3 Ergebnisse

3.1  Quantifizierung klonaler Zellen in peripherem Blut von MF-Patienten

59

3.2 Sequenzierungsergebnisse

Bei 47 Patienten, die histologisch und klinisch gesichert an einer Mycosis fungoides erkrankt waren, konnte retrospektiv in der Haut mit den TCR-γ-Konsensusprimern ein monoklonales Amplifikat nachgewiesen werden. Bei 3 Patienten (GL, PL und WA) konnte in beiden Allelen ein monoklonales Amplifikat gezeigt werden, so dass insgesamt 50 DNA-Sequenzen ermittelt wurden (s. Tab. 7). Von allen ermittelten Sequenzen betrug die mittlere Länge der N-Region 6,8 Basenpaare (Bp) (Median 6 Bp, xmax=18 Bp; xmin = 0 Bp). Der GC-Anteil an den N-Sequenzen betrug im Mittel 56,3% (Median 60%, xmax=80%, xmin=16,6%). Die Segmente Vγ2 und Vγ8 waren mit 50 bzw. 18% überdurchschnittlich repräsentiert, in 88% der Fälle wurde ein Rearrangement der VγI-Familie, in 12% Rearrangements der Familien VγII - IV gefunden (s. Abbildung 3).

Abb. 3: Häufigkeit der Vg-Rearrangments

60

Von 6 Patienten konnte mit Hilfe der TCR-β-Konsensusprimer ein monoklonales Amplifikat nachgewiesen werden. Da bei einem Patienten in beiden Allelen ein monoklonales Amplifikat gezeigt wurde, konnten daraus 7 Sequenzen ermittelt werden (s. Tab. 6). Von den ermittelten DNA-Sequenzen betrug die mittlere Länge der N-Region 14 Basenpaare (Median 10 Bp, xmax=30 Bp; xmin= 5 Bp). Hier betrug der GC-Anteil durchschnittlich 66,1% (Median 71,4%, xmax=80%, xmin=46%).

Tab. 6: TCR-β-Sequenzen, N-Sequenzen sind unterstrichen

Pat.

Sequenz

N-Region (Bp)

GC-% insges.

Primer

Verlauf vorhand.

GL

Vb7s1 AGCCAAG (D2) CGG (N) AGAG CTCCTACGAG J2-7
Vb13s6 CCAGCAG CCCAGGGACTAGCGGGAGTTACA AGCAG Jb2s4

7
25

71
56

-
+

-
+

Vb22s1 cagtgaa caggc ctatggct Jb1s2

5

80

+

-

LO

Vb13s3 TGCCAGC GGGAC TGAGCAGTT J2S1

5

80

+

+

RA

Vb5s1 AGCTTGG GTGTCAGGAG GAACACTGAAG J1s1

10

60

+

-

ZO

Vb3S1 TTATAT GCGGTATGGCAGGGAGACTTCGAAAAAGTT CA J2S5

30

47

+

-

MA

Vb13s4 CAGCAG (N)CCCA(D2)GGGACTAGCGGG AGTTAC J2-4

16

75

-

3.2.1  Klonspezifische Primer

Es wurde versucht, für die patientenspezifischen TCR-Sequenzen spezifische Primer zu entwerfen.

61

Da für die N-Region von 11 Sequenzen mit einer Länge von 0 bis 2 Basenpaaren die Bildung eines spezifischen PCR-Produktes zwischen N-spezifischem Primer und DNA unwahrscheinlich war, wurde für diese auf die Entwicklung eines Primers verzichtet.

Für insgesamt 24 Sequenzen war das Design eines klonspezifischen Primers nicht möglich. Die N-Regionen dieser Sequenzen besassen im Mittel eine Länge von 6,5 Basenpaaren (Median 6 Bp; xmax= 18 Bp; xmin= 3 Bp). Der mittlere GC-Anteil betrug 54,3% (Median 60%, xmax= 80%, xmin= 16,6%). Davon zeigten von 5 Sequenzen die klonspezifischen Primer Schmelztemperaturunterschiede >10°C zu den Vγ-Primern. Die klonspezifischen Primer für 3 Sequenzen bildeten Primer-Dimere mit dG <-7,5 kcal/mol und mit einer Länge von mehr als 4 Basenpaaren, für eine Sequenz zeigten alle möglichen, klonspezifischen Primer falsche Bindungsstellen. Die Bildung von Haarnadelstrukturen war unbedeutend.

Tab. 7: TCR-γ-Sequenzen in Haut der MF-Patienten; N-Region ; + Primerdesign bzw. Verlauf möglich

Pat.

Sequenz

N-Reg.

GC-%
Insg.

Primer

Verl. vorhand.

