Material und Methoden

2.1 Material

2.1.1  Oligonukleotide

↓11

Oligonukleotidname

Sequenz (5`- 3`)

Beschreibung

RACEUMP-F

GGGTCGACTGACGGTAACGGG

für Amplifikation POMP-L mRNA

RACEUMP-R

TCCAATTTGAGAGTTGCCCACTG

für Amplifikation POMP-L mRNA

UMP-F

GATGGTGGAATATAAACT TGG

für Amplif. Sonde POMP für Northern Hybridisierung

UMP-Probe-R

TAATACGACTCACTATAGGGTGTCAGTACTTTTAATGTG

für Amplif. Sonde POMP für Northern Hybridisierung

PPP1

CGCGGATCCGGCTGGTCTTGAACTCCTGA

4 kb POMP Promotor, 5` Primer

PPP5

TGTCCCTCCAACCTCATCTC

2,2 kb POMP Promotor, 5` Primer

PPP6bSac

CGAGCTCGCAATTCAAAGGGCCCAACA

0,7 kb POMP Promotor, 5` Primer; 5` Sac-Schnittstelle

PPP8

CTCTGCGAACAGCCTCTCTG

Ampl. 2,2 kb POMP Promotor 3` Primer

PI1-F

CAGAGAGGCTGTTCGCAGAG

Ampl. POMP Intron 1; 5` Primer

PI1-R

CAAAAGGTCCACTTGCTGAA

Ampl. POMP Intron 1 3` Primer

PI1-2kbF

GGAATTCCCATCATAAGTCAAGGAGCA

Intron 1 Fragmentirerung, 5`

PI1-2kbR

GGAATTCGGTTACTTCCTAATAAATCC

Intron 1 Fragmentirerung, 3`

.2051

TCCAGAAGGGAAGAGATTTGTC

MECL1-Promotor; 5` (Foss and Prydz, 1999)

2334rev

GCAGAGGGGATTAGGGGTC

MECL1-Promotor; 3` (Foss and Prydz, 1999)

PPP-1R

TCGACCCCGCCGCTCACTTC

POMP Promotor ohne Teile der 5`-UTR

PPP-210R

GAGGGAAGACACGGACTCCG

POMP Promotor ohne ersten 210 Basen

PP3UTRXba-F

GCTCTAGATAGTGTGCTGTTCATGGAAAC

POMP 3`-UTR; 5` Primer ; 5`- XbaI – Schnittstelle

PP3UTRXba-R

GCTCTAGAAAAATGTAAATTTTTATATATCAAC

POMP 3`-UTR; 3` Primer; 5`- XbaI – Schnittstelle

PdPXho-R

CCGCTCGAGTCTTTCTCCTCCGGTACTGC

β1(δ)-Promoter, 3` Primer

PdPBam-0.63F

cgcggatccCACTTTAGCCCAAAGACTCT

0,6 kb β1(δ)-Promoter, 5` Primer

PdPBam-1.5F

CGCGGATCCCCAGTATAAAAAGACAAATAG

1,5 kb β1(δ)-Promoter, 5` Primer

PP-UTR-Luc F

GGATGGATGGCTACATTCTG

Kontrolle 3`-UTR; forward; Position 1530 auf pGL3control (im Luciferase Gen)

PP-UTR-Luc R

TATAATCCTAAAATAGCACT

Kontrolle 3`-UTR; 3` ; Position 951 Ac.Nr. BC003390 POMP 3`-UTR

Pdp100-Sac-F

GAGCTCGAGTAGCTTCGCTCCCAGAA

100 Basen β1(δ)-Promoter; forward; 5` SacI-Schnittstelle

Pdp40-Sac-F

CTTTACGACAGTTGCTTTGAGGCAGTACCGGAGGAGAAAGAC

Oligo, zum Annealing mit pdp40-Xho-R

Pdp40-Xho-R

TCGAGTCTTTCTCCTCCGGTACTGCCTCAAAGCAACTGTCGTAAAGAGCT

Oligo, zum Annealing mit pdp40-Sac-F

Oligo dT

TTTTTTTTTTTTTTTTTTTT

RT-PCR

2.1.1.1 Oligonukleotide für EMSA

Oligonukleotidname

Sequenz (5`- 3`)

