[Seite 106↓]

5  Methoden und Materialien

5.1 Methoden

5.1.1 Methoden zur Haltung von Schistosoma mansoni

5.1.1.1 Experimenteller Lebenszyklus

Der Laborzyklus von S. mansoni wurde in der Maus Mus musculus Stamm BALB/c sowie der Wüstenrennmaus Meriones unguiculatus als Endwirt und der Wasserlungenschnecke Biomphalaria glabrata als Zwischenwirt etabliert. Die Endwirte wurden in Makrolonkäfigen im institutseigenen Tierhaus mit einem Hell-Dunkelrhythmus von 12 h gehalten. Der Zwischenwirt wurde bei 28°C unter Sprudelbelüftung in Wasser zur Schneckenhaltung (5.2.18) mit einem Hell-Dunkelrhythmus von 12 h kultiviert. B. glabrata wurde mit 10-20 Mirazidien pro Schnecke, die aus isolierten Schistosomeneiern (5.1.1.3) schlüpften, über Nacht unter einer Lichtquelle in 20 ml Wasser inkubiert. Nach 26 Tagen Kultur unter Standardbedingungen wurden die so infizierten Schnecken für 48 h abgedunkelt. Die Zerkarienausscheidung wurde induziert, indem die Schnecken verteilt auf 12-Loch-Platten starkem Licht ausgesetzt wurden; nach 2 h ließ die Zerkarienausscheidung nach und die Schnecken wurden entfernt. Die Zerkarien von mindestens 5 ausscheidenden Schnecken wurden vereinigt, um zu gewährleisten, dass männliche und weibliche Zerkarien für die Infektion des Endwirtes eingesetzt wurden. Die Tiere, die als Endwirte dienten, waren zum Zeitpunkt der Infektion mindestens 10 Wochen alt. Die zuvor durch Metofane-Inhalation betäubten Tiere wurden je nach Art mit 70-100 Zerkarien, die zuvor unter dem Binokular ausgezählt und in Spritzen in max. 0,1-0,3 ml Wasser aufgezogen wurden, infiziert. Die Infektion erfolgte durch subkutane Injektion von 70 Zerkarien in die Wüstenrennmäuse und von 100 Zerkarien in die Mäuse.

5.1.1.2 Gewinnung und in vitro-Kultur adulter Würmer

Zur Isolation von Würmern aus infizierten Endwirten wurden die Tiere 42 Tage nach ihrer Infektion durch CO2-Inhalation getötet. Nach dem Öffnen der Bauchdecke wurden die Würmer durch vorsichtige Injektion von 50 ml 1 x PBS in den linken Herzventrikel aus den Mesenterialvenen herausgespült und konnten aus dem Bauchraum gesammelt werden. Die adulten Würmer wurden mehrfach mit sterilem [Seite 107↓]RPMI komplett gewaschen und bei 37°C und 5 % CO2 unter sterilen Bedingungen bis zu 14 Tagen kultiviert. Da die weiblichen Würmer auf Grund starker Eigenfluoreszenz für Transformationsversuche ungeeignet waren, wurden Wurmpaare durch Inkubation für 15 min bei 4°C getrennt.

5.1.1.3 Gewinnung von Schistosomeneiern, Mirazidienschlupf und Sporozystenkultur

Schistosomeneier wurden aus Lebern infizierter Endwirte nach der Methode von Coustau et. al (1997) gewonnen. Die frisch entnommenen Lebern wurden durch ein Sieb gepresst und homogenisiert. In einem Erlenmeyerkolben wurde das Homogenat drei- bis fünfmal mit 200 ml kalter 1,8 %iger NaCl-Lösung aufgeschwemmt und auf Eis für 15 min inkubiert. Der Überstand wurde verworfen. Abschließend wurde einmal mit Wasser gewaschen, um die NaCl-Lösung zu entfernen. Die isolierten Eier mit den verbliebenen Leberbestandteilen wurden in einen 50 ml Messzylinder überführt. Der Messzylinder wurde mit 28°C warmen Wasser aufgefüllt und in ein gleichwarmes Wasserbad gestellt. Der Zylinder war bis auf einen Rand am oberen Ende durch Aluminiumfolie abgedunkelt. Das Schlüpfen der Mirazidien aus den Eiern wurde durch Inkubation für 2-4 h unter dem starken Licht einer Kaltlichtlampe induziert. Geschlüpfte Mirazidien sammelten sich an der Wasseroberfläche im Licht. Der gesamte Überstand wurde aus dem Messzylinder in 15 ml Reaktionsgefäße überführt und nachfolgend für 15 min auf Eis abgekühlt, um die Mirazidien zu konzentrieren. Eine anschließende Zentrifugation für 3 min bei 1000 Umdrehungen/Minute (rpm) ließ alle Mirazidien absinken. Der Überstand wurde bis auf 1 ml abgenommen und die Mirazidien erneut für 15 min unter Licht bei 28°C inkubiert. Der Überstand mit den freibeweglichen Mirazidien wurde in Kultur genommen. Zur Transformation in Muttersporozysten wurden die aufgereinigten Mirazidien auf eine 12-Loch-Platte verteilt. Die Transformation in Muttersporozysten wurde durch Zugabe von Sporozystenkulturmedium MEMSE-J (Kawanaka et al., 1986) induziert. Die vollständige Transformation erfolgte bei 28°C und 5 % CO2 im Inkubator innerhalb von 24 h. Sporozysten, die für die Mikroinjektion eingesetzt wurden (5.1.2.1) wurden weitere 24 h kultiviert. Durch eine Zentrifugation für 2 min bei 1000 rpm wurden die Sporozysten aus der Kultur isoliert. Der Überstand wurde abgenommen und die Sporozysten konnten nun in dem verbliebenen kleinen Volumen pipettiert werden.


[Seite 108↓]

5.1.2  Methoden zur genetischen Transformation von S. mansoni

5.1.2.1 Mikroinjektion

Die Mikroinjektion bietet den Vorteil des gezielten Transfers von DNA in einzelne Zielzellen und kann mikroskopisch verfolgt werden. Sie wurde unter einem Inversmikroskop (Axiovert 135, Zeiss) mit Hilfe eines Mikromanipulators (Leitz, Wetzlar) und eines Mikroinjektors (Eppendorf, Hamburg) durchgeführt. Injektionsnadeln wurden hergestellt, indem Glaskapillaren mit Filament (Außendurchmesser: 1 mm; Innendurchmesser: 0,58 mm) mit Hilfe eines Ausziehgerätes für Glasnadeln (Kopf Instruments, USA) ausgezogen und so auf einen Innendurchmesser von 0,2-0,35 μm begrenzt wurden. Haltenadeln wurden hergestellt, indem Glaskapillaren ohne Filament (Außendurchmesser 1 mm, Wandstärke 0,125 mm) über einem Bunsenbrenner von Hand ausgezogen wurden und so der Innendurchmesser auf 5-10 μm begrenzt wurde. Die Injektionsnadel wurde beladen, indem sie mit der stumpfen Seite in die Injektionslösung gestellt wurde. Als Injektionslösungen wurden Trypan-Blau und DNA-Lösungen mit einer Konzentration von 2,25 μg/μl in 1 x Mikroinjektionspuffer verwendet. Die Injektionslösung wurde auf Grund von Kapillarkräften in die Nadel eingesaugt. Die Sporozysten wurden unmittelbar vor der Injektion für 10 min auf Eis inkubiert, um ihre Beweglichkeit einzuschränken. Die Mikroinjektion erfolgte auf Objektträgern mit Hohlschliff (Roth, Karlsruhe), in welche die Sporozysten in 20 μl Medium eingebracht und anschließend mit Paraffinöl überschichtet wurden. Eine Sporozyste wurde mit einer Haltenadel vom Boden gelöst und so positioniert, dass ein Keimballen unmittelbar an der Öffnung der Haltenadel zu liegen kam. Jetzt konnte die Injektionsnadel mit Hilfe des Mikromanipulators auf die Höhe der Sporozyste gebracht werden. Injiziert wurde, indem die Injektionsnadel in die Öffnung der Haltenadel geführt wurde und anschließend wieder ein kleines Stück zurückgezogen wurde, sodass ihre Spitze in dem Keimballen ruhte. Eingebracht wurde etwa 1/10 μl Lösung bei einem Druck von 4000 Psi. Nach der Mikroinjektion wurden die Sporozysten bei 28°C und 5 % CO2 inkubiert. Nach 48 h wurde die Reportergenaktivität mikroskopisch untersucht.

5.1.2.2 Elektroporation

Bei der Elektroporation werden Zellmembranen durch das Anlegen einer elektrischen Spannung reversibel elektrisch permeabilisiert, sodass DNA in die Zelle eindringen [Seite 109↓]kann. Die Elektroporation von Sporozysten wurde mit dem Elektroporator BTX ECM 830 (Qbiogene, Heidelberg) in 4 mm Elektroporationsküvetten (peqLab, Erlangen) durchgeführt. Ca. 500 Sporozysten wurden in einem Gesamtvolumen von 700 μl 1:3 verdünnten MEMSE-J für 10 min bei Raumtemperatur (RT) mit 10-50 μg DNA in Elektroporationsküvetten inkubiert. Elektroporiert wurde bei einer Feldstärke von 910 V/cm mit einem Puls von 250 μs und bei einer Feldstärke von 660 V/cm mit zwei Pulsen von 250 μs. Nach der Elektroporation wurden die Sporozysten zur Regeneration 10 min bei RT in den Küvetten belassen und danach für 48 h bei 28°C kultiviert. In einem weiteren Versuch zur Elektroporation wurden die Sporozysten nach der Methode von Neumann et al. (1996) in Anwesenheit von DEAE-Dextran in einer Konzentration von 3,1 μg/μl elektroporiert. Propidiumiodid wurde in einer Endkonzentration von 15 mg/ml (Sersa et al., 1995; Gabriel und Teissie, 1997) eingesetzt, um die Transfektion mikroskopisch mitzuverfolgen. Propidiumiodid fluoresziert bei einer Anregungswellenlänge von 546 nm (Grünlicht) orange-rot und ermöglichte eine direkte Untersuchung des Transfektionserfolgs ohne auf die Expression des Reportergens warten zu müssen.

