+

TATGACTTCAG

1/0,90

 

GTCGACTTCAG

0,74/0,70

AP VII

AP-1

-540

+

CACACTGACTCAAT

1/0,97

 

CAAGCT

0

CEBP I

C/EBP-b

-422

+

GGTTTGAGAAACAC

0,98/0,92

 

GGTTTGAGATCTAC

0,6/0,6

CEBP II

C/EBP-b

-254

-

CAGTTTCCTCATCT

0,98/0,92

 

CAGTATACCTCATCT

0

CEBP III

C/EBP-b

-197

+

AGATGAGGCAAGAT

1/0,94

 

AGATGAAGCTTGAT

0

Gfi Ia

Gfi-1

-556

-

AGCAGTGATTTac

1/0,97

 

AGCAGTGAAGTac

0,75/0,69

Gfi Ib

Gfi-1

-556

-

AGCAGTGATTTac

1/0,97

 

ATcc

0

Gfi II

Gfi-1

-1167

+

aTAATCCCAGT

1/0,89

 

aGCATGCCAGT

0,50/0,51

Gfi III

Gfi-1

-798

-

TTCCAGATTG

1/0,84

 

TTCCAGCTGG

0

Gfi IV

Gfi-1

+60

+

cCAATCCACAG

1/0,83

 

cGCATGCACAG

0,50/0,56

GRE I

GRE

-1672

+

TCTGATCT

-

 

TCGGATCC

-

GRE II

GRE

-108

+

ACTGATCT

-

 

ACGGATCC

-

GRE III

GRE

-788

-

TTGAACATAGAAGCCT

1/0,6

 

TTGAATTCAGAAGCCT

0

GRE IV

GRE

-417

+

GAGAAACACTGTTTTC

1/0,68

 

GAGAAACAGAATTTTC

0,52/0,52

GRE V

GRE

-185

-

ATGAACAGTGATGAAT

1/0,54

 

ATGCGCAGTGATGAAT

0

NFkB I

NF-kB

-1701

+

TGGGGTTCCC

-

 

CCGGGTTGGC

-

NFkB II

NF-kB

-515

-

GGGCAAGTCCct

-

 

Gtt

-

Smad I

Smad

-303

-

GTCTG

-

 

GCGGG

-

Smad II

Smad

-1294

-

GTCTG

-

 

GCTGG

-

Stat I

Stat-3

-447

-

TTCCAGAAAAT

1/0,91

 

ATGGAGAAAAT

0,6/0,6

Stat II

Stat-3

-399

+

TTGGGGGAA

1/0,89

 

TTGGGGTTA

0,73/0,61

1 Name der Mutation


[Seite 28↓]