Vg8CTGGGATAGG GTTGTAGT TATAAGAAAC Jg1

8

37,5

-

BE

Vg2CTGGGACGGG CGGTGGTACCAAC TATAAGAAAC Jg2

13

61,5

+

-

BN

Vg2CTGGGACGGG CCTGATGATTGGG TATAAGAAAC Jg1

13

54

+

-

BO

Vg3CTGGGACAGG CTCAGGT AATTATTATAAG Jg2

7

57

-

BR

Vg4ACTGTGCCAC CTATT GAATTATTAT Jg1

5

20

-

DE

Vg10TGCTGCGTGG GGAAGCATTAACGGGAG ATAAGAAACT Jg1

17

53

+

-

FI

vg2 ACCTGGGACG AGATACCGATAG ATAGTAGTG jgp2

12

42

+

+

FE

Vg3TCTATTACTG TGCCCCNGNG GAATGGTTATA Jg1

10

70

-

FR

Vg2CTGGGACGGG TATTATCAGA Jg2

0

-

0

GL

Vg5CCTGGGACAG AACA ATTATAAGAA Jg2
Vg2CACCTGGGAC AAAACA ATTATAAGAA Jg1

4
6

25
17

-
-

HA

Vg2CTGGGACGGG TACCTCGCCGGTAGGG TATTATAAGA Jg2

16

69

+

+

HE

Vg2CTGGGACGGG CTTGAGAC TATAAGAAAC Jg1

8

50

+

+

HEI

Vg2CTGGGACAGG CACC TTATAAGAAA Jg1

4

75

-

HN

Vg8CTGGGATAGG AAACTC GAATTATTAT Jg1

6

33

-

HT

Vg3TCTATTACTG TGCCCCTGTG GAATTATTAT Jg1

10

70

+

-

HR

Vg2CCCCTGGGAC TGG TATTATAAGA Jg1

3

66

-

HI

Vg2CCTGGGACGG TATTATAAGA Jg1

0

-

0

VG8CTGGGATAGG CCTTAGC AAGAAACTCT Jg1

8

50

-

HRY

Vg2CACCTGGGAG TGG TATTATAAGA Jg1

3

66

-

IV

Vg3CCACCTGGGA GCCTA ATAAGAAACT Jg1

5

60

+

-

JA

Vg2CCTGGGACGG GA TTATTATAAA Jg1

2

50

0

JE

Vg5 TGGGACAG ATCTCCCTGG AAGAAACTCTTT JG2

10

60

+

-

KR

Vg8CTGGGATAGG GCAAAACAC ACTCTTTGGC Jg1

9

44

-

LA

Vg2CTGGGATGGG CGAGG TATAAGAGAC Jg2

5

80

+

+

LE

Vg8CCTGGGATAG AA ATTATATAAG Jg1

2

0

0

LO

Vg2CTGGGACGGG CC TTATTATAAG Jg1

2

100

0

MH

Vg8CCACCTGGGA TGAGC AATTATTATA Jg1

5

60

-

ML

Vg5TTACTGTGCC CCTGTG GAATTATTAT Jg1

6

66

-

MN

Vg2CTGGGACGGG GGCGGATG GAAACTCCTT Jg1

8

75

-

ME

Vg2TGCCACCTGG AAATGT TATTATAAAA Jg1

6

17

-

MI

Vg8CACCTGGGAT G GAATTATTAT Jg1

1

100

0

MO

Vg2CTGGGACGGG TATTATAAGA Jg1

0

-

0

MR

Vg2CTGGGACGGG CC ATTATAATAA Jg1

2

100

0

OT

Vg2CTGGGACGGG CTTGAGAC TATAAGAAAC Jg1

8

50

+

-

PA

Vg8TGTGCCACTG TA GAATTATTAT Jg1

2

0

0

PL

Vg10TGCTGCGTGG GAGCC CCACTGGTTG JP1
Vg11ACTGTGCCTG CTGGATTAGAGTGGG CCACTGGTTG JP1

5
15

80
53

-
+

-

RA

Vg10TGCTGCGTGG GAGGGGT TTATTATAAG Jg1/2

7

71

-

RI

Vg11ACTGTGCCTGCTGGATTAGGCACGTGGAAAGAAACTC Jg2

18

56

-

SE

Vg2CCACCTGGGA TGAGCCGAACT ATTATTATAA Jg1

11

45

+

-

SU

Vg8ACTGTGCCAC TCTTTGGCAG Jg2

0

-

0

ST

Vg4GTGCCACCTG CCTC GAATTATTAT Jg1

4

75

-

VI

Vg2/7CACCTGGGAC AATGACCCCGGGT TAATTATTAT Jg2

13

62

+

-

WA

Vg2CACCTGGGAC TAAGC TATTATAAGA Jg1
Vg9CTGTGCCTTG TGGGAGGTG TAAGAAACTC Jg1

5

9

40
66

-
-

WU

Vg2CACCTGGGAC TGG TATTATAAGA Jg1

3

66

-

ZO

Vg2CTGGGACGGG CCTCACGG TTATTATAAG Jg1

8

75

+

+

ZR

Vg2CCTGGGACGG ATTATTATAA Jg1

0

-

0

ZW

Vg7ACCTGGGACA TTCCC CTGGTTGGTT JP1/2

5

60

-

JU

Vg8TGCCACCTGG AAATT TTATTATAAG Jg1
Vg11GTGCCTG TCAGATCCTCACAGGGCGGGTT TTAAGGC

5
22

0
59

+
0

62

Für 15 Patienten konnte ein klonspezifischer TCR-γ-Primer und für 5 Patienten ein klonspezifischer TCR-β-Primer entwickelt werden. Hier betrug die mittlere Länge der N-Sequenzen bei den TCR-γ-Sequenzen 11,2Bp (Median 11 Bp; xmax= 17Bp; xmin= 5 Bp) und 15 Bp (Median 10 Bp; xmax= 30Bp; xmin=5 Bp) bei den TCR-β-Sequenzen. Der GC-Anteil lag bei durchschnittlich 59,5% (Median 60%, xmax= 80%, xmin= 41,6%) für die γ-Sequenzen und 57% (Median 60%; xmax= 80%, xmin=50%) für die β-Sequenzen. Der GC-Anteil der letzten 5 Basenpaare am 3´-Ende der Primer lag für die TCR-γ-Primer durchschnittlich bei 40% (xmax=80%, xmin=0%), für die TCR-β-Primer bei 63% (xmax= 80%; xmin= 60%).