5.1.2.3 Mikroprojektilbeschuss

Bei dieser Methode wird DNA auf Goldpartikel präzipitiert. Die Goldpartikel werden als Projektile genutzt und mit Hilfe von Druck gegen das Untersuchungsobjekt beschleunigt (Abb. 5.1). Der Druck wird bei der heliumbetriebenen Apparatur mit Hilfe von Helium hinter einer Plastikscheibe (Rupture Disk) aufgebaut, die je nach gewählter Rupture Disk bei Drücken von 900-2200 Psi zerreißt. Durch die Wahl der Rupture Disk lässt sich der aufgebaute Heliumdruck je nach Versuchsobjekt variieren. Durch einen größeren Heliumdruck beschleunigte Goldpartikel dringen tiefer in die zu transfizierende Probe ein und ermöglichen die Transfektion tiefer gelegener Zellschichten oder die Transfektion von Objekten mit einer härteren Oberfläche.
Der Mikroprojektilbeschuss wurde in dieser Arbeit zur Transfektion von adulten männlichen Würmern, von Sporozysten und von Mirazidien eingesetzt.
Die adulten Würmer wurden in die Mitte einer 6 cm Petrischale pipettiert und das Medium entfernt. Auch Sporozysten wurden in 6 cm Petrischalen transfiziert. Das Entfernen des Mediums geschah unter dem inversen Mikroskop. Mirazidien wurden zur Transfektion auf die Polycarbonatmembraneinlage einer 12 cm Kulturschale [Seite 110↓](Costar, Bodenheim) pipettiert. Wasser floss durch die semipermeable Membran ab, sodass die Mirazidien auf der Membran trocken fielen. Um eine effiziente Transfektion zu erzielen, wurden adulte Würmer, Sporozysten und Mirazidien auf einer maximalen Fläche von 0,5 cm Durchmesser aufgebracht. Die gelieferten Goldpartikel mit einer Größe von 1 μm (Biorad, München) mussten vor dem Gebrauch gewaschen werden: Basierend auf der Methode von Sanford et. al (1993) wurden 30 mg Goldpartikel in einem 1,5 ml Reaktionsgefäß eingewogen und in 1 ml 70 % Ethanol für 5 min stark gevortext und anschließend für 15 min bei RT inkubiert. Die Goldpartikel wurden kurz 5 sec abzentrifugiert und der Ethanol abgenommen. Folgender Vorgang wurde dreimal wiederholt, um die Goldpartikel von dem Ethanol zu befreien: Zugabe von 1 ml sterilen Wassers, 1 min Inkubation bei RT, 1-2 sec Zentrifugation, Abnehmen des Überstandes. Nach dem letzten Waschschritt wurden die Goldpartikel in 50 % sterilen Glycerols aufgenommen. Die Goldpartikelsuspension mit einer Konzentration von 60 mg/ml wurde bei 4°C aufbewahrt.


Abb. 5.1: Ablauf des Mikroprojektil-Beschusses. Helium sammelt sich in einer Druckkammer hinter der Rupture Disk, die bei einem definierten Druck zerreißt. Die Helium-Druckwelle beschleunigt die auf einer Plastikscheibe (Macrocarrier) heftenden Goldpartikel (Microcarrier), die zuvor mit DNA beladen worden waren, gegen die Probe. Ein Metallsieb (Stopping Screen) hält den Macrocarrier zurück und lässt nur die Microcarrier passieren. A: variabler Abstand zwischen Rupture Disc und Macrocarrier; B: variabler Abstand zwischen Macrocarrier und Stopping Screen; C: variabler Abstand zwischen Stopping Screen und Probe. In dieser Arbeit wurde für A ein Abstand von 3-5 mm, für B der durch Unterlegscheiben bestimmbare mittlere Abstand von ca. 10 mm und für C der kleinste mögliche Abstand von 3 cm gewählt. (Die Zeichnung wurde verändert nach Biorad, München.)


[Seite 111↓]


Für einen Beschuss wurden 0,5 mg Gold und 5 μg DNA eingesetzt. Zur Beladung der Goldpartikel mit DNA wurde die Goldsuspension zunächst 5 min stark gevortext. 8,5 μl Goldsuspension wurden unter leichtem Vortexen in ein 1,5 ml Reaktionsgefäß überführt. Dann wurden rasch 5 μg DNA in einem Volumen von 5-15 μl, 8,5 μl 2,5 M CaCl2 und 3,5 μl 0,1 M Spermidin hinzugefügt. Der Ansatz wurde für ca. 2 min gevortext. Nach dem Vortexen wurden die Goldpartikel für 1 min stehen gelassen, damit sie sich am Boden sammelten. Der Überstand wurde abgenommen. Nachfolgend wurde das Gold zweimal mit 96-100 % Ethanol gewaschen und in 15 μl 96-100 % Ethanol aufgenommen. Die Goldsuspension wurde leicht gevortext, durch Pipettieren resuspendiert und auf die Macrocarrier übertragen. Der Überstand wurde abgenommen und das Gold trocknete unter der Sterilbank. Zur Optimierung der Methode wurden Fluoreszein-Isothiocyanat (FITC) gelabelte Oligonukleotide (MWG Biotech, Ebersberg) anstelle von DNA eingesetzt. FITC fluoresziert bei Grünlichtanregung gelb-grün und ermöglichte eine direkte Untersuchung des Transfektionserfolges ohne auf die Expression des Reportergens warten zu müssen. Der Beschuss fand unter Vakuum (15 mm Quecksilbersäule) statt. Adulte Würmer wurden innerhalb weniger Minuten zweimal bei einem Druck von 1800 Psi mit dem gleichen Konstrukt beschossen. Sporozysten wurden zunächst mit einem Druck von 1500 Psi und nach Optimierung der Methode mit einem Druck von 900
Psi beschossen. Mirazidien wurden mit einem Druck von 900 Psi beschossen. Nach
dem Beschuss wurden adulte Würmer bei 37°C und 5 % CO2 inkubiert, Sporozysten bei 28°C und 5 % CO2, Mirazidien wurden entweder zur Infektion von Zwischenwirtsschnecken (5.1.1.1) eingesetzt oder in vitro in Sporozysten transformiert (5.1.1.3). Zur Induktion eines Hitzeschocks wurden adulte Würmer 24 h nach der Transfektion für 4 h bei 42°C und danach für weitere 24 h bei 37°C inkubiert. Sporozysten wurden nicht hitzegeschockt. Mikroskopische, molekularbiologische oder biochemische Untersuchungen erfolgten 48-72 h nach der Transfektion.


[Seite 112↓]

5.1.3  Molekularbiologische Methoden

5.1.3.1 Kultur und Lagerung von Escherichia coli

Flüssigkultur und Kultur auf Agar-Festplatten

Für die Präparation von Plasmid-DNA wurde LB-Medium steril mit einer isolierten E. coli-Kolonie von einer Agarplatte angeimpft. Zur Selektion auf das Vorhandensein des Plasmids wurde der Kultur das dem Plasmid entsprechende Antibiotikum zugesetzt. Die Endkonzentration für Ampicillin betrug 100 μg/ml, die für Kanamycin 50 μg/m. Die Kulturen wurden in einem Schüttler bei 37°C und 230 rpm über Nacht inkubiert. Die Plasmidausbeute bei der DNA-Präparation wurde erhöht, indem die Übernachtkultur durch Verdünnen einer 3 ml-Vorkultur im Verhältnis 1:250 bis 1:500 in frischem Medium angesetzt wurde. Die Vorkultur war ihrerseits aus einer Einzelkolonie oder durch Überimpfen von Zellen aus einer Gefrierkultur angeimpft worden und dann für 4 h bis 8 h bei 37°C im Schüttelinkubator kultiviert worden. Zur Isolation einzelner Klone wurden E. coli-Zellen auf LB-Agarplatten (mit dem entsprechenden selektiven Antibiotikum) ausgestrichen und über Nacht bei 37°C inkubiert.

Glyzerin-Gefrier-Kulturen

Für die dauerhafte Aufbewahrung von E. coli-Zellen bei -80°C wurden 920 µl einer 3 ml-Kultur, die über Nacht gewachsen und von einer Einzelkolonie angeimpft worden war, mit 80 µl sterilen Glyzerins (87 %) versetzt und kurz gevortext. Diese Kulturen wurden dann sofort in flüssigem Stickstoff inkubiert. Während des raschen Einfrierens wurde eine Schädigung der E. coli-Zellen durch das Glyzerin verhindert

5.1.3.2 Isolation von RNA

Die Isolation von RNA aus Zellkultur-Zellen und Parasiten wurde mit dem Materialsatz RNeasy Mini Kit (Qiagen, Hilden) nach Angaben des Herstellers durchgeführt. Zur Isolation von RNA aus Zellen wurden 3 x 106 cos7-Zellen oder 7 x 106 HeLa-Zellen eingesetzt, zur Isolation von RNA aus Schistosomen wurden 20 adulte Würmer, 500-1000 Sporozysten oder 1000-2000 Zerkarien verwendet. Zur Vermeidung von RNAse Kontamination der Proben wurden sämtliche Geräte vor der Verwendung mindestens 4 h bei 240°C sterilisiert und Lösungen mit DEPC behandeltem Wasser und frischen Chemikalien angesetzt. Parasiten-Material wurde nach der Aufnahme in den Lysis-Puffer zunächst mechanisch mit einem kleinen Pistill und unter mehrfachem Einfrieren und Auftauen in flüssigem Stickstoff [Seite 113↓]mechanisch zerkleinert. Das Homogenisieren der Proben erfolgte dann mit QIAshredder-Säulchen (Qiagen, Hilden). Die RNA wurde nach ihrer Isolation in 50 ml DEPC-Wasser aufgenommen und bei -80°C gelagert.

