[Seite 23↓]

3  Ergebnisse

3.1 Erstellung einer CA/GT-Mikrosatelliten-Bibliothek

Mikrosatelliten seien im weiteren definiert als Dinukleotidrepeats von mindestens 16 Bp Länge, Trinukleotidrepeats von mindestens 12 Bp Länge und aus nicht mehr als zwei verschiedenen Elementen zusammengesetzte (‚imperfekte’) Mikrosatelliten (Weber 1993) von insgesamt 30 Bp Länge. Im Falle der unten beschriebenen Artefaktbildung gilt als Mikrosatellit ein abgeschnittener Dinukleotidrepeat von mindestens 10 Bp Restlänge.

Es wurden vier Genbibliotheken erstellt, bei denen jeweils die Anreicherung mittels Dynabeads modifiziert wurde. So wurde im ersten Durchgang mit 5’-biotinylierten Oligonukleotiden hybridisiert. Bei der darauf folgenden PCR fungierten (GT)10-Oligonukleotidreste mit freiem 3’-Ende als Primer, was eine Verkürzung der Mikrosatelliten enthaltenden Fragmente zur Folge hatte (Koblízková 1998). Bei den so erhaltenen 17 positiven Sequenzen lagen die gesuchten repetitiven Sequenzen immer an einem Ende der klonierten Sequenz, so dass die Entwicklung von Primerpaaren nicht möglich war.

Um diese Artefaktbildung zu vermeiden, wurde im zweiten Durchgang die angereicherte DNS, statt sie mit biotinylierten Oligonukleotiden und Dynabeads zusammen als Suspension dem PCR-Ansatz beizufügen (Abb. 5, PCR1), zunächst von den an die Dynabeads gebundenen Oligonukleotiden durch Hitzedenaturierung eluiert. Das Eluat wurde danach mittels PCR-Aufreinigungskit (Qiagen) von eventuellen Primerrückständen befreit. Dieses Vorgehen führte jedoch ebenfalls bei immerhin 22 von 26 auf Mikrosatelliten positiven Klonen zur oben beschriebenen Artefaktbildung.

Im dritten Durchgang wurde das Oligonukleotid am 5’-Ende biotinyliert und am 3’-Ende durch ein angehängtes Phosphat blockiert. Im vierten Durchgang wurde die Biotinylierung am 3’-Ende vorgenommen. In beiden Fällen wurde eine Artefaktbildung wie oben beschrieben vollständig verhindert. Durchgang 4 lieferte die Sequenzen für zehn der 15 in Tab. 3 aufgeführten Primerpaare.


[Seite 24↓]

Die Effizienz der Anreicherung ist stark von der Hybridisierungstemperatur Thyb abhängig. In Durchgang 1 bis 3 wurde mit Thyb=60°C, in Durchgang 4 dagegen mit Thyb=55°C hybridisiert. Im ersten Durchgang enthielten 9,8%, im zweiten Durchgang 14,4% und im dritten Durchgang 9,1% aller untersuchten Kolonien Mikrosatellitensequenzen im Sinne der oben aufgeführten Definition. Dagegen konnten im vierten Durchgang 49,5% positive Klone identifiziert werden (Tab. 2).

Tab. 2: Anteil an positiven Kolonien und Redundanzen (* davon Artefakte)

Durchgang

Thyb

Kolonien

Redundanzen

untersucht

sequenziert

positiv

1

60°C

173

17

17/17*

0

2

60°C

181

43

26/22*

0

3

60°C

690

63

11

7

4

55°C

101

59

50

18

Weiterhin wurde versucht, eine PCR-Amplifikation vor der Anreicherung durchzuführen (Abb. 5, PCR2a), die DNS nach Anreicherung von den Beads zu eluieren (2.2.4), das Eluat mittels spin column (Millipore) aufzukonzentrieren und dann ohne weitere Amplifikation (Abb. 5, gestrichelte Linie) in den Vektor zu ligieren. Dies führte in allen 84 untersuchten Kolonien zu einer direkten Ligation der beiden Vektorenden (Vektor-T-Vektor). Da vor der Ligation die Konzentration der DNS photometrisch gemessen und als ausreichend befunden wurde, muss davon ausgegangen werden, dass der instabile A-Überhang durch die Taq-Polymerase durch den Anreicherungsschritt beseitigt wurde.