Tab. 5: Verwendete Oligonukleotide zur Mutation des LBP-Promotors

Name*

Sequenz

Position

AP I

GCCTGCCAGTGCTGTTTGGTACCTATTGGGAGTCACCC

-1654 bis -1617

AP II

CCTATTGGGAGTCGACCTGTTAATCCCACCACATTCAGTTGG

-1633 bis -1592

AP III

CCCCCACAACCAGAGACAATGCCTCATGGTACCTTGCTAAATATTTTCC

-843 bis -795

AP IV

GGCAAGTCCCTGAAATTGAATTCCCGGGCATGCAACTGTTTAAACATTTGCC

-514 bis -455

AP V

GGGATGATCATAGGAGTCGACCTTCCTCATCCACTGATCTAGGC

-140 bis –97

AP VI

GGCTTCTAAGTATGACCTGTCGACTTCAGTGATGATCGCAAGCAGGTTCC

-86 bis -37

AP VII

GTGATTTACTGGCAAGCTTATGTATTTAAG

-552 bis –515

CEBP I

CACCACCAGCAAGGTTTGAGATCTACTGTTTTCCATTGGGGG

-434 bis –393

CEBP II

GTGGCTTTTTTGAACCTCAGTATACTCATCTGCTAAACCAGGCC

-271 bis –228

CEBP III

GAGACTGGCTGAGATGAAGCTTGATGAACAGTGATGAATATGGG

-208 bis –165

Gfi Ia

TATCTTGGAGCAGTGAAGTACTGGCACACT

-564 bis -535

Gfi Ib

CAGTGGTATCTTGGATCCTGGCACACTGAC

-570 bis -532

Gfi II

GGGCATGGTGGCCCAAGTCTAGCATGCCAGTATTTTGGAAGGCC

-1188 bis -1145

Gfi III

CCTTGCTAAATATTTTCCAGCTGGTTGAACATAGAAGCCTATTTTGAACCCCCC

-812 bis –759

Gfi IV

CTTAAGGGACCTGGGCCGCATGCACAGCTGGGACAGTCC

+43 bis +81

GRE I

TGGGACATTCGGATCCTAACCTCA

-1680 bis –1657

GRE II

CCTCATCCACGGATCCAGGCAGTG

-116 bis –93

GRE III

CCAGATTGTTGAATTCAGAAGCCTATTTTGAACCCCCCAAAATAGAACC

-796 bis –748

GRE IV

CACCACCAGCAAGGTTTGAGAAACAGAATTTTCCATTGGGGG

-434 bis –393

GRE V

GGCTGAGATGAGGCAAGATGCGCAGTGATGAATATGGGG

-202 bis –164

NFkB I

GGCCTGGACTGCCGGGTTGGCTGTGCTTAACGTGGG

-1712 bis –1677

NFkB II

CAATTATGTATTTAAGCTTGAAATTGAATTC

-530 bis –492

Smad I

CACTCTCAACCCTGCCGCGGGCTGGGGGTGAG

-319 bis –288

Smad II

GCAGGGCTGGGGCAAAACTCTAAAAATTAAACACAGCTGGTACTATAAATTTTG

-1329 bis –1276

Stat I

CATTTGCCAATTGCCATGGAGAAAATTTCACCACCAGCAAGGTTTG

-462 bis –417

Stat II

GAGAAACACTGTTTTCCATTGGGGTTAACATTTATTTTTTAAATAAACGAGCC

-417 bis -365

*Name der Mutation, für die die Oligonukleotide verwendet wurden

4.4 Probeverdau mit Restriktionsenzymen

Kolonien aus dem Mutationsansatz wurden einzeln ausgewählt („gepickt“), kultiviert und die Plasmid-DNA isoliert (QIAprep Spin Miniprep Kit, Qiagen, Hilden). Jede eingefügte Mutation wurde so ausgelegt, dass gleichzeitig eine neue Restriktionsenzym-Schnittstelle eingefügt wurde. Daher wurde anschließend ein Doppelverdau angesetzt: Zum einen mit dem Enzym für die neu generierte Schnittstelle und zum anderen in der Regel mit BamH I oder Xho I. An diesen Schnittstellen ist der LBP-Promotor in den Luciferase-Vektor integriert. Über ein Probegel wurde die Mutation durch das jeweils spezifische Fragment nachgewiesen. Zusätzlich wurde der mutierte Bereich kontrollsequenziert und bei kritischen oder unerwarteten Ergebnissen eine zweite Mutation zur Kontrolle durchgeführt.


[Seite 29↓]

5  EMSA

Beim „electrophoretic mobility shift assay“ (EMSA) werden DNA-Protein-Interaktionen untersucht: Die Bindung eines Proteins (in der Regel eines TF) an die DNA (ein Oligonukleotid mit der Sequenz eines bestimmten Promotorabschnitts) führt gegenüber der freien DNA zu einer Veränderung der Laufeigenschaften in der Elektrophorese, d.h. zu einem „Shift“. Dieser ist an einer Verschiebung der radioaktiv markierten DNA-Bande zu erkennen. Wird zusätzlich noch ein spezifischer Antikörper gegen das DNA-bindende Protein zugegeben, tritt eine weitere Verschiebung der Bande auf, ein sogenannter „Supershift“.

5.1 Zellkultur und Stimulation

Es wurden etwa 1 x 106 Hepatomzellen in eine 10 cm Kulturschale ausgesät und am nächsten Tag für 15 min bis 48 Stunden stimuliert. Bei kurzen Stimulationszeiten wurde die Zelldichte entsprechend höher gewählt. Typischerweise betrug die Konfluenz der Zellen bei Lyse 80 %.

5.2 Isolierung nukleärer Proteine

Nach Beendung der Stimulierung wurden die Zellen mit 10 ml eiskaltem (1x) PBS gewaschen, in 1 ml PBS mit einem Schaber vom Untergrund abgelöst und bei 1000 U/min und 4 °C zentrifugiert. Das Pellet wurde anschließend in 400 µl Puffer A resuspendiert und für 10 min auf Eis inkubiert.

 

Puffer A

10

mM

HEPES, pH 7,6

  

10

mM

KCl

  

0,1

mM

ETDA

  

0,1

mM

EGTA

  

1

mM

DTT

  

0,1

mM

Na3O4Va

  

0,5

mM

PMSF

  

1

mM

Leupeptin (Na3O4Va, PMSF, Leupeptin und DTT werden erst kurz vor Gebrauch zugegeben)

Anschließend wurden 25 µl 10 % Nonidet NP40 zugegeben, geschüttelt und bei 4 °C bei 13000 g für 1 min zentrifugiert. Der Überstand enthielt die zytoplasmatischen Proteine. Die Pellets wurden in 50 µl Puffer B resuspendiert.