Es konnte nur für 15 von 49 (30,6 %) TCR-γ-Sequenzen ein klonspezifischer Primer etabliert werden. Von 7 TCR-β-Sequenzen konnte für 5 ein Primer entworfen werden, was einem Anteil von 71,4 % entspricht.

Tab. 8: Sequenzen der klonspezifischen Primer mit PCR-Bedingungen, Mg-Konz.: MgCl2-Konzentration

Name

Sequenz

Typ

Mg-Konz
( mmol).

Annealing
temp.

FI g

vg2 ACCTGGGACGAGATACCGATAGATAGTAGTGattggat jgp2
tctatggctatctatcatcact

gamma

4

62°C

HE g

Vg2 CTGGGACGGGCTTGAGA CTATAAGAAACTCTTTGG Jg 1/2
GAACTCTGATATTCTTTGAGAA

gamma

1,5

HA g

Vg2 CTGGGACGGGTACCTCGCCGGTAGGAAGAaactctttgg Jg2
gagcggccatccttcttt

gamma

2,5

58°C

GL b

Vb13s6 CCAGCAGCCCAGGGACTAGCGGGAGTTACAAGCAGTACT Jb2s4
tcgccctcaatgttcgtcatg

beta

4

62°C

LA g

Vg2CTGGGATGGGCGAGGTATAAGAGAC Jg2

gamma

1,5

58°C

ZO g

Vg2 CACCTGGGACGGATTATTATAAGAAACTCTTTGG Jg 1/2
CCTAATAATATTCTTTGAGA

gamma

2

LO b

Vb13s3 CTGTGCCAGCGGGACTGAGCAGTTcttcggcc J2S1
ctgactcgtcaagaagccgg

beta

4

70°C
2-Schritt

RA b

Vb5s1 AGCAGCTTGGGTGTCAGGAGGAACACTGAAGctatcttt J1s1
cagtcctccttgtgacttcga

beta

4

68°C
2-Schritt

ZO b

Vb3S1 TTTATATGCGGTATGGCAGGGAGACTTCGAAAAAGTTCA J2S5
ccataccgtccctctgaagct

beta

2,5

70°C
2-Schritt

3.2.2 Spezifität und Sensitivität der klonspezifischen PCR

63

Um die Spezifität der PCR zu erhöhen, wurde die MgCl2-Konzentration von 4 um jeweils 0,5mM bis minimal 1,5mM reduziert und, falls nicht ausreichend, die Annealingtemperatur um je 2°C erhöht, bis sich im Agarosegel ein PCR-Produkt nur in der gewünschten Probe mit der erwarteten Produktlänge darstellte. Die Primer und PCR-Bedingungen sind in Tab. 8) dargestellt.

Zur Spezifitätsprüfung wurden von zwei MF-Patienten Produkte aus der Konsensus-PCR kloniert. Es wurden 20 Klone aufgenommen, 14 von Patient ZO und 6 von Patient BÄ, und die DNA jedes Klons in zwei Fraktionen (A und B) aliquotiert. Fraktion A wurde in einer PCR mit dem für Patient ZO klonspezifischen Primer reamplifiziert. Da durch die Klonierung neben der Generierung von DNA mit dem klonalen auch die eines polyklonalen Rearrangements möglich war, wurden die Ergebnisse der klonspezifischen PCR mittels direkter Sequenzierung von Fraktion B überprüft. Beim Vergleich der Ergebnisse konnte in 18 von 20 Fällen (90%) eine Übereinstimmung festgestellt werden. In 2/20 Fällen zeigte die klonspezifische PCR ein positives Ergebnis, obwohl die monoklonale DNA bei der Sequenzierung nicht nachgewiesen wurde (Tab. 9).

Tab. 9: Spezifitäts-Nachweis: Klonspez. Primer Zl 1, Einzelzell-PCR- F.Z.Zellen 1,2,3,16,18, 20, 22-30 Zellen ohne Einzelzell-PCR-Produkt, Klon-spez.PCR negativ, *0,6 dNTP/2mM MgCl2

Zelle

Sequenz direkt

Klon

Klonspez. PCR °C

Sequenz kloniert

58

59

60

61

*58°C

4

CCTCACGG

1

+

+

+

+

+

5

CCTCACGG

1

+

+

+

+

+

6

CCTCACGG

1

+

+

+

10

CCTCACGG

1

+

11

CCTCACGG

1

+

+

+

12

TAAGGG

+

+

(+)

-

-

TAAGGG

13

AAAGAGGC

+

+

+

+

+

AAAGAGGC

14

CCTCACGG

1,2

+

+

+

CCTCACGG

TAAAGAGGCG

TAAAGAGGCG

19

CCtcaCGG

1,2

+

+

+

CCTCACGG

TAAAGAGGCG

TAAAGAGGCG

36

TAAAGAGG

-

-

42

CGA

-

-

44

CA

-

-

45

CCTTC

-

-

46

CAGGAaTTT

-

-

55

CAGGCCTC

-

-

-

56

CAGGCCTC

(+)

-

+

x

57

C

+

-

x

58

CAGTGGAAC

-

-

59

TTGG

-

-

17

1,2

+

CCTCACGG

TAAAGAGGCG

64

Um die Sensitivität der klonspezifischen PCR zu prüfen, wurde für die Jurkat-Zelllinie ein spezifischer Primer entwickelt. Mit Hilfe einer 10fach-Verdünnungsreihe von Jurkat-DNA in aus PBMC eines gesunden Probanden gewonnener DNA konnte ein spezifisches Produkt bis zu einer Verdünnung von 10 Zellen in 106 Zellen, also 1 klonale in 105 polyklonalen Zellen als Hintergrund nachgewiesen werden (siehe Abbildung 4).