5.1.3.3 Verdau mit RNAse freier DNAse

50 μl RNA wurden vor ihrem Umschreiben in cDNA mit 2 μl RNAse freier DNAse (Stratagene, Heidelberg) bei 37°C für 3 h inkubiert, zur Stabilisierung der RNA wurden 2 μl RNAse Block (Stratagene, Heidelberg) dem Ansatz zugefügt.

5.1.3.4 Umschreiben der RNA in cDNA

Die in der Gesamt-RNA vorhandene mRNA wurde mit Hilfe der M-MLV Reversen Transkriptase (H-) (Promega, Mannheim) in cDNA umgeschrieben.

In einen 20 μl Ansatz wurden folgende Komponenten pipettiert:

1 μl Oligo(dT)12-18 (0,5 μg/ul)

1-5 μg Gesamt-RNA

ad 12 μl DEPC-Wasser

Nach Mischen und anschließender Inkubation für 10 min bei 70°C wurde der Ansatz für 2 min auf Eis schnell abgekühlt und nachfolgend abzentrifugiert. Danach wurden dazu gegeben:

4 μl 5 x First Strand Puffer

2 μl 0,1 M DTT

1 μl 10 mM dNTP-Mix (in DEPC-Wasser)

1μl RNAse Block

Der Ansatz wurde wiederum gemischt und für 2 min bei 42°C inkubiert, die nachfolgende Transkription der RNA in cDNA erfolgte nach Zugabe von 1 μl Transkriptase für 50 min bei 42°C. Transkriptase und RNAse Block wurden dann durch Inkubation des Ansatzes für 20 min bei 70°C inaktiviert.

5.1.3.5 Isolation von genomischer DNA

Genomische DNA aus adulten Schistosomen wurde mit dem DNeasy Tissue Kit (Qiagen,Hilden) nach Angaben des Herstellers isoliert: 10-25 adulte Würmer wurden enzymatisch durch Inkubation mit Proteinase K aufgeschlossen. Durch Zugabe von chaotropen Salzen wird die Hydrathülle der DNA zerstört, sodass diese an die Silikamembran der Säulen bindet. Die Elution erfolgte in 50-100 μl Wasser.


[Seite 114↓]

5.1.3.6  Isolation von Plasmid-DNA

Minipräparationen von Plasmid-DNA zur anschließenden Restriktionsanalyse
wurden nach der Methode von Willimzig (1985) durchgeführt.
1,5 ml einer E. coli-Übernachtkultur wurden in einem Eppendorf-Reaktionsgefäß abzentrifugiert und das Bakterien-Pellet in 125 µl TELT-Lösung (Tris/HCl; EDTA; LiCl; Triton X-100), der Lysozym in einer Konzentration von 5 mg/ml zugesetzt war, durch starkes Vortexen vollständig resuspendiert und für 15-20 min bei RT inkubiert. Danach wurden die Proben 3 min bei 95°C erhitzt und 5 min auf Eis abgekühlt. Nachdem die Probe 15 min bei 10000 rpm in der Eppendorf-Tischzentrifuge zentrifugiert worden war, wurde das Pellet mit sterilen Zahnstochern entfernt. Der Überstand wurde mit 300 µl 100 % Ethanol versetzt. Nach 5 Minuten Inkubation bei RT wurden die Proben wiederum bei 10000 rpm zentrifugiert. Nach Abnahme des Überstandes wurde das Pellet mit 200 µl 70 % Ethanol (v/v) gewaschen. Nach dem Trocknen wurde die DNA in 50 µl Wasser aufgenommen. Zur vollständigen Resuspension der Pellets wurde Plasmid-DNA kurz gevortext. RNA wurde durch Zugabe von RNAse A in den Restriktionsansatz verdaut. Zur Isolation von hochreiner DNA bzw. zur Aufreinigung großer Mengen an DNA für Sequenzierung, Transformation und Transfektion wurden kommerziell erhältliche Säulen (Clontech, Heidelberg) verwendet. Grundlage dieses Verfahrens ist das Prinzip der alkalischen Lyse nach Birnboim und Doly (1979), das modifiziert und zur Aufreinigung der DNA mit Anionenaustauschersäulchen, die als Ladungsträger gereinigtes Silicat enthalten, kombiniert wurde. Bei Einsatz eines high-copy-Plasmids konnten so bei der Präparation einer 25 ml Kultur (Midi-Präp) bis zu 100 µg und bei der Präparation einer 100 ml Kultur (Maxi-Präp) bis zu 500 µg Plasmid-DNA gewonnen werden.

5.1.3.7 Restriktion von DNA

Zur Restriktion wurden pro µg DNA 3 Units Restriktionsendonuklease eingesetzt. Die Restriktion erfolgte in dem mitgelieferten 10 x Reaktionspuffer nach Angaben des Herstellers für 1-3 h. Weil das im Enzympuffer enthaltene Glyzerin die Restriktion störte, durfte die Menge an Enzym max. 10 % der Gesamtmenge betragen. Bei Verdau mit zwei verschiedenen Enzymen in dem gleichen Puffer betrug die Aktivität beider Enzyme mindestens 50 % laut Hersteller. Die Restriktionsendonukleasen wurden anschließend durch Hitzeinaktivierung deaktiviert oder durch Phenol-Chloroform-Fällung oder Auftrennung im Agarosegel entfernt.


[Seite 115↓]

5.1.3.8  Agarosegelelektrophorese

Zur Auftrennung von DNA-Fragmenten nach einer Restriktion und zur Aufreinigung von DNA wurden Agarosegele von 0,7-1,5 %, denen zur späteren Visualisierung unter UV-Licht Ethidiumbromid in einer Endkonzentration von 0,5 μg/ml zugesetzt war, in einer horizontalen Gelapparatur verwendet. Je nach Größe der Gele erfolgte die Auftrennung bei einer Spannung zwischen 60 und 100 V. Die Proben wurden mit 6 x Probenpuffer versetzt. Der Probenpuffer enthielt neben Glyzerin, das ein Absinken der Probe in die Geltasche bewirkt, einen blauen Farbstoff, der den Fortgang der Elektrophorese auf dem Gel beobachten ließ. Zur Beurteilung der Größe der DNA-Fragmente diente der 1 kb-DNA-Leiter (Rapidozym, Berlin) und der SmartLadder DNA-Marker (Eurogentec, Belgien). Zur Dokumentation wurden die Gele nach der elektrophoretischen Auftrennung der DNA in der Geldokumentationsanlage im UV-Licht von einer Kamera aufgenommen. Die Bilder wurden von einem Fotoprinter ausgedruckt oder zur späteren Bildverarbeitung auf Diskette abgespeichert.

5.1.3.9 Aufreinigung von DNA aus Agarosegelen

Nach vollständiger Auftrennung des Restriktionsansatzes konnte die Bande, in der das erwünschte Fragment lief, durch Vergleich mit den Banden des Größenmarkers ermittelt und mit Hilfe eines gereinigten Skalpells aus dem Gel ausgeschnitten werden. Die DNA wurde nur kurz dem zur Visualisierung notwendigen UV-Licht ausgesetzt, um eine Schädigung zu verhindern. Die Isolation der DNA aus dem Gel wurde mit Hilfe des NucleoSpin Extraction Kit (Clontech, Heidelberg) nach den Angaben des Herstellers durchgeführt. Nach dem Schmelzen der Agarose wurde die DNA über Säulchen mit Silikamembran aufgereinigt.

5.1.3.10 Reinigung und Fällung von RNA und DNA

Kontaminierende Proteine wurden durch Phenol-Chloroform-Extraktion nach Sambrook et al. (1989) entfernt: Die Probe wurde mit einem Volumen Roti-Phenol-Chloroform-Gemisch (Roth, Karlsruhe) versetzt. Nach gründlichem Vortexen und Zentrifugation für 5 min bei maximaler Geschwindigkeit wurde die wässrige
Phase mit der RNA oder DNA abgenommen. Verbliebene Phenolreste wurden mit
einem Volumen (Vol) Chloroform-iso-Amylalkohol ausgewaschen. Nachfolgend wurde die RNA oder DNA durch Zugabe von 0,1 Vol Natriumacetat, pH 5,2 und 2,5 Vol 100 % Ethanol bei 4°C für mehrere Stunden gefällt. Danach wurde der [Seite 116↓]Fällungsansatz bei 14000 rpm und 4°C für 30 bis 60 min zentrifugiert.
Nach dem Waschen mit 70 % Ethanol wurde das RNA-oder DNA-Pellet getrocknet. RNA wurde in DEPC-Wasser gelöst. Alternativ wurde RNA durch Zugabe von 1 Vol Isopropanol bei 4°C für mehrere Stunden gefällt. PCR-Fragmente wurden mit dem NucleoSpin Extraction Kit (Clontech, Heidelberg) nach Angaben des Herstellers aus dem PCR-Reaktionsansatz isoliert.