 

Puffer B

400

mM

KCl

  

20

mM

HEPES, pH 7,6

  

1

mM

EDTA

  

1

mM

EGTA

  

1

mM

DTT

  

0,1

mM

Na3O4Va

  

0,5

mM

PMSF

  

1

mM

Leupeptin (Na3O4Va, PMSF, Leupeptin und DTT werden erst kurz vor Gebrauch zugegeben)


[Seite 30↓]

Anschließend wurden die Proben bei 4 °C für 30 min im Überkopfschüttler geschüttelt und 5 min bei 4 °C und 13000 g zentrifugiert. Die Überstände enthielten die nukleären Proteine. Die Proteinkonzentration wurde nach Bradford (Bio-Rad Protein-Assay, Bio-Rad, München) bei 595 nm im Photometer gemessen. Anschließend wurden die Proben aliquotiert, in flüssigem Stickstoff schockgefroren und bei –80 °C aufbewahrt.

5.3 Hybridisierung und Markierung der Oligonukleotide

Die Oligonukleotide wurden von Genset Oligos (Paris, Frankreich) oder Eurogentec (Seraing, Belgien) synthetisiert. Für den EMSA wurden i.d.R. 30 bp lange Oligonukleotide verwendet, die so gewählt wurden, dass sich die TF-Bindungsstelle im Zentrum befand.

Jeweils 10 µg der komplementären Einzelstrang-DNA wurden mit 4 µl 10 x T4-PNK-Puffer gemischt und mit A. bidest. auf 40 µl aufgefüllt, für 2 min auf 95 °C erhitzt und langsam auf Raumtemperatur abgekühlt. Das Markieren der doppelsträngigen Oligonukleotide erfolgte durch Phosphorylierung mit dem Phosphorisotop 32P. Die PNK (Polynukleotid Kinase) wurde von Amersham Pharmacia Biotech (Freiburg) bezogen und das γ-32P-ATP von NEN/PerkinElmer (Zaventem, Belgien).

 

Reaktionsansatz

1

µl

dsDNA (= 0,5 µg DNA aus dem Standardansatz)

  

7

µl

10 x PNK-Puffer

  

2

µl

T4-PNK Kinase (1:10 verdünnt mit Kinase-Deletionspuffer)

  

4

µl

γ-32P-ATP

  

56

µl

A. bidest.

Der Reaktionsansatz wurde für 30 min bei 37 °C inkubiert. Über Nick-Säulen (Amersham Pharmacia Biotech, Freiburg) wurden die freien Radionukleotide von der markierten doppelsträngigen DNA chromatographisch abgetrennt.

5.4 DNA-Protein-Inkubation, Gellauf und Visualisierung

Es wurden 4 µg nukleäre Proteine, 2 µl BSA (1 µg/µl), 2 µl Puffer D+ und 4 µl Puffer F gemischt und mit A. bidest. auf 19 µl aufgefüllt. Zuletzt wurde 1 µl markiertes Oligonukleotid zugegeben, gemischt und für 30 min bei Raumtemperatur inkubiert.

 

Puffer D+

20

µl

HEPES, pH 7,9

  

4

%

Glyzerin

  

100

mM

KCl

  

0,5

µM

EDTA

  

0,00063

%

NP-40

  

2

mM

DTT

  

0,1

%

PMSF

  

ad 1000

µl

A. bidest.


[Seite 31↓]

Puffer F (pH 7,2)

400

mM

Ficoll

  

100

mM

HEPES

  

100

mM

KCl

  

10

mM

DTT

  

1

mM

PMSF

Für die Gfi-1-Shifts wurde folgender Puffer verwendet:

 

Gfi-1-Puffer-Mix

4

mM

Tris-HCl (pH 7,5)

  

80

mM

NaCl

  

0,5

mM

ZnSO4

  

1

mM

EDTA

  

0,5

mM

DTT

  

5

%

Glyzerin

Die Ansätze wurden in einem 4 %-igen PAA-Gel mit 0,5 x TBE Laufpuffer 1 Stunde bei 200 V aufgetrennt.

 

PAA-Gel (4 %)

5

ml

5 x TBE Puffer

  

5

ml

40 % PAA

  

250

µl

10 % APS

  

25

µl

Temed

  

40

ml

A. bidest.

Nach dem Gellauf wurde das Gel für eine Stunde auf Filterpapier in einem beheizbaren Trockner mit Vakuumpumpe getrocknet. Anschließend wurde das Gel für 30 min bis mehrere Tage auf speziellem Filmmaterial exponiert (Kodak, bezogen über Sigma-Aldrich, Taufkirchen).

6 LBP-ELISA

Die LBP-Konzentration in den Kulturüberständen der Hepatomzellen wurde mit dem „sandwich-enzyme-linked immunosorbent assay“ (Sandwich-ELISA) gemessen. Dabei immobilisiert ein anti-LBP-Antikörper (Ak), der auf einer speziellen ELISA-Platte fixiert wurde, LBP. Mit einem zweiten, biotinylierten anti-LBP-Ak wird das LBP mittels einer Farbreaktion nachgewiesen.

6.1 Zellkultur und Zellstimulation

Für den LBP-ELISA wurden die Hepatomzelllinien in 24-Loch-Platten mit 0,5 x 105 Zellen/Loch ausgesät. Am nächsten Tag folgte die Stimulierung mit Zytokinen und Dex in 200 µl Medium/Loch für 24 bis 48 Stunden.