Beschreibung

PdpARE-CY5-F

AAAGAGCGTGACAGAGCGCTTTACGA

5` Cy5 markiert; β1(δ)-ARE Sequenz

PdpARE-R

TCGTAAAGCGCTCTGTCACGCTCTTT

Antisense Strang von β1(δ)-ARE Sequenz

TFIID-CY5-F

GGGCAGGGTATAACTCACCTGA

5` Cy5 markiertes Oligo; positiv Kontrolle; TATA-Binding-Protein; sense Strang

TFIID-R

TCAGGTGAGTTATACCCTGCCC

positiv Kontrolle; TATA-Binding-Protein; antisense Strang

pdpHSE-F

ACTTTTCTTTTCCCTTCTGC

5` Cy5 makriert; β1(δ)-Hitze Schock Element; sense Oligo

pdpHSE-R

GCAGAAGGGAAAAGAAAAGT

5` Cy5 makriert; β1(δ)-Hitze Schock Element; antisense Oligo

Comp_pdpHSE-F

ACTTTTCTTTTCCCTTCTGC

unmarkiertes Kompetitions Oligo; β1(δ)-Hitze Schock Element; sense

Comp_pdpHSE-R

GCAGAAGGGAAAAGAAAAGT

unmarkiertes Kompetitions Oligo; β1(δ)-Hitze Schock Element; antisense

Comp_pdpARE-F

AAAGAGCGTGACAGAGCGCTTTACGA

unmarkiertes Kompetitions Oligo; β1(δ)-ARE; sense

Comp_pdpARE-F

TCGTAAAGCGCTCTGTCACGCTCTTT

unmarkiertes Kompetitions Oligo; β1(δ)-ARE; antisense

2.1.2 Geräte

↓12

Agarosegelkammer

Renner

Eismaschine AF-10

Scotsman

Elektrophorese Einheit

Hoefer Pharmacia

Feinwaage MC1

Sartorius

Gefrierschrank –20° C

Liebherr / puffer hubbard

Gefrierschrank –70° C

Liebherr / puffer hubbard

Tischzentrifuge

Heraeus

Geltrockner Drystar

Hölzel

Heizblock

Eppendorf

Kühlzentrifuge Avanti J-25

Beckmann

Kühlzentrifuge RC24

Beckmann

Kühlzentrifuge 54178

Eppendorf

Leuchtkasten

Rex

Magnetrührer MR 3001 K

Heidolph

Mikrowelle

Bosch

Minigel System

Hoefer Pharmacia

Netzgerät DC PS3000

Hoefer

PCR Maschine UNO Block

Biorad

Photometer UV 2102

Shimadzu

Pipetten

Gilson

Rad/Motor Torque

Cole-Parmer Instituts

Röntgenfilmentwickler Hyperprocessor

Amersham

Rotor SS34

Sorvall

Rotor SW 40

Beckmann

Schüttler

Infors

Semi-Dry Blotkammer

PQLAB

Steril gard Hood classII A1 B3

Baker

Stickstofftank

Taylor-Wharton

Ultrazentrifuge Ultra Pro 80

Sorvall

UV-Tisch

Appligen

Vakuumtrockner

Labcono

Vortexer VF2

Janke&Kune

Waage BP210OS

Sartorius

Wasserbad TWB 12

Julabo

Zellkultur-Inkubator

Heraeus

2.1.3 Chemikalien und Verbrauchsmaterialien

3 MM Papier

Whatman

Acrylamid 30 % 29:1

AppliChem

Bacto-Agar

DIFCO

Bacto-Trypton

DIFCO

BSA, 100 x

NEB

Hefe-Extrakt

DIFCO

DMSO

Fluka

Interferon γ rekombinant, human

Roche

2.1.4 Kits

Midi Plasmidkit

Qiagen

Qiaprep Spin

Qiagen

GFX-PCR and Gel purification Kit

Amersham

TA Kloning Kit

Invitrogen

CAT ELISA

Roche

2.1.5 Verwendete Antikörper

↓13

Rpt1 (S7) (1:1000)

polyklonal; WB

α6 (C2) (1 :1000)

monoklonal; WB

β1 (δ) (1:2000)

polyklonal; WB

Hsp70 (1:1000)

polyklonal; WB; Santa Cruz

Ubiquitin

WB; Daco

K08 ; Gesamtproteasom

polyklonal; IP; Dr. Kuckelkorn

C8 (1:2000)

polyklonal; WB; IP; (Nandi, et al., 1997)

MP3 66024

polyklonal; WB; (Frentzel, et al., 1993)

POMP (Krü1, gereinigt) (1:750)

polyklonal; WB; IP; Dr. Krüger

Nrf2 (H-300) sc-13032 (1:1000)

polyklonal; WB; Santa Cruz

HSTF1 (H-311) sc-9144

polyklonal; WB; Santa Cruz

2.1.6 Vektoren

pGL3control

Promega; Luciferase Kontroll Vektor

pGL2basic

Promega; Luciferase Vektor

pCAT3basic

Promega; CAT Vektor

pXP-2

D. Zaiss; Luciferase Vektor

pCR2.1

Invitrogen; TA Kloning

2.2 Methoden

2.2.1 Molekularbiologische Methoden

2.2.1.1 Klonierungsmethoden

2.2.1.1.1 Restriktion von DNA

0,5 μg bis 5 μg DNA wurden gemäß Herstellerinformation für 1h bis 3h verdaut.