5.1.3.11 Konzentrationsbestimmung von Nukleinsäuren

Die Konzentration an Nukleinsäuren wurde photometrisch bei einer Wellenlänge von 260 nm, bei der Nukleinsäuren ihr Absorptionsmaximum besitzen, bestimmt. Bei einer Schichtdicke der Küvette von 1 cm entspricht die optische Dichte OD260 von 1 50 µg doppelsträngiger DNA, 40 µg einzelsträngiger DNA bzw. RNA und 20 µg einzelsträngiger Oligonukleotide (Sambrook et al., 1989). Verunreinigungen mit Proteinen wurden durch eine zweite Messung bei 280 nm nachgewiesen, da die aromatischen Aminosäuren wie Tyrosin und Tryptophan bei dieser Wellenlänge ihr Absorptionsmaximum besitzen. Der Quotient OD260/OD280 liegt bei einer proteinfreien Nukleinsäurelösung zwischen 1,8 und 2 (Sambrook et al. 1989).

5.1.3.12 Glätten von 5’-überhängenden Restriktionsschnittstellen

Aus 5’-überhängenden Restriktionsschnittstellen können durch Auffüllen glatte Enden erzeugt werden. Dazu wird die DNA in Anwesenheit von dNTPs mit dem Klenow-Fragment der DNA-Polymerase I aus E. coli inkubiert.

Folgender Reaktionsansatz wurde pipettiert.

1-10 μg DNA in max. 10 ml

2 μl 10 X Klenow-Puffer

1 μl dNTP-Mix (10mM)

1 μl Klenow-Fragment

H20 ad 20 μl

5.1.3.13 Dephosphorylierung

Zur Verhinderung der Selbstligation von DNA-Fragmenten wurden die terminalen 5’-Enden durch die alkalische Kälberphosphatase abgespalten. Die DNA wurde in einer Konzentration von 0,5 μg/10 ml in 1 x Reaktionspuffer verdünnt. Pro mg Vektor wurden 0,5 Einheiten alkalische Phosphatase dazugegeben. Der Reaktionsansatz wurde für 1 h bei 37°C inkubiert.


[Seite 117↓]

5.1.3.14  Ligation

Bei der Ligation werden die bei der Restriktion entstandenen freien 5’-Phosphatenden durch Inkubation mit der T4-Ligase kovalent unter ATP-Verbrauch mit den freien 3’-Hydroxylenden verknüpft. Zur Ligation wurden 250 ng Vektor-DNA im molaren Verhältnis 1:3 mit dem zu ligierenden DNA-Fragment in einem Gesamtvolumen von 10-15 µl eingesetzt. Die Ligation fand unter Einsatz von 1 Einheit T 4-DNA-Ligase in 1 x Ligasepuffer statt. Ligiert wurde für mehrere Stunden bei RT oder über Nacht bei 4°C.

5.1.3.15 Herstellung transformationskompetenter E. coli

Kompetente E. coli-Zellen wurden nach der Methode von Inoue et. al (1990) hergestellt. In 200 ml LB-Medium wurden E. coli-Bakterien bis zu einer Dichte von 0,6 OD600 kultiviert. Nach einer Inkubation von 10 min auf Eis wurden die Bakterien für 10 min bei 4°C und 2500 g abzentrifugiert. Der Überstand wurde verworfen und die Bakterien in 80 ml kaltem TB-Puffer aufgenommen. Nach einer erneuten Inkubation von 10 min auf Eis wurden die Bakterien wiederum abzentrifugiert. Der Überstand wurde verworfen und das Bakterienpellet in 20 ml TB-Puffer aufgenommen. Tropfenweise wurde DMSO bis zu einer Endkonzentration von 7 % zugegeben. Anschließend wurden die Bakterien aliquotiert, in flüssigem Stickstoff schnell eingefroren und bei –80°C gelagert.

5.1.3.16 Transformation von E. coli

Zur Transformation von Plasmid-DNA nach Hanahan (1985) in kompetente E. coli-Zellen wurden 100 µl kompetente Zellen auf Eis aufgetaut und in ein 1,5 ml Reaktionsgefäß überführt. Dann wurden 50 ng Plasmid-DNA bzw. 5-10 µl eines Ligationsansatzes dazugegeben und gut vermischt. Der Transformationsansatz wurde für 30 min auf Eis, 1 min bei 42°C und dann für 2 min auf Eis inkubiert. Anschließend wurden 500 µl SOC-Medium dazu gegeben. Bakterien, die mit einem Ampicillin-Resistenz vermittelnden Plasmid transformiert worden waren, wurden sofort auf Agarplatten ausgestrichen. Die anderen Transformationsansätze wurden für 30 min bei 37°C und 230 rpm im Inkubationsschüttler kultiviert und anschließend ausgestrichen. Je nach eingesetzter DNA-Menge wurden 50-250 µl von dem Transformationsansatz auf Agarplatten (mit dem entsprechenden Antibiotikum) ausgestrichen und über Nacht bei 37°C inkubiert.


[Seite 118↓]

5.1.3.17  Selektion transformierter E. coli-Bakterien

Blau-Weiß-Screening

Beim Blau-Weiß-Screening produzieren die eingesetzten Bakterien eine inaktive β-Galaktosidase, die durch α-Komplementation aktiviert wird. Das für die Komplementation notwendige Protein wird auf dem Plasmid kodiert und enthält einen multiplen Klonierungsbereich. Durch den Einbau eines Inserts in diesen Klonierungsbereich wird die kodierende Sequenz unterbrochen und die Bildung des für die Komplementation notwendigen Proteins unterbleibt. Damit kann keine β-Galaktosidase in den Bakterien synthetisiert werden. Da die β-Galaktosidase das Substrat X-Gal zu einem blauen Farbstoff hydrolysiert, lassen weiße Kolonien auf ein Plasmid mit Insert schließen, wohingegen negative Klone blau gefärbt sind. Zur Isolation von positiven Transformanten wurden die Bakterien nach der Transformation auf LB-Platten mit Antibiotikum, die mit 15 ml 20 % (v/v) IPTG und 50 μl 2 % (w/v) X-Gal in DMF bestrichen waren, aufgebracht.

Kolonie-PCR

Die Kolonie-PCR wurde als zweite Methode zur Isolation von positiven Transformanten eingesetzt: Eine Einzelkolonie wurde mit Hilfe eines Zahnstochers in ein PCR-Reaktionsgefäß, in dem bereits die Komponenten für eine PCR vorgelegt worden waren, überführt. Durch Rühren wurden Bakterien von dem Zahnstocher gelöst, der dann nachfolgend zum Animpfen einer Flüssigkultur diente. Durch Kochen der Bakterien im Verlauf der PCR wurde die Plasmid-DNA freigesetzt und konnte als Matrize zur Amplifikation spezifischer Fragmente dienen (5.1.3.19).

Restriktionsanalyse

Für die Überprüfung der Klonierung mittels Restriktion wurden 12 Kolonien pro Platte einer Transformation ohne vorheriges Blau-Weiß-Screening bzw. 6 weiße Kolonien aus einem Blau-Weiß-Screening zum Animpfen von 3 ml-Minikulturen eingesetzt. Nach der Inkubation der Bakterien-Kulturen bei 37°C über Nacht im Schüttelinkubator wurde die Plasmid-DNA isoliert und geschnitten. Die Restriktionsansätze wurden elektrophoretisch auf einem Agarosegel aufgetrennt, sodass anhand des Bandenmusters erfolgreich transformierte Klone identifiziert werden konnten.


[Seite 119↓]

5.1.3.18  Sequenzanalyse

Für die Sequenzierung wurde hochreine DNA eingesetzt. Die Sequenzierung wurde von der Firma Agowa (Berlin) nach dem Kettenabbruch-Verfahren von Sanger et al. (1977) durchgeführt. Das automatisierte Sequenzierverfahren beruht auf dem Einbau nukleotidspezifischer Farbstoffe während der Sequenzreaktion, die nach Anregung durch Laserlicht einer bestimmten Wellenlänge Licht in einer anderen spezifischen Wellenlänge wieder emittieren. Dadurch können die DNA-Fragmente bereits während der Auftrennung der Sequenzreaktionsprodukte nachgewiesen werden. Ein Computer wertet die aufgenommenen Lichtsignale automatisch aus.

5.1.3.19 Polymerase-Kettenreaktion

Die PCR (Mullis und Faloona, 1987) wurde in dieser Arbeit zur Gewinnung der schistosomalen Promotorenfragmente aus genomischer DNA, zur Amplifikation von cDNA-Sequenzen aus einem Transkriptionsansatz (5.1.3.4), bei der Überprüfung des Transformationserfolges in der Kolonie-PCR (5.1.3.17.2) und zur Isolation von unbekannten Sequenzen in der inversen PCR (5.1.3.19.3) eingesetzt. Sie wurde mit den unter 5.2.6 angegebenen PCR-Primern in einem Thermocycler (Perkin/Elmer, USA) durchgeführt. Zur Durchführung der PCR mit der Taq-Polymerase (Saiki et al., 1988) wurden folgende Substanzen in einem 0,2 oder 0,5 ml PCR-Reaktionsgefäß vereinigt:

5 µl 10x PCR-Puffer

1 µl 10 mM dNTP-Mix

1,5 µl 50mM MgCl2

2 µl 10 µM Primer 1

2 µl 10 µM Primer 2

1-10 µl Vorlagen-DNA

2,5 Einheiten Taq-Polymerase

steriles Wasser ad 50 µl

Im ersten Programmschritt wurde die DNA für 3 min bei 94°C denaturiert. Es erfolgte die Amplifikation in 30-35 Zyklen: 1 min Denaturieren des DNA-Doppelstranges bei 94°C; 1 min Hybridisierung der Primer mit der DNA (5.1.3.19.1), 1 min Polymerase-Reaktion pro 1000 bp bei 72°C. Nach dem letzten Zyklus wurden die Proben 10 min bei 72°C inkubiert, um die Synthese aller DNA-Moleküle durch die Polymerase zu [Seite 120↓]vollenden, zur Klonierung in pGEM-T easy (5.1.3.19.2) wurde dieser Schritt auf 20 min verlängert.