[Seite 32↓]

6.2  Durchführung des ELISA

 

Coating-Puffer

100

mM

NaHCO3, pH 8,2

     
 

Verdünnungspuffer

1

x

PBS

  

10

%

FCS

     
 

Waschpuffer

1

x

PBS

  

0,05

%

Tween 20

Die ELISA-Platte (MaxiSorp Immunoplatte, 96-well, NUNC, Wiesbaden) wurde mit 50 µl/well Coating Puffer und 0,1 µg/well des 1. Ak (polyclonal Rabbit anti-hLBP Ak, XOMA, Berkeley, USA) über Nacht bei 4 °C inkubiert. Nach dreimaligem Waschen mit Waschpuffer wurde die Platte mit 200 µl/well Verdünnungspuffer für eine Stunde bei Raumtemperatur blockiert. Danach wurden eine LBP-Verdünnungsreihe mit bekannter Konzentration (rLBP-Standard, Xoma) und 100 µl/well Zellkulturüberstände auf die Platte gegeben und nach einer Stunde 4 x gewaschen. Dann wurden 100 µl/well Verdünnungspuffer und 30 pg/well des 2. Ak (biotinylierter 1. Ak) für eine Stunde bei Raumtemperatur inkubiert und 4 x gewaschen. Streptavidin-Peroxidase (Sigma, Taufkirchen) wurde mit Verdünnungspuffer 1:1000 verdünnt und die Platte mit 100 µl/well für 30 min bei Raumtemperatur inkubiert und danach 4 x gewaschen. Durch Zugabe von 100 µg/well OPD-Substrat (o-Phenylenediamine Dihydrochloride, Tablet Sets, Sigma) erfolgte die Farbreaktion, die nach Augenmaß (5 – 30 min) durch Zugabe von 50 µl/well 2 M Schwefelsäure abgestoppt wurde. Die Extinktion der Proben wurde mit einem Spektrometer (SpectraFluor Plus, Tecan, Crailsheim) bei 492 nm gemessen und die LBP-Konzentration anhand der Eichkurve ermittelt.

7 Northern-Blot Analyse und RT-PCR

Beim Northern-Blot wird die RNA (Gesamt-RNA oder mRNA) isoliert und auf einem Gel nach Fragmentgröße aufgetrennt und auf eine Nylonmembran übertragen („geblottet“). Mit Hilfe einer 32P-markierten Sonde (einem DNA-Strang-Abschnitt aus dem zu detektierenden Gen, der mit der entsprechenden RNA hybridisiert) kann die RNA-Akkumulation nachgewiesen werden. Dazu wird die Membran mit der Sonde inkubiert, dann gewaschen und die Radioaktivität durch Auflegen eines Films nachgewiesen.

7.1 Zellkultur und Zellstimulierung

HuH-7 oder HepG2 Zellen wurden mit einer Dichte von 1 x 106 Zellen/Platte in Schalen mit 10 cm Durchmesser ausgesät. Nach 2 bis 3 Tagen, bei einer Konfluenz von ca. 80 %, wurden die Zellen für 24 bis 72 Stunden stimuliert.


[Seite 33↓]

7.2  Isolierung der RNA

Die Isolierung der Gesamt-RNA wurde mit dem RNeasy Kit von Qiagen nach Angaben des Herstellers durchgeführt. Dabei wird durch Zugabe von RNAse-Inhibitoren gewährleistet, dass die RNA nicht durch zelleigene RNAsen zerstört wird. Durch β‑Mercaptoethanol, das eine stark denaturierende Wirkung auf Proteine ausübt, werden die RNA-Protein-Komplexe aufgelöst. Die Abtrennung der RNA erfolgt über Säulen, an deren Matrix sich die RNA bindet und von der sie nach mehreren Waschschritten unter geeigneten Bedingungen wieder abgelöst wird.

7.3 Gelelektrophorese der RNA

Die Auftrennung der RNA erfolgte unter denaturierenden Bedingungen mit Agarose-Formaldehydgel in MOPS-Puffer (3-(N-Morpholino)-Propansulfonsäure).

Für 200 ml eines 1,2 %-igen denaturierenden Agarosegels wurden 170 ml A. bidest. mit 2,4 g Agarose aufgekocht. Nach dem Abkühlen auf etwa 40 - 50 °C wurden 20 ml 10x MOPS und 6 ml 37 % Formaldehyd zugegeben.

 

10x MOPS

0,2

M

MOPS, pH 7,0 in A. bidest.