2.2.1.1.2 Präparation von Klonierungsvektoren

↓14

Zur Vorbereitung einer Ligation wurde der jeweilige Vektor mit dem der Klonierungsstategie entsprechenden Enzym verdaut. Bei einer Restriktion mit nur einem Enzym wurde eine Dephosphorylierung mit Shrimp Phosphatase von Roche gemäß Herstellerangaben durchgeführt. Die Aufreinigung der Klonierungsvektoren erfolgt mittels Auftrennung durch ein 1% Agarosegel. Das aufgetrennte Fragment wurde anschließend durch ein GFX-PCR and Gel purif i cation Kit gemäß Herstellerangaben aufgereinigt und in destilliertem Wasser aufgenommen.

2.2.1.2 Dephosphorylierung von kompatiblen Enden

Bei Vektoren mit kompatiblen Enden müssen die Enden dephosphoryliert werden, um eine Religation zu vermeiden. Im Falle von DNA hydrolysiert die Shrimp alkalische Phosphatase (AP) das 5` Phosphat Ende. Je 1 Unit Shrimp AP wurde gemäß Herstellerangaben zwei mal 30 Minuten bei 37° C inkubiert und anschließend 15 Minuten bei 65° C Inaktiviert.

2.2.1.3 Ligation

Für die Ligationsansätze wurden zwischen 10 und 100 ng aufgereinigtem Vektor eingesetzt. Die Konzentration an aufgereinigten Inserts betrug in Bezug auf das molare Verhältnis das 2 – 3 Fache der eingesetzten Vektormenge. Der Ligationsansatz wurde mit 400 U T4 Ligase (New England Biolabs) in einem 20 μl Ansatz für 10 Minuten – 30 Minuten bei Raumtemperatur inkubiert.

2.2.1.4 Transformation von Bakterienzellen

↓15

Kompetente DH5α wurden nach (Sambrook, et al., 1989) transformiert. Pro Ligationsansatz wurde ein Aliquot kompetente Zellen aufgetaut und 20 bis 50 ng DNA aus dem Ligationsansatz unter die Zellen gemischt. Nach 30 Minuten Inkubation auf Eis wurde der Ansatz einem Hitzeschock ausgesetzt (90 Sekunden bei 42° C) und anschließend 1 Minute auf Eis abgekühlt. Der Ansatz wurde mit 700 μl LB-Medium versetzt und 1 h bei 37° C mit 1200 rpm geschüttelt. Jetzt wurden die Zellen bei 2500 rpm in der Heraeus Zentrifuge sedimentiert, in ein Gesamtvolumen von 100 μl LB-Medium aufgenommen, auf LB-Platten mit Ampicillin ausgestrichen und ü.N. bei 37° C inkubiert.

2.2.1.5 Herstellung kompetenter E.coli Zellen (vom DH5α-Typ)

100 ml φa-Medium wurden mit 2 ml einer 3 ml Vorkultur angeimpft und bei 37° C bis zu einer OD595 von 0,5 mit ca. 200 rpm geschüttelt. Die Kultur wurde mit 3000 rpm in einer Tischzentrifuge bei 4° C pelletiert. Das Pellet wurde vorsichtig mit 40 ml TFbI Puffer auf Eis resuspendiert. Anschließend wurde der Ansatz mit 3000 rpm bei 4° C zentrifugiert. Das Sediment wurde in 4 ml TFbII Puffer resuspendiert und 15 Minuten auf Eis stehen gelassen. Anschließend wurde das Gemisch aliquotiert (je 100 μl) und in flüssigem Stickstoff schockgefroren. Die Aliquots wurden bei –70° C gelagert.