Primerdesign

Zur spezifischen Amplifikation wurden Primer mit einer Länge von 18-25 Nukleotiden eingesetzt, wobei der Anteil an G/C-Nukleotiden ca. 50 % betrug. Um eine bessere Bindung der Primer an die DNA zu ermöglichen und um damit eine fehlerhafte Amplifikation zu verhindern endeten die Primer vorzugsweise mit 1-2 G/C-Nukleotiden am 3‘-Ende. Für die Klonierung konnte am 5‘-Ende eine Restriktionsschnittstelle eingeführt werden, ein weiteres überhängendes Ende aus unspezifischen Nukleotiden am 5‘-Ende sorgte für ein effizientes Schneiden des PCR-Produktes mit dem Restriktionsenzym. Die Schmelztemperatur TM für die PCR wurde mit der Formel:

TM= {22+ 1,46 * [(Anzahl A + Anzahl T) + 2 * (Anzahl G + Anzahl C) ]}*°C

kalkuliert.

Klonierung von PCR-Produkten

Die in der PCR eingesetzte Taq-Polymerase hängt an den 3’-Enden der DNA-Fragmente unspezifisch einen Adenosinrest an, der zur Klonierung in den Vektor pGEM-T-Easy (Stratagene, Heidelberg) mit 3’-T-Überhang genutzt wurde.
Für die Ligation wurde folgender Ansatz pipettiert und nachfolgend über Nacht bei 4°C inkubiert:

5 μl 2x Rapid Ligations Puffer

0,5 μl pGEM-T easy

PCR-Produkt im Verhältnis 1:3

1 μl T4 DNA-Ligase

Wasser ad 10 μl

Inverse PCR

Die inverse PCR (Ochman et al., 1993) ermöglicht es, unbekannte genomische Sequenzen in der Nachbarschaft bekannter Sequenzbereiche zu analysieren. Sie wurde eingesetzt zur Klonierung des 5’-Bereiches des Cathepsin D und des Aktins von S. mansoni.

Nach dem Schneiden von schistosomaler genomischer DNA mit einer Restriktionsendonuklease (5.1.3.7) wurde das Restriktionsenzym durch Hitzeeinwirkung inaktiviert. Die DNA-Fragmente wurden stark verdünnt und durch [Seite 121↓]Ligation (5.1.3.14) zu DNA-Ringen zirkularisiert. Diese DNA-Ringe dienten als Matrize in einer PCR, in der Primer eingesetzt wurden, die eine entgegengesetzte Orientierung aufwiesen. Die PCR-Amplifikate wurden über ein Agarosegel aufgetrennt (5.1.3.8) und in pGEM-T easy (5.1.3.20.2) zur Sequenzierung kloniert.

5.1.4 Zellbiologische Methoden

5.1.4.1 Zellkultur

Kultur von HeLa- und cos7-Zellen

HeLa-Zellen wurden in RPMI komplett mit nicht inaktiviertem fetalem Rinderserum (FCS) bei 37°C und 5 % CO2 (Standardbedingungen für die Zellkultur)kultiviert. Zellen in konfluent bewachsenen Zellkulturflaschen wurden zur Passagierung zunächst zweimal mit 1 x PBS gewaschen. Anschließend wurden die Zellen durch Trypsin/EDTA-Verdau bei 37°C für 2 min vom Boden gelöst. Das Trypsin wurde inaktiviert durch Zugabe von RPMI komplett. Die Zellen wurden bei 800 rpm zentrifugiert und 1:4 in frischem RPMI komplett verdünnt in neue Zellkulturflaschen überführt. Cos7-Zellen wurden unter den gleichen Bedingungen in RPMI komplett mit hitzeinaktiviertem FCS kultiviert. Zur Passagierung wurden diese Zellen mit dem Zellschaber gelöst und in neue Zellkulturflaschen überführt.

Einfrieren von Zellen

Zellen wurden in FCS, dem 10 % DMSO zugefügt worden war, durch langsames Abkühlen in einer Styroporbox bei –80°C eingefroren. Nach 24 h wurden die Zellen in flüssigen Stickstoff überführt.

Zellzahlbestimmung

Die Zellzahl wurde mit Hilfe der Neubauerzählkammer bestimmt, tote Zellen wurden zur Unterscheidung von lebenden Zellen mit Trypan-Blau (Sigma, München) angefärbt und bei der Bestimmung der Zellzahl nicht berücksichtigt.

Methoden zur genetischen Transformation von Zellen

A) DEAE-Dextran

Durch Inkubation von DNA mit DEAE-Dextran werden bei dieser Methode DNA-haltige Komplexe erzeugt, die sich an die Zelloberfläche heften und
die Aufnahme der DNA in die Zelle durch Endocytose ermöglichen.
105 Zellen wurden am Vortag der Transfektion pro Vertiefung einer 6-Loch-Platte ausgesät. Nachdem die Zellen einmal mit 1 x PBS gewaschen worden waren, [Seite 122↓]wurden sie in 4 ml Dulbeccos Modiefied Eagel Medium (DMEM) komplett kultiviert. Pro Transfektionsansatz wurden 4 μg DNA in sterilem 1 x TBS gelöst. Zu der gelösten DNA wurden 80 μl DEAE-Dextran (10mg/ml) zugegeben. Diese Lösung wurde den Zellen zugesetzt. Nach einer Inkubation von 4 h bei 37°C wurde das Transfektionsmedium entfernt. Die Aufnahme von DNA in die Zellen wurde erhöht, indem sie für 1 min in 1 x PBS inkl. 10 % DMSO bei RT inkubiert wurden. Danach wurden sie einmal mit 1 x PBS gewaschen und unter Standardbedingungen weiterkultiviert.

B) Lipofektion

Die Transfektion von HeLa Zellen erfolgte mit einem für die Transfektion von Endothelzellen optimiertem Materialsatz Lipofectin Reagent (Invitrogen, Karlsruhe). Lipofectin ist ein synthetisches Lipidpolymer, das unter physiologischen
Bedingungen mit der Zellmembran verschmilzt und so eine effiziente
DNA-Aufnahme durch Endozytose in die Zelle ermöglicht.
Am Vortag der Transfektion wurden 105 Zellen pro Vertiefung einer 12-Loch-Platte ausgesät. 2 μg DNA und 8 μl Lipofectin wurden separat in 100 μl serumfreien DMEM für 30 min bei RT inkubiert. Nach dem Mischen beider Lösungen wurde die fertige Transfektionslösung 30 min bei RT inkubiert. Die Transfektionslösung wurde mit 800 μl DMEM ergänzt und zu den Zellen gegeben, die zuvor mit 1 x PBS gewaschen worden waren. Die Inkubation in dem Transfektionsmedium erfolgte für mindestens 6 h unter Standardbedingungen. Anschließend wurde das Transfektionsmedium durch RPMI komplett ersetzt.

C) Elektroporation

106 cos7-Zellen wurden für die Elektroporation (5.1.2.2) in RPMI komplett mit 5 mg DNA bei RT in 4mm Elektroporationsküvetten (peqLAB, Erlangen) für 10 min inkubiert. Elektroporiert wurde bei einer Feldstärke von 3,75 kV/cm mit 1-2 Pulsen von 90 μs Länge. Nach der Elektroporation wurden die Zellen in den Küvetten für 30 min bei 37°C gehalten, bevor sie wieder in Zellkulturflaschen überführt und unter Standardbedingungen für die Zellkultur weiterkultiviert wurden.

Zur Induktion des HSP70-Promotors wurden Zellen 24 h nach der Transfektion für 4 h bei 42°C inkubiert und dann bei 37°C unter Standardbedingungen für die Zellkultur weiterkultiviert.


[Seite 123↓]

5.1.4.2  Mikroskopie

Lichtmikroskopische und epifluoreszenzmikroskopische Arbeiten wurden an einem Zeiss Axioplan Fluoreszenzmikroskop mit Blaulichtfilter Nr. 487909 und Grünlichtfilter Nr. 487915 durchgeführt. Mit Hilfe eines Kameraaufsatzes und einer elektronischen Steuereinheit für die Kamera wurden mikroskopische Bilder nach der Bedienungsanleitung des Herstellers aufgenommen. Zur Verbesserung der Detektion von EGFP-Fluoreszenz wurde das Leica DM/R Mikroskop mit digitaler Bildspeicherung eingesetzt. Konfokale Laser-Scanning Mikroskopie wurde durchgeführt an einem Leica TCS SP Mikroskop mit einem Argon/Krypton-Gaslaser (Leica). Der Laser wurde auf 50-60 % eingestellt, die Anregungswellenlänge für GFP war 488 nm. Störende endogene Fluoreszenz unter der Blaulichtanregung wurde durch Quenchen mit Trypan-Blau nach der Methode von Loike und Silverstein (1983) verhindert.