  

80

mM

Natriumazetat

  

5

mM

EDTA

     
 

Laufpuffer

1x

 

MOPS

     
 

RNA-Ladepuffer

1

mM

EDTA, pH 8,0

  

0,25

%

Xylencyanol

  

0,25

%

Bromphenolblau

  

50

%

Glyzerin

     
     
 

RNA-Probepuffer

300

µl

10x MOPS-Puffer

  

520

µl

37 % Formaldehyd, pH>4,0

  

150

µl

Formamid

  

360

µl

A. bidest.

15 µg Gesamt-RNA wurden, wenn nötig, in einer Vakuumzentrifuge auf 2 µl eingeengt und mit 13 µl Probenpuffer aufgefüllt, 15 min bei 5 °C denaturiert, auf Eis abgekühlt und nach Zugabe von 2 µl Ladepuffer auf dem Gel bei 3 V/cm aufgetrennt.

7.4 Übertragen der RNA auf eine Nylonmembran („blotten“)

Nach dem Gellauf wurde die RNA mit einer Vakuum Blotting-Apparatur (Amersham) auf die Hybond N+ Nylonmembran (Amersham) übertragen. Zuerst wurde das Gel 2 x 5 min in A. bidest. und 30 min in 10 x SSC-Puffer (1,5 M NaCl, 0,15 M Natriumzitrat x 2 H2O, pH 7,0) gewaschen. In 20 x SSC-Puffer wurde anschließend die RNA in der Blotting-Apparatur auf die Membran [Seite 34↓]übertragen (4 Stunden). Auf der dann getrockneten Membran wurde durch eine UV-Strahlenquelle (Stratalinker, Stratagene, La Jolla, USA) die RNA an der Membran fixiert.

7.5 Herstellung der cDNA-Sonde

Die Sonde stellt den Abschnitt eines Gens dar, dessen mRNA nachgewiesen werden soll. Dazu wurde ein Plasmid, welches das Gen trägt, in E. coli vermehrt und, wie im Abschnitt „DNA-Präparation“ beschrieben, isoliert. Das Plasmid wurde unter Verwendung geeigneter Restriktionsenzyme verdaut und das Fragment in einem 1 %-igen Agarosegel separiert. Die Isolierung des Fragments aus dem Gel erfolgte mit dem QIAquick Gel Extraktion Kit nach Angaben des Herstellers (Qiagen, Hilden).

7.6 Radioaktive Markierung der Sonde

Die Markierung der Sonde erfolgte mit dem Megaprime DNA Labelling System von Amersham Pharmacia (Freiburg) nach Herstellerangaben. In Kürze: Die denaturierten DNA-Einzelstränge der Sonde wurden mit kurzen Zufallsprimern, einem Mix aus Nukleosidtriphosphaten (außer CTP), dem Klenow-Fragment der DNA-Polymerase aus E. coli und dem Reaktionspuffer gemischt. Dazu wurde radioaktives α-32P-dCTP gegeben, das bei der Synthese des DNA-Gegenstrangs integriert wurde. Die überschüssigen Nukleotide wurden über NAP-10 Säulen (Amersham) nach Herstellerangaben abgetrennt.

7.7 Hybridisierung von RNA und Sonde

Zuerst wurde bei der Prähybridisierung die Membranoberfläche der Nylonmembran, die eine hohe Affinität zu Nukleinsäuren aufweist, so abgesättigt, dass die (DNA-) Sonde nicht unspezifisch an die Membran binden konnte. Dazu wurde der Blot für 3 Stunden bei 68 °C in Prähybridisierungslösung inkubiert.

 

50x Denhardts Lösung

5

g

Ficoll

  

5

g

Polyvinylpyrrolidon

  

5

g

BSA

  

ad 500

ml

A. bidest. (bei –20 °C lagern)

     
 

Prähybridisierungslösung

5

x

Denhardts Lösung

  

6

x

SSC-Puffer

  

0,5

%

SDS

     
 

Hybridisierungslösung

6

x

SSC

  

0,5

%

SDS

  

100

mg/ml

Kalbsthymus-DNA

  

50

%

Formamid (deionisiert)


[Seite 35↓]

Zur Hybridisierung wurde in die Hybridisierungslösung die bei 95 °C für 5 min denaturierte Sonde gegeben (1 – 2 x 106 cpm/ml) und die Membran für 12 – 16 Stunden bei 42 °C in einem speziellen Hybridisierungsofen inkubiert. Dabei befand sich der Blot in einer zylinderförmigen Glasflasche, die sich in permanenter Drehbewegung befindet und dadurch bei minimaler Menge der Hybridisierungslösung (und der radioaktiv markierten Sonde) eine gleichmäßige Benetzung des Blots gewährleistet.

Anschließend wurde die Membran wie folgt gewaschen:

 

Schritt

Waschpuffer

Temperatur

Zeit

 

1

2x SSC, 0,5% SDS

25 °C

5

min

 

2

2x SSC, 0,1% SDS

25 °C

15

min

 

3

0,1x SSC, 0,5% SDS

37 °C

30

min

 

4

0,1x SSC, 0,5% SDS

68 °C

10

min

 

5

0,1x SSC

25 °C

5

min

Die Schritte 3 und 4 wurden bei unspezifischen Signalen und hohem Hindergrund wiederholt. Danach wurde die noch feuchte Membran in Folie eingeschlagen und ein Röntgenfilm belichtet (Kodak X-OMAT-AR über Amersham, Freiburg).