2.2.2 Isolierung von Plasmid DNA aus E. coli

2.2.2.1 Kochpräparation

↓16

1,5 ml einer ü.N. Kultur rekombinanter Bakterien wurden 5 Minuten bei 14.000 rpm in einer Heraeus Tischzentrifuge zentrifugiert. Das Pellet wurde in STET Aufschlusspuffer resuspendiert und 5 Minuten bei Raumtemperatur inkubiert. Die Suspension wurde 1 Minute bei 100°C gekocht. Nach einer erneuten Inkubation für 5 Minuten bei Raumtemperatur, folgt eine Zentrifugation bei 14.000 rpm in einer Heraeus Tischzentrifuge für 15 Minuten. Das Pellet wurde mit einem geeignetem Gegenstand entfernt und der Überstand mit 200 μl Isopropanol versetzt und gut gemischt. Der Ansatz wird für 5 Minuten bei –20 °C vorinkubiert und anschließend wird die DNA bei 4 °C und 14.000 rpm 10 Minuten präzipitiert. Das Pellet wird mir 400 μl 70 % Ethanol gewaschen. Das Pellet wurde in einem Vakuumtrockner (Labcono) getrocknet und in 50 μl destillierten Wasser aufgenommen.

2.2.2.2 Miniprep (Qiagen)

Mini Präparation von Plasmid DNA erfolgt mittels Plasmid Mini Kit (Qiaprep Spin Miniprep Kit) gemäß Herstellerangaben.

2.2.2.3 Agarose-Gelelektrophorese

↓17

Für die Auftrennung von DNA nach Molekulargewicht wurden 0,7 – 2 % Agarosegele verwendet. Die elektrophoretische Auftrennung der DNA erfolgte in einer Kammer der Firma (Renner) bei konstanter Spannung von 100 V. Als Größenstandard wurde der 1 kb Marker der Firma Gibco verwendet.

2.2.3 PCR (polymerase chain reaction)

Zur Amplifikation von DNA Fragmenten aus genomischer DNA, cDNA oder aus BAC Plasmiden wurde die Taq-Polymerase (Roche) oder der ExpandTM High Fidelity Mix von Roche verwendet. Ein typischer Ansatz beinhaltete wie folgt:

↓18

Dieser Ansatz wurde mit folgendem Programm im Thermocycler (Biometra) vervielfältigt:

  1. 95° C für 5 Minuten
  2. 95° C für 1 Minute
  3. 50° C - 58° C für 1 Minute
  4. 68° C – 72° C für 20 Sekunden bis 5 Minuten
  5. 68° C – 72° C für 10 Minuten

↓19

Die Schritte 2. bis 4. wurden zwischen 20 bis 30 mal wiederholt.

2.2.3.1 RT-PCR

2 µg RNA-Extrakt wurde mit 1µl (50 mM) Oligo dT Primern vermischt und für 10 Minuten auf 65° C erhitzt. Anschließend wurde folgender cDNA-Mix hinzugegeben:

↓20

dieser Ansatz wurde für 1 h bei 42° C inkubiert. Anschließend für 2 Minuten auf 4 ° C abgekühlt und für 2 Minuten bei 95° C hitzeinaktiviert. Für die PCR wurden 2 µl aus der cDNA Gemisch eingesetzt.

2.2.4 Northern Hybridisierung

2.2.4.1 RNA Isolation aus Säugetier - Zellen

Die RNA – Isolierung aus humanen Zellen und VSMC erfolgte mit dem High Pure RNA Isolation Kit von Roche gemäß Herstellerangaben. Die RNA Ausbeute wurde durch optische Messung bei 260 nm bestimmt. Der Qualität der Aufreinigung wurde aus dem Verhältnis von 260 zu 280 nm bestimmt.

2.2.4.2 Herstellung von DIG-RNA Sonden

↓21

Zur Sondenherstellung benötigt die Zielsequenz an ihrem 3` Ende einen T7 Promotor, der in antisense Orientierung liegt. Die T7 RNA Polymerase synthetisiert die Antisense-RNA-Sonde und baut die angebotenen mit DIG markierten Uracil-Nucleotide ein.

Als DNA Matrize wurden entweder eine Zielsequenz verwendet, die einen T7 Promotor schon auf ihrem Plasmid besitzen oder die Zielsequenz wurde mit Primern mittels PCR amplifiziert. Einer der PCR – Primer enthält dann die Sequenz des T7 Promotors. Für die Markierung der RNA wurde der DIG RNA Labeling Mix von Roche verwendet. Die Reaktion wurde nach Herstellerangaben ausgeführt. Um noch vorhandene Template DNA zu verdauen wurde 2μl DNAse aus dem Kit dazugegeben und für 15 Minuten bei 37° C inkubiert. Das Abstoppen der Reaktion erfolgte mit 1 μl 0,5 M EDTA. Die RNA wurde mit 2,5 μl 4 M LiCl und 75 μl absolutem Ethanol versetzt. Über Nacht bei – 20° C oder 1 Stunde bei – 70° C wurde der Ansatz gefällt. Nach 30 Minuten Zentrifugation bei 13.000 rpm (Tischzentrifuge) und 4° C wurde das Pellet mit 70 % Ethanol gewaschen. Nach erneut 10 Minuten Zentrifugation und Trocknen des Pellets im Vakuum wurde es mit 100 μl H2O DEPC und 1 μl RNA Guard aufgenommen. Das Pellet löste sich nach 1 Stunde bei 37° C.