Abb. 4: Klonale Jurkat-Zellen vor polyklonalem Hintergrund in oben angegebener Verdünnung, H2O: Negativprobe; Marker: Hinc III Lambda; klonspezifischer Primer: Ju

3.2.3 Detektion zirkulierender, klonaler Zellen im Verlauf

Von 5 Patienten, für die ein klonspezifischer Primer entworfen werden konnte, waren mehr als 5 Blutproben im Verlauf vorhanden. Diese Blutproben wurden in einer klonspezifischen PCR quantifiziert.

65

Bei 4 Patienten konnte mit Hilfe der klonspezifischen Primer die klonale Sequenz aus der Haut auch in den Blutproben detektiert werden.

1. Bei Patient FI (s. Tab. 10) wurden 11 Blutproben aus einem Zeitraum von 53 Monaten untersucht. Mittels PCR mit Konsensusprimern konnte in keiner der Proben ein monoklonales Amplifikat gefunden werden, mittels klonspezifischer PCR neben der Blutprobe bei Erstdiagnose 02/1997 in neun weiteren Proben. Zum Zeitpunkt der kompletten Remission 05/1997 war die Detektion des monoklonalen Rearrangements im Blut nicht möglich.

Tab. 10: Patient FI: Ergebnisse der Routine-PCR, klonspezifischen PCR und Quantifizierung im LightCycler im Vergleich. PCR-TGGE: Ergebnisse der Routine-PCR mit TGGE, poly: polyklonal, mono: monoklonal, bi: biklonal; sq TuZ: semiquantitative Abschätzung im Agarosegel nach klonspez. PCR, Grad 0 bis +++; % TuZ: im LightCycler bestimmter Anteil an Tumorzellen im Blut, Therapie: bis zur Blutabnahme erhaltene Therapie

Number

R-Nr

PCR-TGGE

Sq. TuZ

% TuZ

Verlauf

Therapie

02/97

5611

poly

+

0,000

TNM IIa

0

05/97

5867

poly

0

1,860

Regredienz

PUVA / IFN / Steroid

08/97

6142

poly

+

0,780

komplette Remission

dto.

01/98

6617

poly

(+)

2,135

dto.

0

07/98

7371

poly

+

0,000

Rezidiv

0

11/98

7869

poly

+

8,800

komplette Remission

Steroid

03/99

8332

poly

+

2,088

Rezidiv

PUVA

12/99

9521

poly

+

5,245

Rezidiv

Steroid

04/00

10464

poly

+

0,905

Progressive Disease

Steroid

04/01

20413

poly

+

1,530

komplette Remission

0

07/01

20865

poly

+

1,113

Rezidiv

0

66

2. Bei Patient GL (s. Tab. 11) wurden 17 Blutproben aus einem Zeitraum von 38 Monaten getestet. Mittels Konsensusprimern konnte in 4, mittels klonspezifischer PCR in 12 Proben ein monoklonales Rearrangement ermittelt werden. Von der Erstdiagnose 12/1997 bis 01/1999 konnte mit Ausnahme vom Mai 1998 während progredienter Erkrankung durch keine der Methoden ein monoklonales Amplifikat gezeigt werden, im Mai 1998 war mittels klonspezifischer PCR ein monoklonales Rearrangement detektierbar. Ab 02/1999 bis 05/1999 war nur mit Hilfe der klonspezifischen Methode Monoklonalität, ab 10/1999 waren auch mit den Konsensusprimern ein mono- bzw. biklonales Amplifikat sowohl im Tumorstadium als auch während Remission nachweisbar.

3. Bei Patient LO (s. Tab. 12) wurden über einen Zeitraum von 43 Monaten 14 Blutproben untersucht, wobei in keiner der Proben mit Hilfe der Konsensusprimer ein monoklonales Amplifikat gezeigt werden konnte. Neben der Erstdiagnose 11/1997 konnte mittels klonspezifischer PCR in neun weiteren Proben das klonale Rearrangement bei sowohl re- als auch progredienter Erkrankung nachgewiesen werden.

4. Bei Patient ZO (s. Tab. 13) wurden 10 Proben über eine Zeit von 17 Monaten überprüft, in zwei Proben wurde mit Hilfe der Konsensusprimer ein monoklonales Amplifikat nachgewiesen. Neben der Erstdiagnose 12/1997 wurde mittels klonspezifischer PCR in den 4 weiteren Blutproben bis 01/1999 das klonale Rearrangement gezeigt, in den übrigen war dies nicht möglich.

67

Mit Hilfe der PCR mit Konsensusprimern wurde bei den 4 Patienten nur in 6/52 Blutproben die klonale Sequenz nachgewiesen, mit den klonspezifischen Primern war dies in 39/52 dieser Fälle möglich (siehe Tabelle 10,11 und 12). Bei den letztgenannten konnte eine Verlaufskontrolle der im Blut zirkulierenden klonalen Zellen mittels Real time-PCR vorgenommen werden.

In den Blutproben von Patient RA konnte die β-Sequenz aus der Haut nur bei Erstdiagnose nachgewiesen werden. In den restlichen Blutproben war die Sequenz mit den klonspezifischen Primern nicht nachweisbar und somit eine Quantifizierung im Verlauf nicht möglich.

3.2.4 Quantifizierung

Die Produktmenge der klonspezifischen PCR wurde im Agarosegel mittels einer Einteilung von null über „+“ bis „+++“, d.h. von wenig über mittel bis viel Produkt semiquantitativ abgeschätzt.