5.1.4.3 Methoden zur histologischen Untersuchung

Nachweis der β-Galaktosidaseaktivität in fixierten Zellen und Geweben

Zur histologischen Untersuchung mussten Zellen nach ihrer Transfektion in einem geeigneten Kulturgefäß (35 mm Petrischale oder 6 Loch-Platte) kultiviert werden. 48 h nach der Transfektion mit β-Galaktosidase exprimierenden Plasmiden wurden die Zellen zweimal mit 1 x PBS gewaschen, die Fixierung der
Zellen erfolgte für 10 min in 1 x PBS inkl. 1 % Glutaraldehyd unter leichtem Schwenken. Nach der Fixierung wurden die Zellen dreimal mit 1 x PBS inkl.
1mM MgCl2 vorsichtig gewaschen, ohne sie vom Boden des Kulturgefäßes zu lösen. Danach wurden die fixierten Zellen in der Färbelösung bei
37°C inkubiert bis die gewünschte Färbung erreicht wurde.
Ganze Schnecken wurden nach dem Entfernen der Gehäuse für 45 min in Fixierlösung auf Eis unter leichtem Schwenken fixiert. Dann wurden die fixierten Proben dreimal für 15 min mit Waschpuffer gewaschen und mit der Färbelösung über Nacht bei 37°C unter Schütteln im Dunkeln inkubiert. Nach drei weiteren Waschschritten für 10 min mit 1 x PBS wurden die Proben in Bouin-Lösung nachfixiert und bei 4°C gelagert (5.2.16).

Gefrierschnitte

Die Gehäuse der Schnecken wurden unter dem Binokular entfernt. Nach einem kurzen Waschen in 1 x PBS wurden die Schnecken in die Mitte von [Seite 124↓]Einbettungsschalen platziert und mit dem Einbettungsmedium Tissue Tec bedeckt. Ein rasches Einfrieren wurde erreicht, indem die Einbettungsschalen während des ganzen Vorgangs auf Trockeneis inkubiert wurden. Eingefrorene Proben wurden bis zu ihrer Aufbereitung bei –80°C gelagert. Das Schneiden von 10 μm Schnitten wurde im Cryocut (Reichert-Jung (Leica), Solms) durchgeführt. Die Schnitte wurden auf beschichtete Objektträger (Superfrost/Plus, Roth, Karlsruhe) überführt und nachfolgend für 10 min in 1 x PBS inkl. 2,5 % Paraformaldehyds fixiert.

Paraffinschnitte

Gehäuse zu untersuchender Schnecken wurden mit Hilfe einer Pinzette unter dem Binokular entfernt, die anschließende Fixierung erfolgte in Bouin-Lösung bei RT. Die anschließende histologische Aufarbeitung der Proben wurde von Frau Marko und Dr. Bleiß (AG Elektronenmikroskopie; Lehrstuhl für Molekulare Parasitologie; Humboldt-Universität) durchgeführt: Die Proben wurden mit 70 % Ethanol gewaschen, in 100 % Ethanol entwässert und in Xylol überführt. Dann erfolgte die Einbettung in Paraplast Plus (Paraffin) unter Einsatz von Standardmethoden (Romeis. 1989; Lemos and Andrade, 2001). Fünf-Mikrometer-Semidünnschnitte wurden mit Haematoxylin und Eosin gefärbt und mikroskopisch untersucht.

5.1.5 Biochemische Methoden

5.1.5.1 Proteingesamtextraktion aus B. glabrata und S. mansoni

20-40 adulte Würmer oder der Hepatopankreas einer Schnecke wurden zunächst mit kleinen Pistillen in 1,5 ml Reaktionsgefäßen gemörsert. Für den anschließenden Zellaufschluss wurde ein Ultraschallgerät (Heinemann, Schwäbisch Gmünd) eingesetzt. Die Proben wurden nach Zugabe von 500 μl 1 x PBS auf Eis für 3 min bei 180 Pulsen pro Minute homogenisiert. Anschließend wurde der Extrakt für 5 min bei 10000 g zentrifugiert und bei –20°C gelagert.

5.1.5.2 Konzentrationsbestimmung von Proteinen

Zur Bestimmung der Konzentration von Proteinlösungen wurde die Methode von Bradford (1976) eingesetzt. Dazu wurde der Materialsatz Bio-Rad Protein Assay (Biorad, München) nach Angaben des Herstellers verwendet.

5.1.5.3 SDS-Polyacrylamidgelelektrophorese

Bei der SDS-Gelelektrophorese werden Proteine in Anwesenheit von Natriumdodecylsulfat (SDS) auf Grund ihres Molekulargewichtes im Polyacrylamidgel [Seite 125↓]aufgetrennt (Laemmli, 1970). Die Proteine werden denaturiert und durch Anlagerung von SDS negativ geladen.

Für die Auftrennung von Proteinen wurden 6 %ige Sammelgele und 10 %ige Trenngele verwendet. Eine Proteinprobe wurde im Verhältnis 1:1 mit 2 x Probenpuffer versetzt, nachfolgend für 5 min bei 95°C erhitzt und für 5 min bei 12000 rpm in der Tischzentrifuge abzentrifugiert. Der Überstand wurde auf das Gel aufgetragen und bei 120 V für 1,5 h aufgetrennt. Zur Visualisierung der Proteine im Gel, wurde es mit Coomassie-Lösung gefärbt und anschließend mehrfach in Entfärbelösung entfärbt.

5.1.5.4 Nachweis der β-Galaktosidase-Aktivität im Proteingesamtextrakt

Zum Nachweis der β-Galaktosidase-Aktivität wurde das High sensitivity β-Galactosidase Assay Kit (Stratagene, Heidelberg) nach Angaben des Herstellers eingesetzt. Grundlage ist die Spaltung von Chlorophenol-Rot-β-D-Galaktopyranosid (CPRG) in Galaktose und das Chormophor Chlorophenol -Rot, durch die β-Galaktosidase. Der damit verbundene Farbumschlag von
gelb nach rot lässt sich photometrisch durch Messung der Extinktion bei 570 nm quantifizieren.
Cos7-Zellen wurden in dem Lysis-Puffer aufgeschlossen, für die Messung von β-Galaktosidase-Aktivität von Schnecken oder Würmern wurde der Proteingesamtextrakt eingesetzt (5.1.5.1).

5.1.6 Immunologische Methoden

5.1.6.1 Western-Blot

Der immunologische Nachweis von Proteinen wurde nach der Methode von Towbin et al. (1979) durchgeführt. Im SDS-Polyacrylamidgel aufgetrennte Proteine (6.1.5.3) wurden über Nacht in Transferpuffer bei 80 mA auf eine Nitrocellulosemembran geblottet. Zur Blockierung unspezifischer Bindungen wurde die Membran 1 h in Blocklösung inkubiert und anschließend dreimal für 5 min in 1 x PBS-T gewaschen. Es folgte die Inkubation mit dem ersten an E. coli-Lysat präadsorbierten Antikörper (Kaninchen-Antiserum gegen EGFP bzw. Maus-Antiserum gegen EGFP) in einer Verdünnung von 1:200 in 1 x PBS-T. Nach 1 h wurde die Membran wiederum für dreimal 5 Minuten 1 x PBS-T gewaschen und mit dem zweiten Antikörper (Peroxidase-konjugierter Anti-Kaninchen bzw. Anti-Maus-Antikörper) in einer [Seite 126↓]Verdünnung von 1:2500 für eine Stunde inkubiert. Wiederum wurde dreimal für 5 min mit 1 x PBS-T gewaschen. Die Entwicklung des Blots fand in Peroxidase-Substratlösung statt. Waren die Banden gut sichtbar, wurde die Enzymreaktion durch Zugabe von Wasser abgestoppt.

5.1.6.2 Immunhistochemie

Fixierte Gefrierschnitte (5.1.4.3.2) wurden zum Waschen 1 min in 1 x PBS inkubiert. Nachfolgend wurde die endogene Peroxidase-Aktivität durch Inkubation in Methanol inkl. 0,3 % H2O2 geblockt. Die Schnitte wurden dreimal für 5 min in 1 x PBS-T gewaschen und über Nacht bei 4°C mit dem ersten Antikörper (Kaninchen-Antiserum gegen EGFP bzw. Maus-Antiserum gegen EGFP) in einer Verdünnung von 1:100 bis 1:400 inkubiert. Nach dem Waschen für 10 min in 1 x PBS-T wurden die Schnitte für 30 min bei RT mit dem zweiten Antikörper (Peroxidase-konjugierter Anti-Kaninchen bzw. Anti-Maus-Antikörper) in einer Verdünnung von 1:800 inkubiert. Mit 1 x PBS-T wurde für 10 min gewaschen und die Schnitte mit der DAB-Färbelösung inkubiert. Gestoppt wurde die Reaktion durch Inkubation der Schnitte in 1 x PBS.

5.1.7 Datenverarbeitung

Die Auswertung von Sequenzdaten und die Suche nach Sequenzen erfolgte mit Programmpaketen, die im Internet zur Verfügung standen (National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/ und TIGR Schistosoma mansoni Gene Index (SMGI) http://www.tigr.org/tdb/tgi/smgi/); Promotoranalysen wurden mit dem MatInspector (Quandt et al., 1995) unter http://www.genomatix.de durchgeführt. Die statistische Auswertung durch den Student’schen T-Test wurde unter http://www.bio.miami.edu/rob/perls_t/ durchgeführt.

Fotos von Mikroskopischen Präparaten wurden gescannt, die Kontrastverstärkung und Tonwertkorrektur wurde mit Adope Photoshop 5.0 durchgeführt; zusammengestellt und beschriftet wurden die Bilder in Microsoft PowerpointX:Mac.