Es konnte aber gezeigt werden, dass durch die Amplifikation vor der Anreicherung (Abb. 5, PCR2a) genug Material für diverse Anreicherungsschritte gewonnen werden kann. So kann nach einmaliger Digestion, Adaptorligation, Größenselektion und zusätzlicher PCR (Abb. 5, PCR2a) mit mehreren Oligonukleotiden unterschiedlicher Mikrosatellitensequenzen angereichert werden. Nach einer weiteren Amplifikation (Abb. 5, PCR2b) und Ligation in den Vektor erhält man ausreichend viele Fragmente unterschiedlicher Länge innerhalb des zu erwartenden Größenintervalls (400-1000 Bp plus Länge der beiden mitamplifizierten Vektorstücke).


[Seite 25↓]

Abb. 5: Fließschema: Anlegen der angereicherten genetischen Bibliothek

Beim Durchsuchen der Bibliothek auf Mikrosatellitensequenzen mittels Kolonie-PCR mit (AC)10-Oligonukleotid (2.3) zeigte sich bei Mikrosatelliten enthaltenden Kolonien statt einer starken Bande zwei etwas schwächere Banden (Abb. 6). Dabei konnten bereits Aussagen über die Position und Länge der gefundenen repetitiven Sequenzen gemacht werden. Bei einer Doppelbande konnte durch die Längenbestimmung der zwei amplifizierten Fragmente mittels einer mitaufgetragenen 1 kB-Leiter die ungefähre Position des Mikrosatelliten innerhalb der klonierten Sequenz bestimmt werden.


[Seite 26↓]

Abb. 6: die positive Kolonie (41-19) zeichnet sich durch deutliche Doppelbande aus

3.2 Sequenzauswertung und Primerdesign

Insgesamt enthielten 104 von 1154 untersuchten Klonen Mikrosatellitensequenzen. Redundanzen und unzureichende Flankenregionen reduzierten die Anzahl der verwendbaren Mikrosatelliten auf 28. Für sieben Klone mit abgeschnittenem Mikrosatelliten aus den ersten zwei Durchgängen fanden sich eindeutige Übereinstimmungen mit Sequenzen der Datenbank, sechs davon von L. major und eine von L. donovani. In drei Fällen fand sich an erwarteter Stelle ein der klonierten Sequenz gleichgearteter Mikrosatellit. Die Templatesequenzen von Li21-32F und Li21-34R stammen von L. major MHOM/IL/80/Friedlin (Datenbank-Nr.: AE001274), die von Li23-41F von L. donovani MHOM/ET/67/HU3(LV9) (Datenbank-Nr.: AF427881). Für die 28 vollständigen und die drei mit Sequenzen aus der Datenbank ergänzten Mikrosatellitenregionen wurden Primerpaare entwickelt. 22 dieser Primer lieferten für alle untersuchten Stämme ein Amplifikat der gewünschten Fragmentgröße. Die anschließende Analyse zeigte weitere Redundanzen auf, was die endgültige Zahl der Marker auf 15 reduzierte (Tab. 3). Auch mit diesen wurde eine BLAST-Suche durchgeführt, um ihre Lokalisationen im Gesamtgenom zu bestimmen (Tab. 3).


[Seite 27↓]

Tab. 3: Mikrosatellitenprimerpaare (TA: Annealingtemperatur; unter Repeats findet sich Art und Länge der Repeats beim klonierten Stamm PM1 sowie Längenbereich bei allen untersuchten Stämmen; bei Lokalisation ist die Spezies der Vergleichssequenz angege-ben; * zu Li71-41 siehe Abb. 7)

Primerpaar

Sequenz (5'-3')

TA

Repeats

Anzahl Allele

Lokalisation

PM1, alle Stämme

Li21-34

F: GAGAAAGCAAGACACGAGATGA

52

(AC) 9, 2-9

6

Chr. 1 (L. major)

 

R: GAGGCGTTTTCCTTCTGGTAG

     

Li22-35

F: CTTGATGTTCGGGTTAGCAAGT

52

(CA) 14, 8-28

11

 
 

R: ATGCACACCAAAAATCATGTG

     

Li23-41

F: GATCGGAGGTGACAGCGT

52

(GT) 16, 8-31

7

 
 

R: CCTTTAACTGCCAGTGCG

     

Li45-24

F: GCGCCTACAGGCATAAAGGA

54

(AC) 15, 9-20

9

 
 

R: CTGGCGCATCAACGGTGT

     

Li51-40

F: CGAACAACCCTGTATCACCC

50

(GT) 9, 6-9

4

Minicircle-kDNS

 

R: GCCGTTCTTCTTTCGTTAGC

    

(L. infantum)

Li71-33

F: CTCCTTTCACACCGCCTCT

50

(TG) 11, 8-13

4

 
 

R: GAGAGAAGACGAGCCGAAGT

     