68

  1. Bei Patient FI (siehe Tab. 10) wurde im Agarosegel im Verlauf null bis + PCR-Produkt gesehen. + PCR-Produkt war in neun Proben sowohl während pro- als auch regredienter Erkrankung nachweisbar, zum Zeitpunkt der klinischen Remission 05/1997 konnte null und bei stabiler Remission 01/1998 nur + Produkt ermittelt werden.
  2. Bei Patient GL (siehe Tab. 11) war zwischen null und +++ Produkt sichtbar. Mit Ausnahme von 05/1998 mit + PCR-Produkt konnte bei progredienter Erkrankung das monoklonale Rearrangement mit Hilfe des klonspezifischen Primers bis 01/1999 nicht und ab 02/1999 mit einer Menge von ++ nachgewiesen werden. Die Menge stieg 12/1999 während Rückbildung der kutanen Tumoren weiter an. Von 11/2000 bis 02/2001 schwankten bei kompletter, klinischer Remission die Produktmengen im Agarosegel zwischen einer Intensität von +++ und + .
  3. Bei Patient LO (siehe Tab. 12) veränderte sich die Produktquantität im Verlauf zwischen nicht nachweisbarer und mittlerer Menge. Nach Erstdiagnose 11/1997 sank sie während kompletter Remission auf null, um während eines Rezidivs 03/1999 und partieller Remission 10/1999 auf eine Menge von ++ anzusteigen. Während progressiver Erkrankung fiel die Produktmenge auf + bis null, zum Ende der Progression 02/2001 und während klinischer Remission 04/2001 stieg sie wieder auf ein Niveau von ++.
  4. Bei Patient ZO (siehe Tab. 13) bewegten sich die Produktmengen im Verlauf zwischen + bis null. Von dem Zeitpunkt der Erstdiagnose 12/1997 bis 01/1999 war im Agarosegel (+) bis + Produkt, ab 01/1999 kein Produkt mehr eruierbar.

Tab. 11: Patient GL: Ergebnisse Routine-PCR, klonspezifische PCR und Quantifizierung im LightCycler im Vergleich. Erläuterungen siehe Tab. 10

Datum

Name

PCR-TGGE

Sq. TuZ

% TuZ

Klinik

Therapie

12/97

6422

poly

0

0,8

TNM IIB

PUVA/IFN

05/98

7144

poly

+

0

Progressive Disease

PUVA/IFN

10/98

7625

poly

0

0,0

Lk pos.

Retinoide/PUVA/IFN

11/98

7829

poly

0

0,0

Progressive Disease

HC-Vakzination

01/99

8062

poly

0

0,0

dto.

dto.

01/99

8158

poly

0

3,0

dto.

dto.

02/99

8261

poly

++

2,2

dto.

dto.

03/99

8394

poly

++

4,7

dto.

dto.

04/99

8513

poly

++

3,6

dto.

dto.

05/99

8592

poly

++

5,6

dto.

ECP/PUVA

10/99

9282

mono

++

5,1

dto.

MTX

12/99

9463

bi

+++

29,5

T3↓/ T1/2↑

MTX

01/00

10029

poly

+

5,2

T3↑

PUVA

03/00

10246

poly

+

0,0

MTX

11/00

11103

bi

+++

91,1

Kompl. klin. Remission

MTX / Targretin

01/01

20036

poly

+

21,0

dto.

0

02/01

20187

bi

++

8,0

dto.

0

Bei 3 MF-Patienten konnte im LightCycler mittels Real time-PCR mit SYBR Green eine quantitative Verlaufsbeobachtung der klonalen, im Blut zirkulierenden Zellen durchgeführt werden.

69

  1. Bei Patient FI konnte in 9 Blutproben mittels Real time-PCR ein Anteil klonaler Rearrangements von 0,78 bis 8,8% bei einer mittleren Standardabweichung von 42,1% (xmin=20,5%, xmax=112,0%) gefunden werden (s. Abb. 12).
  2. Bei Patient GL wurde in 12 Proben über einen Zeitraum von 38 Monaten zwischen 0,8 und 91,1% klonale Rearrangements bei einer mittleren Standardabweichung von 32,9% (xmin=1,0%; xmax=72,1%) eruiert (s. Abb. 10).
  3. In 9/14 Blutproben über einen Zeitraum von 36 Monaten wurden bei Patient LO monoklonale Rearrangements mit einem Anteil zwischen 1,4 und 6,5% nachgewiesen, hier betrug die mittlere Standardabweichung 38,6% (xmin= 3,4%; xmax= 110,0%) (s. Abb. 11).
  4. Bei Patient ZO (siehe Tab. 13), bei dem in 5 Blutproben das klonale Rearrangement aus der Haut mit klonspezifischer PCR und Auftrennung im Agarosegel nachgewiesen werden konnte, war die klonale DNA mit Hilfe des LightCyclers nicht darstellbar und quantifizierbar.

Tab. 12: Patient LO: Vergleich der Ergebnisse der Routine-PCR mit denen der klonspezifischen PCR und Quantifizierung im LightCycler. Erläuterungen s. Tabelle 10

Datum

Name

PCR-TGGE

Sq. TuZ

% TuZ/TZ

Klinik

Therapie

11/97

6340

poly

+

0

TNM IIB

PUVA/IFN

06/98

7230

poly

0

1,5

kompl. Remission

PUVA/IFN

03/99

8351

poly

++

2,9

Rezidiv

PUVA

10/99

9276

poly

++

1,4

part. Remission

PUVA

11/99

9391

poly

+

0,0

Rezidiv

0

02/00

10207

poly

++

4,4

progr. Disease

Steroid

07/00

10772

poly

0

0,0

dto.

Steroid

08/00

10861

poly

0

0,0

dto.