7.8 Mehrfachhybridisierung

Eine Nylonmembran kann mehrfach mit verschiedenen Sonden hybridisiert werden. Dies wurde regelmäßig mit einer GAPDH-Sonde als „house keeping“-Kontrolle durchgeführt: GAPDH wird konstitutiv exprimiert und dient der internen Kontrolle und dem Abgleich von RNA-Menge und -Qualität. Dazu wurde der Blot „gestrippt“, d.h. bei 85 °C für 15 min in A. bidest. gewaschen und dadurch die alte Sonde entfernt. Anschließend wurde der Blot wie beschrieben prähybridisiert und erneut hybridisiert.

7.9 Reverse Transkription (RT)-PCR

Für die RT-PCR wurde die Gesamt-RNA wie unter 7.2 beschrieben mit dem RNeasy Kit von Qiagen isoliert. Die reverse Transkription und die PCR wurden getrennt durchgeführt. Die RT-Reaktion wurde unter Verwendung des Omniscript Reverse Transcriptase-Kit von Qiagen nach Firmenangaben mit 3 µl der Gesamt-RNA durchgeführt.

 

Master-Mix

10,9

µl

A. bidest.

  

2,5

µl

10x Puffer

  

2

µl

dNTPs

  

0,5

µl

MgCl

  

2,5

µl

Primer sense (5µM)

  

2,5

µl

Primer antisense (5 µM)

  

0,125

µl

Taq-Polymerase


[Seite 36↓]

Für die PCR wurden zu 21 µl „Master-Mix“, der unter Verwendung des Taq PCR Core Kit von Qiagen hergestellt wurde, 4 µl cDNA aus der RT-Reaktion gegeben. Folgende Primer wurden verwendet:

Gfi-1sense5’-TACAAGTGCATCAAGTGCAGC-3’

Gfi-1antisense5’-TTGTGAAGCTTCTCACCAGTG-3’

Die Gfi-1-PCR wurde mit 30 Zyklen durchgeführt, und zwar erst für 30 s bei 95° C, dann 45 s bei 60° C und schließlich 30 s bei 72 °C. Danach wurden die Proben für 10 min bei 72° C inkubiert. Anschließend wurden jeweils 5 µl der PCR-Proben wie unter Abschnitt 2.3 beschrieben in einem 1,5 %igem Agarosegel aufgetrennt und unter UV-Licht fotografiert.

8 Western-Blot-Analyse und p44/42-Kinase-Assay

Beim Western-Blot werden isolierte Proteine elektrophoretisch aufgetrennt und auf einer Membran fixiert. Über anschließende Inkubation der Membran mit spezifischen Antikörpern können bestimmte Proteine nachgewiesen werden.

8.1 Zellkultur und Zellstimulierung

HuH-7- oder HepG2-Zellen wurden mit einer Dichte von 3 x 105 Zellen/Loch in einer 6-Loch-Platte ausgesät. Nach 2 bis 3 Tagen, bei einer Konfluenz von ca. 80 %, wurden die Zellen in der Regel für 20 min mit Zytokinen stimuliert.

8.2 Isolierung der zytoplasmatischen Proteine

 

Lysepuffer

20

mM

Tris Acetat

  

0,1

mM

EDTA

  

1

mM

EGTA

  

1

mM

Na3O4Va

  

10

mM

Na2-2-Glycerophosphat

  

50

mM

NaF

  

5

mM

Pyrophosphat

  

1

%

Triton X100

  

1

mM

Benzamidin

  

0,27

M

Sucrose, auf pH 7,5 einstellen

  

1

mM

PMSF und

  

1

µg/ml

Leupeptin vor Gebrauch zugeben

Die stimulierten Zellen wurden in kaltem PBS mit 1 mM Na2O4Va zweimal gewaschen und mit 150 μl/well kaltem Lysepuffer für ca. 10 min bei 4° C inkubiert. Die Zellen wurden anschließend mit einem Schaber abgelöst und 20 min bei 13000 U/min und 4° C zentrifugiert. Im Überstand befand sich die postmitochondriale Fraktion mit den zytoplasmatischen Proteinen. Die [Seite 37↓]Proteinkonzentration wurde gemessen, die Überstände aliquotiert, in flüssigem Stickstoff schockgefroren und bei –80 °C aufbewahrt.