↓22

Die Sonden wurden im Dot Blot getestet. Dafür wurden je 1 μl der Lösungen in einer Verdünnungsreihe (1:10 bis 1:10.000) auf ein Stück Nylonmembran von Roche aufgetragen. Die Membran wurde 3 Minuten UV-Licht ausgesetzt (UV-Tisch), um die RNA auf der Membran zu fixieren. Die Antikörperbehandlung und Detektion der Signale erfolgte nach vorheriger Blockierung der Membran wie unter 2.2.4 beschrieben. Bei einer guten Sonde ist noch ein Signal bei einer Verdünnung von 1 : 10000 und einer Exposition von 1 Minute zu erkennen.

2.2.4.3 Northern Blot

Zwischen 2 μg und 10 μg RNA wurden in 1 x RNA Probenpuffer aufgenommen und 10 Minuten bei 65° C denaturiert. Das 1,5 % Agarosegel wurde vor dem Probenauftrag für 10 Minuten bei 120 V laufen gelassen. Das Gel mit geladenen Proben lief ca. 1-2 h bei 120 V, dabei wurde der Laufpuffer mit Magnetrührern umgewälzt. Nach der elektrophoretischen Auftrennung erfolgte der eigentliche Blot in einer Vakuumblotaperatur (Amer-sham). Auf einer porösen Trägerplatte der Apparatur wurde die angefeuchtete Nylonmembran (Roche) gelegt, diese mit einer Maske umrandet und auf die Membran das Gel gelegt. Das Vakuum wurde durch eine Pumpe mit einem Druck von ca. 55 cm * H2O gewährleistet. Das Gel wurde für 10 Minuten mit Denaturierungslösung überschichtet, danach erfolgte 10 Minuten Überschichtung mit Neutralisierungslösung. Anschließend wurde das Gel für mindestens 2 Stunden mit 20 x SSC beschickt. Die auf die Nylonmembran transferierte RNA wurde für 3 Minuten unter UV Licht fixiert. Als Ladekontrolle und Blotkontrolle wurde die rRNA eingelesen. Die Membran wurde bei 68° C in einem Hybridisierungsofen (GFL) mit Hybridisierungslösung prähybridisiert. Die Hybridisierung mit der DIG-RNA Sonde erfolgt bei 68° C über Nacht (ca. 5-20 μl Sonde auf 10 ml Hybridisierungslösung). Die Hybridisierungslösung mit der Sonde kann mehrfach verwendet werden und wird bei – 20° C aufbewahrt. Die Detektion der Hybridisierung wurde wie folgt durchgeführt. Die Membran wurde 2 mal 5 Minuten bei 68° C mit Waschpuffer I gewaschen und anschließend zweimal für jeweils 15 Minuten mit Waschpuffer II behandelt. Die nachfolgenden Reaktionen erfolgten bei Raumtemperatur. Die Membran wurde in 1 x Maleinsäurepuffer equilibriert und anschließend in Puffer 2 mindestens 30 Minuten blockiert. 30 Minuten Antikörperbehandlung mit Anti-DIG-AK (1:10000 in Puffer 1). Die Membran wurde 2 mal für 15 Minuten in Puffer 1 gewaschen und anschließend kurz in Puffer 3 equilibriert. Nach 5 Minuten Inkubation mit CDP-Star (Roche) wurden die Signale auf einen Röntgen-Film (Kodak) detektiert.

2.2.5 Exonuclease III Verdau

↓23

Exonuclease III katalysiert das schrittweise Entfernen von 5`- Mononukleotiden von doppelsträngiger DNA mit einem freien 3`OH – Ende in 3` - 5` Richtung.

Die Ziel - DNA muss einen 3` Überhang und einen 5` Überhang oder ein glattes Ende besitzen. Vom 5` Überhang aus startet der Verdau. Der 3` Überhang ist vor Restriktion geschützt.