Hybridzell-Vakzination

09/00

10945

poly

+

4,3

dto.

dto.

10/00

11055

poly

0

0

dto.

dto.

11/00

11132

poly

+

5,0

dto.

dto.

02/01

20183

poly

++

4,6

dto.

PUVA/IFN

04/01

20400

poly

++

2,9

kompl. Remission

PUVA/IFN

06/01

20729

poly

++

6,5

Rezidiv

0

70

Fasst man die Ergebnisse der Real time-PCR zusammen, stellt man bei den 3 Patienten, für die eine Quantifizierung durchgeführt wurde, fest, dass sich der Anteil klonaler Zellen im Blut im Verlauf der Erkrankung ändert, bei den Patienten FI und LO maximal um den Faktor 10, bei Patient GL um den Faktor 100. Die mit Hilfe von Mehrfachbestimmungen erhaltenen Werte variieren mit einer mittleren Standardabweichung von 36,8% (xmin=0,96%, xmax=112,03%). Im LightCycler konnten Standardverdünnungen bis 103 Kopien/µl spezifisch detektiert werden. Mit Hilfe der Schmelzkurvenanalyse waren bei den Patienten FI und LO neben dem Peak der spezifischen Produkte ein Peak von unspezifischen Produkten nicht nachweisbar (s. Abb. 6). Da der β-Primer für GL unspezifische Produkte mit einem Peak bei 81°C in grosser Menge bildete (s. Abb. 8), wurde die Messtemperatur auf 83°C erhöht. Keine der Negativproben zeigte ein unspezifisches Produkt (s. Abb. 5).

Abb. 5: Klonspezifische Real time–PCR Patient LO; Schwarz: Standard in zunehmender Verdünnung 1:10, mittelgrau: Blutproben LO; hellgrau: Negativproben

71

Abb. 6: Schmelzkurvenanalyse nach klonspezifischer PCR mit Blutprobe des Pat. FI im LightCycler

In 37/52 Proben stimmten die Ergebnisse der klonspezifischen PCR im Agarosegel und der LightCycler-PCR überein: In 11/52 Fällen konnte weder mittels klonspezifischer PCR und Auftrennung im Agarosegel noch mittels LightCycler-PCR, in 26/52 Blutproben konnte mit Hilfe beider Methoden die klonale Sequenz detektiert werden. In 15 Fällen divergierten die Ergebnisse zwischen beiden Methoden. Die klonale Sequenz war in 11 Blutproben trotz Nachweises mittels Agarosegels durch die LightCycler-PCR nicht detektierbar, bei diesen war im Agarosegel immer eine Produktmenge von + bis (+) sichtbar. Bei 4/52 Proben war dies umgekehrt, hier wurden mittels LightCycler-PCR klonale Rearrangements mit einem Anteil von 0,5 bis 3,0% ermittelt (siehe Tabelle 10, 11 und 12).

Schätzt man den Anteil der klonalen Zellen im Blut semiquantitativ anhand der Bandenstärke im Agarosegel ab, stimmen 21/26 Blutproben mit den mittels Quantifizierung im LightCycler erhaltenen Daten überein, bei 5 Proben war der im LightCycler gemessene Anteil höher als im Agarosegel veranschlagt.

72

Tab. 13: Patient ZO, Vergleich Ergebnisse der Routine-PCR mit klonspezifischer PCR und LightCycler-Quantifizierung. (Erläuterungen siehe Tabelle 10)

Datum

Name

PCR-TGGE

Sq. TuZ

% TuZ

Verlauf

Therapie

12/97

8711

poly

(+)

0

TNM Ia

Externa

05/98

9190

mono

(+)

0

Regredienz/
Remission

Externa

10/98

9570

poly

+

0

Neue Plaques

Interferon / Bade-PUVA

11/98

10302

poly

(+)

0

Inkompl. Remission

dto

01/99

10378

poly

(+)

0

dto.

Externa

01/99

10490

poly

0

0

dto

dto

02/99

20058

mono

0

0

3 Plaques

Cortisonsalbe

03/99

20978

poly

0

0

dto

dto

04/99

347/02

poly

0

0

dto

dto

05/99

348/02

poly

0

0

Knotenbildg.

Externa

Bei Patient GL (s. Abb. 10) war der im LightCycler bestimmte Ausgangswert der zirkulierenden, klonalen Zellen 12/1997 während progredienter Erkrankung unter PUVA/Interferontherapie mit 0,8% niedrig und sank 10/1998 weiter auf 0% ab, zeitgleich mit dem Auftreten einer Lymphadenopathie. Im Anschluss kam es unter Hybridzellvakzinierung und Therapie mit extrakorporaler Photophorese und PUVA zu einem Anstieg der klonalen Zellen im Blut von 02/1999 bis 05/1999 bis auf 5,6%. Während einer MTX-induzierten Rückbildung der kutanen Tumoren 11/1999 kam es zu einem weiteren Anstieg auf 29,5%, während zum Zeitpunkt einer erneuten Progredienz 01/2000 der Anteil der klonalen Zellen auf 5,2% abfiel. Unter einer weiteren Methotrexattherapie kam es zunächst zu einem Abfall der zirkulierenden, klonalen Zellen auf 0%, während einer kompletten, klinischen Remission 11/2000 stiegen sie auf den Maximalwert von 91% an. Bei stabiler, klinischer Remission sank der Anteil der zirkulierenden Tumorzellen im weiteren Verlauf ab, der Patient verstarb 08/2001 an einer Sepsis mit 8% klonalen Zellen im Blut.