[Seite 127↓]

5.2  Materialien

5.2.1 Laborgeräte

Binokular

Leica, Solms

Cryocut E Reichert-Jung

Leica, Solms

Elektroporator BTX ECM830

Qbiogene, Heidelberg

Mikroinjektionsnadelhersteller

Kopf Instruments, USA

Mikroinjektor 5242

Eppendorf, Hamburg

Mikromanipulator

Leitz, Wetzlar

Mikroprojektil-Schießanlage, PDS-1000/He

Biorad, München

Mikroskope

 

Leica TCS NT

Leica, Solms

Zeiss Axioplan

Zeiss, Oberkochen

Leica DM/R

Leica, Solms

Photometer

Eppendorf, Hamburg

Thermocycler GeneAmp PCRSystem9600

Perkin/Elmer, USA

Ultraschallgerät HD 200

Heinemann, Schwäb.Gmünd

Videodokumentationsanlage

Herolab, Wiesloch

Zentrifugen 5810R, 5415C und 5417R

Eppendorf, Hamburg

5.2.2 Verbrauchsmaterialien

Die allgemeinen Verbrauchsmaterialen für das Labor (Petrischalen; Pipettenspitzen; 0,2, 0,5, 1,5 und 2 ml Reaktionsgefäße; Gefrierröhrchen; 12, 14 und 50 ml Polypropylen-Röhrchen) wurden von Greiner (Nürtingen) bezogen. Verbrauchsmaterialen für den Mikroprojektilbeschuss (Macro-u. Microcarrier; Rupture Discs; Stopping Screens) stammten von Biorad (München) und die Verbrauchsartikel für die Zellkultur (6 u. 12 -Lochplatten, Petrischalen, Zellkulturflaschen) wurden von Costar (Bodenheim) hergestellt.


[Seite 128↓]

Einbettungsmedium Tissue Tek

Sakura Finetek, Niederlande

Einbettungsschalen

Roth, Karlsruhe

Elektroporationsküvetten (4mm)

peqLab, Erlangen

Filme

 

Fujicolor HG 1600 und Superia 400

Fuji, Japan

Professional T400 CN

Kodak, USA

Einwegkanülen- u. spritzen

Braun, Melsungen

Einwegpasteurpipetten

Greiner, Nürtingen

Gel-Blotting-Papier

Schleicher & Schuell, Dassel

Glaskapillaren zur Mikroinjektion

Kopf Instruments, USA

Mikroinjektionsnadeln

Clark Elektromedical Instruments, GB

Nitrocellulosemembran

Schleicher & Schuell, Dassel

Petrischalen mit Polycarbonat-Membraneinsatz

Costar, Bodenheim

Objektträger und Deckgläschen

Roth, Karlsruhe

Sterilfilter

Schleicher & Schuell, Dassel

5.2.3 Reagenzien

Die allgemeinen Chemikalien stammten von den Firmen Roth (Karlsruhe), AppliChem (Darmstadt) und Sigma (München) und besaßen „zur Analyse“-Qualität; für die Zellkultur oder die Kultur von Parasiten wurden Chemikalien eingesetzt, die lt. Hersteller für die Molekularbiologie getestet waren. Organische Lösungsmittel wurden außerdem von Merck, Darmstadt und von der Humboldt-Universität bezogen.


[Seite 129↓]

Acrylamid / Bisacrylamid-Lösung

Roth, Karlsruhe

Agar-Agar

AppliChem, Darmstadt

Agarose NEEO

Roth, Karlsruhe

Ammoniumperoxidisulfat (APS)

Roth, Karlsruhe

Antibiotika

AppliChem, Darmstadt; Serva, Heidelberg

ATP-Dinatriumsalz

AppliChem, Darmstadt

Bromphenolblau

Sigma, München

Chlornaphtol

Serva, Heidelberg

Chloroform

Merck, Darmstadt

Coomassie Brilliant Blau R250

AppliChem, Darmstadt

3,3'-Diaminobenzidin-HCl (DAB)

AppliChem, Darmstadt

Diethylaminoethyl-Dextran (DEAE-Dextran)

Sigma, München,

DNA-Größenmarker

 

1-kb-DNA-Leiter

Rapidozym, Berlin

SmartLadder DNA-Marker

Eurogentec, Belgien

Dithiothreitol (DTT)

Promega, Mannheim

Dodecylsulfat Natriumsalz (SDS)

Merck, Darmstadt

Dulbecco’s MEM

Biochrom KG, Berlin

dNTP-Mix

Rapidozym, Berlin

Ethylendiaminotetraessigsäure (EDTA)

Sigma, München

Ethylendioxy-bis-(ethylennitrilo)-tetraessigsäure (EGTA)

Sigma, München

Ethidiumbromid

Merck, Darmstadt

Fetales Kälberserum (FCS)

Biochrom KG, Berlin

Ficoll 400 und 1600

Serva, Heidelberg

Fluoreszein-Isothiocynat (FITC) Oligonukleotide

MWG Biotech, Ebersberg

Glutaraldehyd

Sigma, München

Hefeextrakt

Roth, Karlsruhe

Isopropyl-b-D-thiogalactopyranosid (IPTG)

AppliChem, Darmstadt

L-Glutamin

Biochrom KG, Berlin

L-Serin

Sigma, München

MEM-Aminosäurelösung

Sigma, München

MEM-Vitamin-Lösung

Sigma, München

Metofane

nicht mehr hergestellt

Milchpulver

AppliChem, Darmstadt

Natriumdeoxycholat

Sigma, München

Nonidet P-40

Sigma, München

Penicillin-Streptomycin-Lösung

Biochrom KG, Berlin

Piperazin-1,4-bis-(2-ethansulfonsäure) (PIPES)

AppliChem, Darmstadt

Propidiumiodid

Sigma, München

Proteingrößenmarker

New England Biolabs, Schwalbach

RPMI 1640

Biochrom KG, Berlin

Spermidin

Sigma, München

Trypan-Blau

Sigma, München

Trypsin-EDTA-Lösung

Gibco/LifeTechnologies, Karlsruhe

Trypton

Roth, Karlsruhe

5-Brom-4Chlor-3-indonyl-b-D-galactopyranosid
(X-Gal)

Roth, Karlsruhe

Xylencyanol

Fluka, Neu-Ulm

5.2.4 Enzyme

Alkalische Phosphatase

New England Biolabs, Schwalbach

DNase (RNAse frei)

Stratagene, Heidelberg

Klenow-Fragment

New England Biolabs, Schwalbach

Lysozym

AppliChem, Darmstadt

Proteinase K

Boehringer, Mannheim

Restriktionsenzyme

New England Biolabs, Schwalbach

M-MLV Reverse Transkriptase (H-)

Promega, Mannheim

RNase A

Qiagen, Hilden

RNase Block

Stratagene, Heidelberg

Taq-Polymerase

Rapidozym, Berlin

T4 DNA Ligase

New England Biolabs, Schwalbach

5.2.5 Kommerzielle Kits


[Seite 130↓]

DNeasy Tissue Kit

Qiagen, Hilden

High sensitivity Beta-GAL Assay Kit

Stratagene, Heidelberg

Lipofectin Reagent

Invitrogen, Karlsruhe

Nucleobond Plasmid Midi Kit

Clontech, Heidelberg

Nucleospin Plasmid Mini Kit

Clontech, Heidelberg

Nucleospin Extraction Kit

Clontech, Heidelberg

pGEM-T Easy Vector System I

Promega, Mannheim

Proteinnachweis nach Bradford

Biorad, München

QIAshredder

Qiagen, Hilden

RNeasy Mini Kit

Qiagen, Hilden

5.2.6 Primer


[Seite 131↓]

P-505-F

ATGACGGAACACTCACCTAAGG

P-532-F

AAGTTAAAATCTATTCCCCC

P-557-F

CGATTCAGTTAACGCCATTTTGG

P-622-F

ATGCACGGAATCACGGAC

P-1982-F

CCCTAAAAAGGACAGCAACGATTG

P-2010-F

CCAACTGATGTTTATCGGCGTC

P-2193-R

GAGTGATGATGGCGGTTTTAGG

P-2429-R

GGTTCCGATTTGGCATTTCTG

P-3430-F

GCTGTCAGAAATCTAAGG

P-3447-R

CCTTAGATTTCTGACAGC

P-4464-R

CTACGTGCAATAGTCGTTAAGATGTTCTGG

P-4882-R

ACATACAACTGATGGTCG

Aktininvers1

GATCTTGACTGAGAGAGG

Aspinvers1

GAAGAACTAGAAGCAGC

Aspinvers2

GTTGCATCTGAAGTGG

Aktin-for

CCCCCAAGCTTAGACACCTAATC

Aktin-rev

CCCCCGAATTCTTTACTAGATGATGAGAC

Asp-for

CCCCCAAGCTTACTGGGAGCATAA

Asp-rev

CCCCCGAATTCCTTATCATTCAA

Cal-for

GCGCGGAATTCCTAACCGAATCTATTCTG

Cal-rev

GCGCGAAGCTTCCTGACAGACAAAACCGTG

Gst-for

GCGCGGAATTCGTGAATGCGACTGCTGAGG

Gst-rev

GCGCGAAGCTTCTTGCAAATAGACAAAAC

Hsp-for

GCGCGGAATTCGATTAGCACTAAG

Hsp-rev

GCGCGAAGCTTTCCAAGATATGTTAAGAC

Hsp-revBamHI

GCGCGGGATTCTCCAAGATATGTTAAGAC

LTR-for

CCCCCAAGCTTCCGTACACTAAATGGGGACG

LTR-rev

CCCCCGAATTCTGTACCAGATCACGTCAGGC

DsRed-for

ATTTATCCCGGGATGGCCTCCTCCGAGGAC

DsRed-rev

ATTTATGCGGCCGCCTACAGGAACAGGTGG

Hsp3’-for

CCCCCTCTAGACCTATAATTGTTGTGATAAATTG

Hsp3’-rev

CCCCCAAGCTTAGAACCCTTCCACGGTGTG

EGFP-for

CCCCCGAATTCATGGTGAGCAAGGGCGAG

EGFP-rev

CCCCCAAGCTTACTTGTACAGCTCGTC

EGFP-nestedfoR

GCAGTGCTTCAGCCGCTA

EGFP-nestedrev

TAGTGGTTGTCGGGCAGC

Cytox-for

GATTTGCGCTATGGCTTC

Cytox-rev

GGCCATCACCATACTAGC

oligo-dT

15-18 T

5.2.7 Agarosegelelektrophoresepuffer

10 x TAE

0,4 M Tris-Acetat

0,01 M EDTA (pH 8)