Li71-5/2

F: GCACGGTCGGCATTTGTA

50

(CA) 9, 7-9

3

Chr. 35 (L. major)

 

R: GATAAACGAGATGGCCGC

     

Li71-41

F: ATGCGCAAGAGAAGGAAAAG

50

(CTCTTYT*) 4, 3-4

2

 
 

R: TGCCTCATTTCGCTCATAGTC

     

Li71-42

F: CCAAGCACCACTCAAGCATA

54

(AC) 9, 7-12

4

 
 

R: TCTTGTCCTCTTCGGTGCTT

     

Li72-14

F: AGAGTGTCTGCGCGTGAGTA

54

(TG) 10, 8-11

3

 
 

R: AAGAAAAGAAGGTGCAGCGA

     

Li72-20

F: GATCCCTTCGGATTACTGC

50

(CA) 12, 9-14

6

Chr. 35 (L. major)

 

R: CTGCTAGCGAGGGGATAGG

     

Li72-23

F: TGCTTCATGATAACAACTTGGC

50

(AC) 10, 8-16

6

 
 

R: TGTTTTGAATGGTGCCTGTT

     

Li71-19

F: CAAACCGGTGTTCTGCTTTT

52

(CA) 13, 13-21

4

 
 

R: CGGACATTGGCAACACACT

     

Li71-60

F: GTGAGAAGGCAGGGATTCAA

46

(CA) 12, 8-13

5

Chr. 13 (L. major), RNS-Polymerase-
III-Gen

 

R: GCTGCAGCAGATGAGAAGG

    

Li72-17/2

F: CTGTTTTACGCCCAACCATC

48

(CA) 13, 11-15

5

 
 

R: CTTTTGGGATCGCAGGTTT

     


[Seite 28↓]

Der Vergleich der Sequenzen aus Durchgang 1 und 2 mit der Datenbank führte weiterhin zu folgenden Ergebnissen: In Region Li13-5 fand sich im korrespondierenden L. major-Chromosom an Stelle eines (CA)-Repeats von mindestens 34 Bp Länge bei L. infantum lediglich ein kurzes, imperfektes Stück der Sequenz (CA)3GA(CA)2(CGCA)2. In den drei übrigen Fällen war an entsprechender Stelle im L. major-Genom überhaupt kein Mikrosatellit vorhanden.

Das Primerpaar Li71-41 umschließt einen zusammengesetzten Mikrosatelliten. Hier kommt es bei den Stämmen aus Nordostafrika (Sudan, Äthiopien) und Kenia zu einer Deletion von sieben Basenpaaren sowie zu einer Punktmutation (Abb. 7)

Abb. 7: Deletion und Punktmutation an Locus Li71-41

3.3 Nachweis von Polymorphismen in den Mikrosatellitenregionen

Die Amplifikation durch die in Tab. 3 beschriebenen Primer für die in Tab. 1 aufgeführten Stämme führte in jedem Falle zu einer oder zwei Banden. Die Fragmentlänge der PCR-Produkte wurde mit Hilfe der Polyacrylamidgelelektrophorese (PAGE) und nachfolgender Auswertung mittels Bionumerics-Software bestimmt (Abb. 8). Die mitaufgetragenen Amplifikate des klonierten Stammes MHOM/ES/93/PM1 mit bekannter Länge dienten als Referenz.

Anstelle der aufwendigen PAGE wurde die Elektrophorese in MetaPhor-Agarose (4 g/ 100 ml) versucht (Abb. 9). Die Auswertung der Bilder zeigte, dass eine eindeutige Längenbestimmung der aufgetragenen Fragmente wegen der Unschärfe der Banden nicht möglich war. Die prinzipielle Frage, ob ein Marker Polymorphismen aufweist, lässt sich aber auch mit dieser Methode beantworten.


[Seite 29↓]

Abb. 8: Polyacrylamidgelelektrophorese (Locus 72-23, IPT1 nicht aufgetragen)

Abb. 9: Gelelektrophorese mit MethaPhor-Agarose (Locus Li72-20)

Anhand der bekannten Mikrosatellitensequenzen des klonierten Stammes wurde von der Fragmentlänge des PCR-Produkts auf die Anzahl der repetitiven Sequenzen in den untersuchten Stämmen geschlossen (Tab. 4, 5). Von den 15 untersuchten Markern sind


[Seite 30↓]

Tab. 4: Polymorphe Mikrosatellitenmarker für die untersuchten Stämme des L. donovani-Komplex; dargestellt ist die Größe des jeweiligen Markers in Bp

 