Bei Patient LO (s. Abb. 11) zeigten zwei zum Zeitpunkt der Remission 06/1998 nach PUVA/Interferon-Therapie und 03/1999 unter PUVA-Therapie entnommene Blutproben mit 1,4 und 2,9% nur einen geringen Unterschied der zirkulierenden klonalen Zellen. Während eines erneuten Rezidivs 12/1999 war das klonale Rearrangement im Blut nicht nachweisbar. Der Anteil stieg ab 03/2000 bis 03/2001 an, im gleichen Zeitraum war die Erkrankung progredient. Eine Ausnahme bildete die Zeit der Hybridzellvakzinierung, hier kam es zur Rückbildung eines Tumorknotens und zeitgleich zum Auftreten erneuter kutaner Manifestationen, klonale Zellen im Blut waren jedoch nicht mehr nachweisbar. Ihr Anteil stieg später unter PUVA-Therapie wieder auf 4,6%. Eine komplette, klinische Remission 03/2001 und ein späteres Rezidiv 05/2001 brachten nach einer leichten Abnahme einen maximalen Anstieg auf 6,5% klonale Zellen im Blut.

73

Bei Patient FI (s. Abb. 12) konnten im Blut während eines Rezidivs 02/1997 keine klonalen Zellen nachgewiesen werden, während klinischer Remission unter PUVA- und Interferontherapie stieg der Anteil zirkulierender, klonaler Zellen auf 2 bzw. 1% an und blieb während der kompletten Remission 01/1998 auf diesem Niveau. Zum Zeitpunkt eines erneuten Rezidivs 07/1998 waren die klonalen Zellen wiederum im Blut nicht nachweisbar, um während einer kompletten Remission unter Steroidtherapie 11/1998 auf den Maximalwert von 9% anzusteigen und während des nächsten Rezidivs 4/1999 wieder auf 2% zu fallen. Auch während des darauffolgenden Rezidivs 12/1999 sank der Anteil der im Blut vorhandenen monoklonalen T-Zellen trotz progredienten Krankheitsbildes 04/2000, blieb aber während der folgenden Remission 04/2001 und einem Rezidiv 07/2001 auf dem gleichen Niveau.

Betrachtet man bei Patient GL (s. Tab. 11 und Abb. 10) das Absinken der Tumorlast im Blut trotz Zunahme der Hauttumoren zwischen 12/1999 und 03/2000 und das klinische Bild einer kompletten Remission trotz maximalen Anteils an klonalen Zellen im Blut 11/2000, wird die Tendenz sichtbar, dass die Frequenz der klonalen Zellen im Blut bei Verbesserung des Hautbildes ansteigt und bei Verschlechterung absinkt. Ein weiteres Beispiel dafür ist Patient FI (s. Tab. 10 und Abb. 12), bei dem während der zwei Rezidive zu Beginn keine klonalen Zellen im Blut nachweisbar sind, während der Remissionen der Anteil der Tumorzellen aber ansteigt. Der maximale Anteil an klonalen Zellen zum Zeitpunkt einer kompletten Remission 10/1998 und ein Absinken des Anteils während des Rezidivs 04/1999 ist ein zusätzliches Beispiel. Bemerkenswert ist eine indirekte Korrelation von klinischem Bild und Anteil an zirkulierenden, klonalen Zellen nicht nur während den Phasen topischer Therapie, z.B. bei FI zwischen 07/1998 und 10/1998, sondern auch während der Applikation systemischer Therapieformen, z.B. die Chemotherapien mit MTX bei GL 09/1999 bis 12/1999 und 01/2000 bis 11/2000 und die Hybridzellvakzinierung 12/1998 bis 04/1999 beim gleichen Patienten.

Anders verhält es sich bei Patient LO (s. Tab. 12 und Abb. 11). Vergleicht man die Werte zum Zeitpunkt der kompletten Remissionen mit denen während der Rezidive, ist der Anteil der klonalen Zellen zum letztgenannten Zeitpunkt höher, was im Gegensatz zur vorher festgestellten Tendenz steht.

74

Werden die quantitativen Werte in Bezug zu klinischem Verlauf und Therapie gesetzt, lässt sich aber aufgrund der geringen Variation der Werte im Verlauf und der grossen Standardabweichungen höchstens eine Tendenz, jedoch keine sichere Korrelation feststellen.

3.3 TCR-Klonalität bei Patienten mit SPP

3.3.1  Nachweis klonaler Zellen in Blut- bzw. Hautproben

Von 14 Patienten mit histologisch und klinisch gesicherter SPP wurden sowohl Haut- als auch Blutproben bei Erstdiagnose und vor Therapie retrospektiv mittels TCRγ-PCR-TGGE-Assays untersucht. Bei 9/14 Patienten konnte damit im Blut ein monoklonales Amplifikat nachgewiesen werden. In der Haut war bei keinem der Patienten Monoklonalität nachweisbar.

3.3.2 Sequenzierung und Entwicklung klonspezifischer Primer

Das monoklonale TCR-γ-Rearrangement im Blut der 9 SPP-Fälle wurde sequenziert. Die N-Sequenzen aller Blutklone zeigten dabei eine mittlere Länge von 10,2 Bp (xmin= 2 Bp, xmax = 22 Bp), im Gegensatz zu 6,8 Basenpaaren bei den MF-Patienten. Der GC-Anteil betrug im Mittel 57,9% (Median= 57,8%; xmin= 0%; xmax= 100%).

75

Ein überdurchschnittlich häufiges Rearrangement wurde mit 44% für Vγ2 und mit 22 bzw. 33% für Vγ10 und 11 gesehen, VγII-IV wurden mit 55% häufiger als bei den MF-Patienten (13) rearrangiert (12%).