↓24

Nach Linearisierung der Ziel – DNA mit einer 3` und einer 5` Überhang produzierenden Endonuclease, wurde die DNA mit 10 x Exonuclease III Puffer versetzt und bei entsprechender Temperatur gemäß Herstellerangaben 3 Minuten inkubiert. 30 Sekunden nach Zugabe von 500 U Exonuclease III startete der Verdau. Nach gewünschter Abbaurate wurde zwischen 30 Sekunden bis hin zu einer Minute 2 μl von der Exonuclease III Mixtur in die S1 Nuclease - Lösung gegeben. Alle Ansätze wurden 30 Minuten bei Raumtemperatur inkubiert und anschließend mit 1 μl Stop – Lösung versetzt uns bei 70° C für 10 Minuten inaktiviert. 3 μl von dem Ansatz wurde zur Religation verwendet.

2.2.6 EMSA

Die sense und antisense Oligonukleotide (biomers; 300 µM in A.dest) wurden für 5 Minuten bei 95° C gekocht und für 4 h bei RT abgekühlt. Die so annealten Oligonukleotide wurden im EMSA zu 300 µM eingesetzt. Ein Ansatz enthielt:

↓25

Der Ansatz wurde für 20 – 30 Minuten bei 30° C inkubiert und anschließend auf ein nicht denaturierndes 5 % PAA-Gel aufgetragen. Das Gel wurde im Fluoroimager (Fujifilm FIA3000) analysiert.

Für die Kompetitions-Analysen wurden zusätzlich noch ein 10 facher Überschuss an unmarkierten Oligonukleotiden zugegeben und die Ansätze wurden wie oben angegeben behandelt.

2.2.7 Zellkultur

2.2.7.1 Zelllinien

↓26

Immortalisierte Zelllinien:

HeLa

humane Cervix-Karzinomzellinie; epithelial

ATCC CCL-2

HUVEC

humane Nabel-Vene Endothel Zellen fusioniert mit permanenten humanen Zelllinie A549

(Edgell, et al., 1983)

Primäre Zelllinien:

↓27

VSMC

präpariert aus Karotis von Wistar Ratten

(Meiners, et al., 2002)

2.2.7.2 Medien für humane Zellinien

Wachstumsmedien:

↓28

Einfriermedium:

2.2.7.3 Kultur von adhärenten Zellen

↓29

Alle Zelllinien wurden im Brutschrank (Heraeus) bei 37° C, 5 % CO2 und 95 % Luftfeuchtigkeit kultiviert. Nach Erreichen der Konfluenz wurden die Zellen gemäß ihrer Wachstumsgeschwindigkeit gesplittet. Zur Ablösung der Zellen vom Boden der Kulturschale wurden nach einmaligem waschen mit 1 x PBS Trypsin / EDTA Lösung (Gibco) verwendet.

Zur Gewinnung von Lysaten zur proteasomalen Aktivitätsbestimmung wurden die Zellen direkt in der Kulturschale mit destilliertem Wasser und 0,1 % Triton X-100 aufgeschlossen.

2.2.7.4 Kultur von Suspensionszellen

Nach erreichen der Konfluenz wurden 90 % der T2 Zellen abgesaugt und mit frischem RPMI Medium aufgefüllt.

2.2.7.5 Einfrieren und Auftauen von Zellen

↓30

Die Zellen wurden mit 1 x PBS gewaschen und mit Trypsin / EDTA geerntet (s. 2.2.7.3). Das Zellpellet wurde mit 1 x xPBS gewaschen und in ca. 50 μl Lysepuffer pro 106 Zellen aufgenommen. Das Lysat wurde 3 x in flüssigem Stickstoff oder bei – 80° C eingefroren und bei RT aufgetaut. Nach Zentrifugation in einer Tischzentrifuge bei 14000 rpm und 4 ° C wurde der Überstand als Gesamtproteinlysat weiter verwendet.

2.2.7.6 Behandlung von Kulturzellen mit Proteasom - Inhibitor

Für die Behandlung mit Proteasom Inhibitor, wurde das Kulturmedium mit clasto-lactcystin, MG132 oder ALLM in Konzentrationen zwischen 0,1 bis 10 μM, versetzt. Der Inkubationszeitraum lag zwischen 3 h und 16 h. Als Kontrolle wurde das Lösungsmittel der Inhibitoren (DMSO) verwendet. Die maximale Konzentration lag bei 0,1 % des Kulturmediums.

↓31

VSMC wurden vor der Zugabe von Inhibitoren mit 2 % FKS enthaltenden DMEM für 24 h synchronisiert.

2.2.7.7 Behandlung von Kulturzellen mit α - Amanitin

Zellen wurden bis zu einer Konfluenz von mindestens 70 % kultiviert und mit 2 μg – 50 μg α - Amanitin (Sigma) für 2 h – 16 h versetzt.