WHO-Code

Zymodem

Li21-34

Li22-35

Li23-41

Li45-24

Li51-40

Li71-33

Li71-5/2

Li71-41

Li71-42

Li72-14

Li72-20

Li72-23

Li71-19

Li71-60

Li72-17/2

1

MHOM/TN/80/IPT1

MON-1

93

102

83

107

94

105

81

90

106

92

95

104

112

98

126

2

MHOM/ES/93/PM1

MON-1

93

96

85

105

94

105

81

90

106

92

95

104

112

98

126

3

MHOM/FR/95/LPN114

MON-1

93

98

87

103

94

105

79

90

106

92

95

104

112

100

126

4

MCAN/FR/87RM1

MON-108

93

108

85

107

94

105

81

90

106

92

97

104

112

100

126

5

MHOM/ES/88/LEM175

MON-198

81

120

85

113

92

113/109

77

90

112

92

97/89

108

112

100

124

6

MHOM/ES/92LEM373

MON-199

93/81

124/116

85

115/109

94/92

113/109

77

90

112

92

99/89

110/106

112

98

126/124

7

MCAN/ES/86/LEM935

MON-77

93/87

120

83

113/105

94

105

81

90

106

92

95/93

106/104

112

100

126

8

MHOM/CN/78/D2

LON-49

93

106

85

105

94

105

79

90

106

92

95

104

112

100

124

9

MHOM/SD/97/LEM3472

MON-267

89

102

97

111

90

103/99

81

83

102

88

97

106

128/126

94

128/122

10

MHOM/ET/72/GEBRE1

MON-82

89/79

84

95

111

88

99

79

83

106

88

99

106/100

126

94/92

122

11

MHOM/SD/97/LEM3463

MON-258

89/79

102

69

111

90/88

99

79

83

106

88

99/97

108

128

94

122

12

MHOM/IN/80/DD8

MON-2

79

100

115

97

88

103

79

90

102

92

89

106

118

90

130

13

MHOM/KE/83/NLB189

-

85

104

79

93

88

105

79

83

108

94

91

116

118

94

128


[Seite 31↓]

Tab. 5: Polymorphe Mikrosatellitenmarker für die untersuchten Stämme des L. donovani-Komplexes; dargestellt ist die Anzahl der repetitiven Elemente.

 

WHO-Code

Zymodem

Li21-34

Li22-35

Li23-41

Li45-24

Li51-40

Li71-33

Li71-5/2

Li71-41

Li71-42

Li72-14

Li72-20

Li72-23

Li71-19

Li71-60

Li72-17/2

   

(AC)

(CA)

(GT)

(AC)

(GT)

(TG)

(CA)

(CTCTTYT)

(AC)

(TG)

(CA)

(AC)

(CA)

(CA)

(CA)

1

MHOM/TN/80/IPT1

MON-1

9

17

15

16

9

11

9

4

9

10

13

10

13

12

13

2

MHOM/ES/93/PM1

MON-1

9

14

16

15

9

11

9

4

9

10

12

10

13

12

13

3

MHOM/FR/95/LPN114

MON-1

9

15

17

14

9

11

8

4

9

10

12

10

13

13

13

4

MCAN/FR/87RM1

MON-108

9

20

16

16

9

11

9

4

9

10

13

10

13

13

13

5

MHOM/ES/88/LEM175

MON-198

3

26

16

19

8

13/10

7

4

12

10

13/9

12

13

13

12

6

MHOM/ES/92LEM373

MON-199

9/3

28/24

16

20/17

9/8

13/10

7

4

12

10

14/9

13/11

13

12

13/12

7

MCAN/ES/86/LEM935

MON-77

9/6

26

15

19/15

9

11

9

4

9

10

12/11

11/10

13

13

13

8

MHOM/CN/78/D2

LON-49

9

19

16

15

9

11

8

4

9

10

12

10

13

13

12

9

MHOM/SD/97/LEM3472

MON-267

7

17

22

13

7

10/8

9

3

7

8

13

11

21/20

10

14/11

10

MHOM/ET/72/GEBRE1

MON-82

7/2

8

21

13

6

8

8

3

9

8

14

11/8

20

10/9

11

11

MHOM/SD/97/LEM3463

MON-258

7/2

17

8

13

6/7

8

8

3

9

8

14/13

12

21

10

11

12

MHOM/IN/80/DD8

MON-2

2

16

31

11

6

10

8

4

7

10

9

11

16

8

15

13

MHOM/KE/83/NLB189

-

5

18

13

9

6

11

8

3

10

11

10

16

16

10

14


[Seite 32↓]

zwölf in der Lage, unterschiedliche Subspezies von L. infantum zu differenzieren. Fünf davon weisen Polymorphismen innerhalb des Zymodems MON-1 auf.