Für 6 Patienten war die Entwicklung eines N-spezifischen Primers möglich (siehe Tab. 14). Hier lag die Länge der N-Sequenzen im Mittel bei 14 Basenpaaren, der GC-Anteil bei 64,3% (Median= 61,3%, xmin= 41,6%, xmax= 100%). Für Patient BC und CZ wurde wegen einer N-Sequenz von 1 bzw. 3 Basenpaaren auf die Entwicklung eines Primers verzichtet. Die für die Patienten HL und HO entworfenen Primer waren nicht spezifisch, hier betrug die mittlere Länge der N-Sequenz 4,5 Bp, der GC-Anteil 23,1%.

3.3.3 Ergebnisse der klonspezifischen PCR in Haut- und Blutproben

Pro Patient wurden bei Erstdiagnose eine Haut- und Blutprobe und während des Follow-ups von 18 bis 47 Monaten 1 bis 8 weitere Blutproben entnommen.

76

Mit Hilfe der klonspezifischen Primer konnte das monoklonale Rearrangement in allen Blutproben der Patienten nachgewiesen werden. Anhand der PCR mit Konsensusprimern war dies nur in 18/20 Fällen möglich gewesen.

Bei keinem der 6 SPP-Patienten gelang es, die monoklonale Sequenz aus dem Blut auch in der Haut nachzuweisen (s. Abb. 7).

Obwohl das PCR-Produkt nochmals in einer geschachtelten PCR mit V seq und dem N-spezifischen Primer eingesetzt wurde, blieb ein Nachweis des monoklonalen Rearrangements in den Hautläsionen negativ (siehe Tab. 14).

77

Abb. 7: PCR mit klonspez. Primer BE; Marker: Hinc III Lambda; H2O: Negativprobe; Blut 1: diagnostische Blutprobe; Blut 2: zweite Blutprobe BE; Haut 1: Hautprobe BE; Haut 2: Hautprobe 1 nach nested PCR

Zur Beurteilung des Nachweises zirkulierender, klonaler Zellen bei SPP-Patienten ist eine Unterscheidung zwischen reaktiven und malignen Zellen notwendig. Zwar konnten in einigen MF-Fällen auch CD8+ Zellen als klonal proliferierend nachgewiesen werden, jedoch in der Mehrzahl der Fälle ist die maligne Zellfraktion bei MF CD4+ (92). Ausserdem konnte von Posnett et al. (84) die Entwicklung von Klonen bei CD8-positiven T-Zellen auch bei gesunden Probanden gezeigt werden. Deshalb wurden bei den Patienten SZ und HO die im Blut vorhandenen T-Zellen nach CD4/CD8-Expression sortiert, aus diesen Zellen DNA extrahiert und mit den klonspezifischen Primern untersucht. Bei beiden Patienten zeigte sich, dass die klonalen Zellen der CD4+ Fraktion zuzuordnen sind.

Tab. 14: Sequenzen und Ergebnisse der klonspezifischen PCR der SPP-Patienten

ID

TCRγ PCR

klonspezifische PCR

Follow-up d

Haut

Blut

Klonale TCRγ-Sequenz und
klonspezifischer Primer a

Annealing temp.

Blut

Haut

Haut nestedb

CD4+ c

CD8+ c

TCRγ PCR

klonspezifische PCR

1

Wo

p

p

0/2

2

Kl

p

p

0/1

3

p

p

0/3

4

We

p

p

0/1

5

Sn

p

p

0/8

6

Cz

p

m

Vg2- TGGGCAAATTA -Jg1

3/3

7

Be

p

m

Vg11- GCTGGATTAGGTGGGGCGAGTGGAG -Jg2
BE-1 CTAATCCACCCCGCTCAC

64°C

+

-

-

3/3

3/3

8

Bc

p

m

Vg2- ACGGCTATA -Jg2

3/3

9

Hl

p

m

Vg10- GTGGGAGCTGATATTATAAGAAA -Jg1
HL-1 CTCGACTATAATATTCTTT

61°C

ns

8/8

10

Ho

p

m

Vg2- GGGTTAAAATTATTATAAGAAACTC -Jg2
HO-1 CAATTTTAATAATATTCTTTGAG

61°C

ns

Vg2- CACCCATTCAGGGTAAGGGCAGT -Jg2
HO-2 TAAGTCCCAGGCCCGTCA

60°C

++

-

-

+

-

6/7

7/7

11

Me

p

m

Vg2- CAGGCCCCATTATAAGAAACACTTTG -Jg2
ME-1 GGGTAATATTCTTTGTGAAAC

60°C

+

-

-

3/4

4/4

12

Ri

p

m

Vg11- GCTGGATTAGGCACGTGGAAAGAAA -Jg2
RI-1 CTAATCCGTGCACCTTTC

62°C

++

-

-

1/1

1/1

13

Sf

p

m

Vg10- GTGGGCCTAACCCATATACCACTG -Jg2
SF-1 GGATTGGGTATATGGTGAC

63°C

++

-

-

1/1

1/1

14

Sz

p

m

Vg10- GTGGGATGGGTGAGGGGCAACATT -Jg1
SZ-1 CTACCCACTCCCCGTTGTAA

63°C

++

-

-

+

-

4/4

4/4

JM e

Vg8- GAAATTTTATTATAAGAAACTCTTTGG -Jg2
JU-5 CTTTAAAATAATATTCAAAGTG

60°C

Vg11-GTCAGATCCTCACAGGGCGGGTTTAAG -Jg1

Σ

0/14

9/14

6/9

0/6

0/6

32/49

20/20


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
08.11.2006