8.3 Gel und Gellauf

 

SDS-Trenngel (10 %,15 ml)

 

SDS- Sammelgel (5 %, 5 ml)

 
 

7,15

ml

 

3,6

ml

H20

 

10

%

 

5

%

Acrylamid

 

0,38

M

  

-

Tris (pH 8,8)

 

-

  

0,125

M

Tris (pH 6,8)

 

0,1

%

 

0,1

%

SDS

 

0,1

%

 

0,1

%

APS

 

6

µl

 

5

µl

TEMED

Das Trenngel wurde bis 1 cm unterhalb des Kammendes gegossen und mit Wasser überschichtet. Nach der Polymerisierung des Trenngels wurde das Wasser abgekippt und das Sammelgel darüber gegossen.

Pro Ansatz wurden 30 µg Protein verwendet und die entsprechende Menge 4 x Probenpuffer hinzugegeben (Endkonzentration 1 x).

 

Probenpuffer

200

mM

Tris-HCl pH 6,8

  

400

mM

DTT

  

8

%

SDS

  

0,4

%

Bromphenolblau

  

40

%

Glyzerin

Die Proben wurden anschließend 5 min bei 95° C inkubiert und auf Eis abgekühlt. Das Gel wurde beladen und bei 80 V gestartet. Nachdem die Proben vollständig in das Trenngel eingelaufen waren, wurde die Spannung auf 150 V erhöht.

 

Laufpuffer

25

mM

Tris-Base

  

250

mM

Glyzerin

  

0,1

%

SDS, pH 8,3

8.4 „Blotten“ und Detektion

 

Transferpuffer

25

mM

Tris-Base

  

200

mM

Glyzerin

  

20

%

Methanol, pH 8,5

Die Membran (Milipore Immobilon-P, Amersham Pharmacia Biotech, Freiburg) wurde kurz in EtOH (100%, unvergällt) gespült und anschließend 10 min in Transferpuffer inkubiert. Das Gel wurde ebenfalls 10 min in Transferpuffer inkubiert. Das Blotten erfolgte in einem Semitrocken-Verfahren mit der Blottingapparatur von Hölzer GmbH (Dörfen). Dazu wurden der Reihenfolge nach zwei Lagen dickes, mit Transferpuffer getränktes Whatman-Papier (Schleicher & Schuell, Dassel), die [Seite 38↓]Membran, das Gel und nochmals getränktes Whatman-Papier auf die Apparatur gelegt und bei 15 mA für 1,5 Stunden geblottet.

Die Membran wurde anschließend kurz in PBST (PBS mit 0,05 % Tween 20) gespült und die Membran für 1 Stunde in 20 ml Blockierlösung (PBST mit 5 % Milchpulver) bei RT inkubiert, danach 3 x 5 min in PBST gewaschen und mit dem primären Antikörper in 15 ml PBST über Nacht bei 4 °C inkubiert (siehe Tabelle 6).

Am nächsten Tag wurde die Membran 3 x 5 min in PBST gewaschen und mit dem sekundären Antikörper in 15 ml PBST für eine Stunde bei Raumtemperatur inkubiert, dann 2 x 5 min in PBST gewaschen und weitere 2 x 5 min in PBS gewaschen. Der Nachweis erfolgte mit dem ECL-System (Western blotting detection reagents) und Hyperfilm ECL Film von Amersham nach Angaben des Herstellers.

8.5 Strippen, neue Antikörperbindung

 

Striplösung

62,5

mM

Tris-HCl

  

100

mM

Mercaptoethanol

  

2

%

SDS

Sollte auf der Membran ein zweites Protein nachgewiesen werden, wurde sie für 15 min bei 50 °C in Striplösung inkubiert, 3 x 5 min in PBST gewaschen, 30 min in Blockingpuffer blockiert und 3 x 5 min in PBST gewaschen. Die Detektion wurde wie oben beschrieben durchgeführt.

Tab. 6: Verwendete Antikörper

Name

Firma

Puffer

Verdünnung

Phospho-p44/42 MAP Kinase

Biolabs

PBST+5 %BSA

1:2000

p44/42 MAP Kinase

Biolabs

PBST+5 %BSA

1:2000

Phospho-p38

Biolabs

PBST+5% BSA

1:1000

Jak2

Santa Cruz

PBST+1% BSA+1% Milchpulver

1:200

Phospho-Stat-1

Biolabs

PBST+5% BSA

1:1000

Phospho-Stat-3

Biolabs

PBST+5% BSA

1:1000

JNK1

Santa Cruz

PBST+1% BSA+1%Milchpulver

1:200

8.6 p44/42-Kinase-Assay

Die p44/42-Kinaseaktivität wurde mit einem Messsystem von Amersham Pharmacia Biotech (Freiburg) nach modifizierten Herstellerangaben nachgewiesen. Die p44/42-Kinase katalysiert den γ-Phosphat-Transfer von Adenosin-5´-Triphosphat zu einem spezifischen Peptid. Durch die Bindung des Peptids an ein spezielles Filterpapier kann das nicht umgesetzte Phosphat abgetrennt werden. Detektiert wird die Radioaktivität des verwendeten Isotops 33P.