2.2.7.8 Transfektion von adhärenten Zellen

↓32

Transiente Transfektion wurde mit dem kationischen Lipid-Reagenz FuGENE (Roche) durchgeführt. 24 – Loch oder 6 – Loch Platten wurden mit HeLa Zellen beschickt. Die Zellen wurden bis zu einer Konfluenz von 60 – 70 % wachsen gelassen. Die nach Herstellerangaben entsprechende Menge FuGENE Reagenz wurde mit serumfreien Medium versetzt und für 5 Minuten bei Raumtemperatur inkubiert. 0,5 μg – 2 μg der zu transfizierenden DNA wurde zugegeben und für 15 Minuten bei Raumtemperatur stehen gelassen. Die der Kulturplatte entsprechende Menge Medium mit Serum wurde mit dem Ansatz versetzt. Die Transfektion wurde mindestens für 3 h im Brutschrank kultiviert bevor eine weitere Behandlung erfolgte.

2.2.7.9 Markierung von Zellen mit 35S

VSMC wurden für 1 h gehungert mit Methionin- und Cystein- freiem Medium (RPMI). Zur Markierung wurden 200 μCi 35S-L-Methionin (ICN Radiochemicals) verwendet. Die Zellen wurden für 16 h im Brutschrank belassen.

2.2.7.10 Aktivitätsbestimmung der Luziferase

↓33

Die Luciferase verwandelt das Substrat Luziferin in Gegenwart von molekularen O2, ATP und Mg 2+ in Oxoluziferin und CO2 um. Bei der Reaktion wird Licht einer Wellenlänge von 562 nm emittiert, das in einem Luminometer gemessen werden kann.

Zur Bestimmung der Luziferaseaktivität wurden die transfizierten HeLa Zellen zweimal mit 1x PBS gewaschen und anschließend mit 50 μl Lysepuffer für ein 24-Loch Platte oder 200 μl für eine 6-Loch Platte lysiert. Das Lysat wurde 10 Minuten in einer Tischzentrifuge bei 4° C bei 14.000 rpm sedimentiert und der Überstand in ein neues Gefäß überführt. Je die Hälfte des Lysats wurde in ein FACS Röhrchen gegeben und mit 750 μl L-Lösung und 300 μl Luziferin versetzt. Der Ansatz wurde gut durchmischt und im Luminometer (Lumat LB9501, Berthold) für 2 Sekunden gemessen.

2.2.7.11 Aktivitätsbestimmung der Chloramphenicol acetyltransferase (CAT)

Zur Bestimmung der CAT Aktivität wurde CAT ELISA von Roche verwendet. Die Messung wurde gemäß Herstellerprotokoll durchgeführt. Die Emission wurde am Plattenreader (Dynatech MR5000) gemessen.

2.2.7.12 Kernprotein-Extraktion

↓34

Trypsinierte und pelletierte Zellen wurden in zwei Volumenteilen Puffer B vorsichtig resuspendiert. Alle Schritte geschahen auf Eis. Das Gemisch wurde ca. 5 Minuten inkubiert bis die Zellen lysiert waren (Mikroskopkontrolle). Das Lysat wurde bei maximaler Drehzahl in einer Tisch-Kühlzentrifuge pelletiert. Der Überstand besteht aus cytoplasmatischen Proteinen und wurde in Puffer DRegular 1:3 verdünnt und bei – 80° C gelagert. Das Pellet (Zellkerne) wurde mit 1 ml Puffer A gewaschen und wie oben beschrieben pelletiert. Das Pellet wurde in 2/3 Volumenteilen Puffer C resuspendiert und ca. 20-30 Minuten auf Eis inkubiert. Die Kerne quellen erst auf und schrumpfen dann wieder (Mikroskopkontrolle). Das Gemisch wurde wie oben beschrieben pelletiert und der Überstand wurde 1:4 in Puffer DModified aufgenommen. Die Kernproteine konnten bei –80° C gelagert werden.

2.2.7.13 Hitze Schock an transfizierten HUVEC

HUVEC wurden in 6 Well Platten bis zu einer Konfluenz von 70 % angezogen und wie unter 2.2.7.8 beschrieben transfiziert. Die Transfektion wurde ü.N. stehen gelassen. Die Zellkulturschale wurde anschließend 1 h im 42° C Wasserbad inkubiert und für 2 h bei 37° C erholen lassen. Die Zellen konnten nun weiter bearbeitet werden.