1,14 % Eisessig

  

Ethidiumbromidlösung

10 mg / ml in H2O

  

6 x Probenpuffer

0,2 % Bromphenolblau

0,25 % Xylencyanol

15 % Ficoll

5.2.8 Puffer für Plasmidpräparationen nach Willimzig (1985)

TELT-Lösung

50 mM Tris/HCl pH 8

62,5 mM EDTA

2,5 M LiCl

0,4 % Triton X-10

5.2.9 Bakterien und Zelllinien

XL-1 Blue

Stratagene, Heidelberg

GM2163 (Dam-/Dcm-)

New England Biolabs, Schwalbach

HeLa-Zellen

Adenocarcinoma-Zellen, Homo sapiens

COS7-Zellen

Nierenzellen, Cercopithecus aethiops

5.2.10 Plasmide


[Seite 132↓]

pEGFP-N1

(EGFP-Sequenz, kanR)

BD Biosciences Clontech, USA

pBluescript SK+

(Klonierungsplamid, ampR)

Stratagene, Heidelberg

pUC19

(Klonierungsplamid, ampR)

Yanisch-Perron et al., 1985

pSLfa1180fa

(Klonierungsplasmid, ampR)

E. Wimmer, Bayreuth

pDsRed

(DSRed-Sequenz, ampR )

D. Buhmann, Berlin (2003)

pb-Gal

(b-Galaktosidase-Sequenz, ampR)

A. Mißlitz, Berlin (2000)

pPD118.20

(C.elegans-Konstrukt, ampR )

Fire Lab (1997)

5.2.11 Bakterienkultur-Medien

LB-Medium

10 g Trypton

5 g Hefeextrakt

5 g NaCl

ad 1l H2O

pH 7,0

  

LB-Agar

LB-Medium

1,5 % Agar-Agar

  

SOC-Medium

20 g Trypton

24 g Hefeextrakt

0,5 g NaCl

25 mM KCl

250 mM MgCl2

20 mM sterilfiltierte Glucose

pH 7,0

H2O ad 1 l

  

TB-Puffer

10 mM PIPES

55 mM MnCl2

15 mM CaCl2

250 mM KCl

  

X-Gal-Stammlösung

20 mg/ml in DMSO

  

IPTG-Stammlösung

1 M in H2O

  

1000 x Ampicillin

100 mg/ml in H2O

  

1000 x Kanamycin

50 mg/ml in H2O


[Seite 133↓]

5.2.12  SDS-Polyacrylamid-Gele


[Seite 134↓]

Laufpuffer

14,41 g Glycin

3,03 g Tris

1 g SDS

H2O ad 1l

  

2 x Probenpuffer

125 mM Tris/HCl (pH 6,8)

4 % SDS

20 % Glycerin

0,2 % Bromphenolblau

  

Acrylamid / Bisacrylamid-Lösung

29,2 % Acrylamid

0,8 % Bisacrylamid

  

APS

10 % in H2O

  

Lösung L

1,5 M Tris/HCl (pH 8,4)

0,4 % SDS

  

Lösung M

0,5 M Tris/HCl (pH 6,8)

0,4 % SDS

  

Sammelgel 6 %

375 µl Acrylamid-Stock

625 µl Lösung M

2,5 µl TEMED

1,5 ml H2O

25 µl APS

  

Trenngel 10 %

1,7 ml Acrylamid-Stock

1,25 ml Lösung L

5 µl TEMED

2 ml H2O

50 µl APS

Färbelösung

10 % Essigsäure

20 % Ethanol

0,2 % Coomassie Blau R-250

 

Entfärbelösung

10 % Essigsäure

20 % Ethanol

5.2.13 Immunoblot

Transferpuffer

25 mM Tris-HCl

192 mM Glycin

10 % Methanol

  

1 x PBS

137 mM NaCl

2,7 mM M KCl

8,1 mM Na2HPO4

1,5 mM KH2PO4

pH 7,4

  

Waschpuffer (1 x PBS-T)

Tween 500 µl

1 x PBS ad 1l

  

Blockpuffer

5 % Magermilch in Waschpuffer

  

Peroxidase-Substratlösung

10 ml 1 x TBS

600 µl 0,3 % Chloramphenicol

5 µl 30 % H2O2

  

primäre Antikörper

Kaninchen-Antiserum gegen EGFP

Maus-Antiserum gegen EGFP

Maus-Infektionsserum gegen Schistosoma

mansoni

  

sekundäre Antikörper

IgG Ziege-Anti-Kaninchen, Peroxidase-

gekoppelt

IgG Ziege-Anti-Maus, Peroxidase-gekoppelt

Dianova, Hamburg

5.2.14 Medien für die Zellkultur


[Seite 135↓]

RPMI komplett

RPMI 1640

0,002 M L-Glutamin

100 U/ ml Penicillin

100 µg/ml Streptomycin

5-10 % FCS

 

1 x TBS

1 M NaCl

0,05 M Tris

pH 7,4

  

Dulbecco’s MEM (DMEM) komplett

Dulbeccos MEM

0,002 M L-Glutamin

100 U/ ml Penicillin

100 µg/ml Streptomycin

5 % hitzeinaktivierten FCS

5.2.15 Mikroinjektionspuffer

1 x Mikroinjektionspuffer für Sporozysten

10 mM Tris pH 7,4

0,25 mM EDTA

5.2.16 Puffer für die β-Galaktosidase-Färbung


[Seite 136↓]

1 x Natriumphosphatpuffer 0,1 M pH 7,3

11,5 ml 1 M NaH2PO4

38,5 ml 1 M Na2HPO4

H2O ad 500 ml

  

für Zellkultur-Zellen

 
  

Fixierlösung

1 % Glutaraldehyd in 1 x PBS

  

Waschpuffer

1 mM MgCl2 in 1 x PBS

  

Färbelösung

250 µl 20 mM K4Fe(CN)6*3H2O in 1 x PBS

250 µl 20 mM K3Fe(CN)6 in 1 x PBS

1 µl 1 M MgCl2

50 µl 2 % X-Gal

1 x PBS ad 1 ml

  

für Schnecken

 
  

Fixierlösung

0,4 ml 25 % Glutaraldehyd

1 ml 250 mM EGTA pH 7,3

5 ml 1 M MgCl2

43, 5 ml 0,1 M Natriumphosphatpuffer pH 7,3

0,02 % Nonidet P-40

  

Waschpuffer

1ml 1 M MgCl2

5 ml 1 % Natriumdeoxycholat in H2O

5 ml 2 % Nonidet P-40 in H2O

0,1 M Natriumphosphatpuffer pH 7,3 ad 500 ml

  

Färbelösung

180 µl 1 M X-Gal in DMSO

0,159 g K4Fe(CN)6*3H2O

0,123 g K3Fe(CN)6

Waschpuffer ad 75 ml

5.2.17 Puffer für die Immunohistochemie

Fixierlösung

2,5 % Glutaraldehyd in 1 x PBS

  

Blockpuffer (endogene Peroxidase)

0,4 % H2O2 in Methanol

  

Blockpuffer (Fc Rezeptoren)

2 % unspezifisches Serum in 1 x PBS-T

  

Peroxidase-Substratlösung (DAB-Lösung)

0,1 % NiCl

4 µl DAB (25 mg/ml)

32 µl 0,4 % H2O2

160 µl 1 x PBS

5.2.18 Tiere und Medien zu ihrer Haltung


[Seite 137↓]

BALB/c-Mäuse, Inzucht-Stamm (Mus musculus)

institutseigene Zucht

  

Wüstenrennmaus, Inzucht-Stamm (Meriones unguiculatus)

institutseigene Zucht

  

Wasserlungenschnecken (Biomphalaria glabrata) (Stamm Puerto Rico)

Dr. M. J. Doenhoff (School of Biological Sciences, University of Wales)

  

Pärchenegel (Schistosoma mansoni)

(Stamm Puerto Rico)

Dr. M. J. Doenhoff (School of Biological Sciences, University of Wales)

 

Caenorhabditis elegans

institutseigene Zucht

  

100 x H2O zur Schneckenhaltung

16,5 g CaCl2

0,3 g K2CO3

1 g NaOH

10,5 g MgCl2*6H2O

2 g NaHCO3

1 g CaCO3

H2O ad 1 l

MEMSE-J (Sporozystenkulturmedium)

(Kawanaka et al., 1986)

20 ml MEM-Aminosäure-Lösg. 50 x

300 mg L-Glutamin 300 mg

10 mg Glycin

30 mg L-Serin

10 ml MEM-Vitamin-Lösg. 100 x

6,8 g NaCl

400 mg KCl

200 mg CaCl2

200 mg MgCl2*6H2O

150 mg NaH2PO4*2H2O

2 g NaHCO3

2 g Glucose

10 ml Pen-Strep-Lösung

H2O ad 900 ml; pH 7,2

100 ml FCS; sterilfiltrieren


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
24.05.2004