Pro Ansatz wurden 5 µg Protein mit Lysepuffer (Proteinisolierung und Lysepuffer siehe Western-Blot) auf 15 µl aufgefüllt, 10 µl Substrat, 5 µl kaltes ATP und 1 µCi (γ-33P)ATP (Amersham) [Seite 39↓]gemischt, bei 37 °C inkubiert und nach 30 min mit 10 µl Stopplösung abgestoppt. 30 µl des Ansatzes wurden auf das spezielle Filterpapier aufgebracht, erst 2 x 2 min in 1 %-iger Essigsäure, dann 2 x 2 min in A. bidest. gewaschen und im Szintillationszähler (Liquid Scintillation Counter, Raytest, Berlin) die Aktivität gemessen.

9 FACS-Messungen

Mit Hilfe von Fluorescence Activated Cell Sorter (FACS)-Analysen wurde in der vorliegenden Arbeit die Integration von Rezeptoren auf der Zelloberfläche nachgewiesen. Dabei bindet ein erster Ak spezifisch an den Rezeptor, an den ein zweiter, Fluorescein-Isothiocyanate (FITC)-markierter Ak bindet. Die Fluoreszenz jeder Zelle wird im FACS-Gerät gesondert gemessen, aufgrund der großen Anzahl erfasster Zellen sind statistisch gesicherte Aussagen leicht möglich.

9.1 Zellkultur und -stimulierung

Die Hepatomzellen wurden in einer Dichte von 0,5-1 x 105 Zellen/Loch in einer 24-Loch-Platte ausgesät und am nächsten Tag mit Zytokinen und Dex stimuliert.

9.2 Antikörperinkubation und Fixierung

1. Antikörper:Anti-human IL-6 R Antibody, Goat (R&D Systems, Wiesbaden)
oder Anti-human gp130 Antibody, Goat (R&D Systems, Wiesbaden)

2. Antikörper:FITC-conjugated Anti-Goat IgG, Rabbit (Jackson ImmunoResearch, West Baltimore Pike, USA)

Nach Abschluss der Stimulierung wurden die Zellen 2 x mit 0,5 ml FACS-Puffer (1 x PBS mit 5 % FCS) gewaschen und für 1 Stunde bei 37 °C mit dem 1. Ak inkubiert (0,5 µg/Loch in 200 µl FACS-Puffer). Anschließend wurden die Zellen nach zweimaligem Waschen ebenfalls für 1 Stunde mit dem zweiten, FITC-markierten AK inkubiert (1:25 in 200 µl FACS-Puffer). Dieser und folgende Schritte wurden aufgrund der Lichtempfindlichkeit von FITC lichtgeschützt durchgeführt. Nach der Ak-Inkubation wurden die Zellen nochmals zweimal gewaschen und in 0,5 ml/Loch Fixierpuffer (PBS, 0,5 % Formaldehyd) abgelöst und maximal 7 Tage bei 4 °C lichtgeschützt gelagert.

9.3 Messung und Auswertung

Die FACS-Messungen wurden mit einem FACS-Scan (Becton Dickinson, Heidelberg) und der zugehörigen Software (CellQuest, Becton Dickinson) durchgeführt. Da nur mit Hepatomzelllinien gearbeitet wurde, war keine Abgrenzung zu anderen Zellpopulationen nötig. Pro Ansatz wurde die Fluoreszenz von 50 000 Zellen gemessen und der Mittelwert berechnet. Die Versuche wurden mindestens dreimal wiederholt.


[Seite 40↓]

10  Auswertung und Darstellung der Ergebnisse

Alle dargestellten Ergebnisse zeigen Versuche, die mindestens dreimal erfolgreich durchgeführt wurden. Die Ergebnisse wurden, wenn nicht anders bemerkt, in den beiden Zelllinien HepG2 und HuH-7 durchgeführt und bestätigt. Wurden A-549 Zellen verwendet, ist ausdrücklich darauf hingewiesen.

Die Abbildungen aus EMSA und Western- und Northern-Blot wurden in dem Programm Adobe Photoshop D1-4.0 (Adobe Systems Inc., San Jose, USA) bearbeitet. Die Berechnung der Mittelwerte, der Mittelwertabweichungen und der Signifikanzen, sowie die graphische Darstellung der Ergebnisse wurden mit den Programmen Excel 97, Power Point 97 (Microsoft Corp., Redmond, USA) und SPSS für Windows 9.0 (SPSS Inc., Chicago, USA) durchgeführt. Wenn nicht anders vermerkt ist der MIttelwert +/- Mittelwertabweichung dargestellt. Die Ergebnisse wurden mit dem U-Test von Mann Whitney untersucht und Unterschiede mit weniger als 5 % Irrtumswahrscheinlichkeit (p < 0,05) wurden als signifikant betrachtet. In Abbildungen mit uneindeutigen Ergebnissen sind die signifikanten Ergebnisse markiert, soweit sie für die Aussage des Experiments relevant sind.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
20.10.2005