Wie auch bei L. viannia-Spezies (Russel 1999) besteht eine hochsignifikante Rangkorrelation der Länge des Mikrosatelliten zur Anzahl der insgesamt gefundenen Allele (rS,B=0,699; P<0,01; n=15) und zur Fragmentlängendifferenz zwischen längstem und kürzestem gefundenen Allel (rS,B=0,723; P<0,01; n=15) sowie zwischen Allelanzahl und maximaler Fragmentlängendifferenz innerhalb der Allele (rS,B=0,856; P<0,01; n=15).

Es wurde bei der Auswahl der untersuchten Stämme darauf geachtet, einerseits mehrere Proben des vorherrschenden Zymodems bei L. infantum MON-1 und andererseits von jeder Subspezies des L. donovani-Komplexes wie auch jeder in Vergangenheit mit genotypischen Untersuchungsmethoden diskriminierten Untergruppe von L. donovani sensu sticto (El Tai 2001, Mauricio 2001, Lewin 2002) in die Analysen mit einzubinden. Bei zehn Mikrosatellitenloci traten Doppelbanden für einen oder mehrere der 13 ausgewählten Stämme auf, während die übrigen fünf bei sämtlichen untersuchten Stämmen nur ein Allel aufwiesen (Tab 4, 5). Es ist bemerkenswert, dass lediglich bei den spanischen Stämmen LEM175, LEM373, LEM935 und den Stämmen aus Nordostafrika (Sudan, Äthiopien) Doppelbanden beobachtet wurden.

Bei sieben perfekten Mikrosatelliten mit ausreichenden flankierenden Regionen wurde für insgesamt 200 wie auch für 300 Nukleotide um die repetitive Sequenz herum der durchschnittliche G/C-Gehalt bestimmt. Dieser liegt mit 48,33 - 57,33% unter dem des Leishmaniengesamtgenoms, welches mit 60 % angegeben wird (Alvarez 1994, Leishmania Genome Network, Ravel 1998). Eine Korrelation zwischen dem G/C-Gehalt der flankierenden Region und der Allelanzahl beziehungsweise der maximalen Längendifferenz der gefundenen Allele, wie von Glenn (1996) und Brock (1999) beschieben, konnte allerdings nicht nachgewiesen werden.


[Seite 33↓]

3.4  Bestimmung der genetischen Verwandtschaft basierend auf der Analyse der Mikrosatellitenvariationen

Für die untersuchten Stämme wurde die genetische Distanz mit verschiedenen Methoden berechnet (‚Delta mu genetic distance’ Ddm (Goldstein 1995 a), ‚Average square distance’ D1 (Goldstein 1995 b), ‚Proportion of shared allels’ Dps (Bowcock 1994) und ‚Nei’s standard distance’ Ds (Nei 1972)) und Dendrogramme mittels ‚Unweighted pair group method with arithmatic mean’ (UPGMA, Sneath 1973) und ‚Neigbour joining’ (NJ, Saitou 1987) erstellt (Abb. 10, übrige Daten nicht dargestellt). Während Ds und Dps das klassische Mutationsmodell zu Grunde liegt, basiert die Berechnung von Ddm und D1 auf der Theorie eines schrittweisen Mutationsprozesses (Moran 1975).

Die Einteilung der Stämme in Gruppen war für alle Dendrogramme mit Ausnahme einzelner abweichender Stämme gleich. Prinzipiell zeichnen sich zwei taxonomische Gruppen ab: Die erste beinhaltet L. infantum-Stämme aus Südeuropa sowie einen Stamm aus China und einen aus Tunesien. Die zweite Gruppe setzt sich aus nordostafrikanischen Stämmen zusammen zuzüglich des indischen Referenzstammes für L. donovani. Während die europäische Gruppe bei jeder Distanzberechnungsmethode und Darstellung eindeutig separiert ist, findet sich der L. donovani-Referenzstamm aus Indien bei NJ-Darstellung der Ds in einer Position zwischen den beiden Gruppen. Bei Bestimmung von D1 und Ddm zeichnet sich eine Zwischengruppe mit MHOM/KE/83/NLB189 und MHOM/SD/97/LEM3463ab. Innerhalb der europäischen Gruppe wird eine enge Beziehung zwischen LEM175 und LEM373 deutlich; bei der Berechnung von D1 und Ddm findet sich zusätzlich noch LEM935 in dieser Subgruppierung aus spanischen Stämmen.


[Seite 34↓]

Abb. 10: Dendrogramme erstellt mit UPGMA nach Berechnung von Ds (Nei 1972) und Ddm (Goldstein 1995 a)


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
01.02.2005