2.2.8 Proteinbiochemische Methoden

2.2.8.1 SDS PAGE (SDS – Polyacrylamidelectrophorese) nach Lämmli

↓35

Die Methode wurde nach Lämmli (1970) modifiziert. Mit dieser Methode werden Proteine entsprechend ihrer molekularen Masse unter denaturierenden Bedingungen in SDS – Gelen aufgetrennt. Es wurden 0,75 mm dicke Gele mit einer Lauflänge von 6 cm verwendet. Der Lauf wurde mit Lämmli – Puffer durchgeführt. Die Proben wurden vor dem Auftragen auf 1 x Probenpuffer eingestellt und bei 100° C 5 Minuten denaturiert. Die Trennung der Proteine erfolgte im Mighty Small System S250 von Hoefer / Pharmacia bei konstantem Strom (15 mA im Sammelgel; 35 mA im Trenngel; 200 V maximal).

2.2.8.2 Western Blot Analyse

↓36

Nach der SDS – PAGE wurden die Proteine für 1 h bei konstanten Strom von 1,5 – 2 mA / cm2 , maximal 400 mA pro Blotapparatur, aus dem Gel auf eine PVDF Membran (0,45 μm Porengröße, Millipore) transferiert. Der Transfer erfolgte in einer Apparatur von PeqLab im Semidry – Verfahren, wobei sich zwischen Gel und Kathode bzw. zwischen Membran und Anode jeweils 3 Lagen in Transferpuffer getränkten Whatmann – Papiers befanden. Zum Nachweis des erfolgreichen gleichmäßigen Proteintransfers wurde die Membran mit Amidoschwarzlösung angefärbt.

Durchführen der Antikörper- und Färbereaktion:

(alle Reaktionen auf dem Schüttler und bei RT)

↓37

  1. Blockierung der Membran: 1 h mit Blocking – Lösung
  2. Inkubation mit in Blocking – Lösung verdünnten 1. Antikörper bei 4° C über Nacht.
  3. 2 x 20 Minuten Waschen mit TBS – T
  4. Inkubation mit dem 2. Antikörper: anti – mouse bzw. anti – rabbit konjugiert mit Meerrettich – Peroxidase in Blocking – Lösung für mind. 1 h
  5. 2 x 20 Minuten Waschen mit TBS – T
  6. Inkubation mit ECL plus (Amersham). Die Detektion der Chemiluminiszenz – Signale erfolgte mit Kodak X – Omat DS Filmen.

2.2.8.3 Dichtegradientenzentrifugation

Es wurden Gradienten im SW 40 – Ultrazentrifugenröhrchen mit einer Saccharosekonzentration von 40 % - 10 % gegossen und ca. 3 mg Protein aus Gesamtproteinlysaten aufgetragen. Die Gradienten wurden 15 Std. und 59 Min. bei 4° C und 40000 rpm im SW 40 Rotor zentrifugiert und der Gradient von unten gezapft (40 %) und in 500 μl Aliquots abgefüllt.

2.2.8.4 Immunopräzipitation

↓38

Zwischen 0,5 – 1 x 107 CPM VSMC Zelllysat wurden für jeden Immunopräzipitation Ansatz eingesetzt. Slurry wurde 1/10 eingesetzt. Zusätzlich wurde ca. 1/10 Präimmunserum eingesetzt und 16 h bei 4° C auf einem Inkubationsrad drehen gelassen. Der Ansatz wurde 1 Min. bei 14.000 rpm in einer Tischzentrifuge sedimentiert. Der Überstand wurde mit 50 μl Slurry, 10 % Glycerol, 5 mM ATP und 5 μl K08 Antikörper beschickt und für 1 h bei 4° C auf dem Inkubationsrad drehen gelassen. Nach Sedimentation des Slu r ry in einer Tischzentrifuge für 1 Min. bei 14000 rpm wurde das Sediment 3 x mit Waschpuffer gewaschen. Danach wurde mit PBS das Slurry einmal mit dest. Wasser gewaschen und anschließend wurde das Volumen bei 100° C reduziert. Zur Vorbereitung des Präzipitats für die Auftrennung auf einer SDS – PAGE wurde der Ansatz für 5 Min. bei 100° C gekocht. Der Überstand wurde auf ein SDS – PAGE aufgetragen. Das Gel wurde 10 Min. mit dem Fixierer fixiert und im Verstärkerlösung für 30 Min. behandelt. Das Gel wurde anschließend getrocknet und die Signale mittels (Fujifilm) Screen und (Kodak) Film detektiert.

2.2.8.5 Aktivitätsbestimmung des Proteasoms

Zur Aktivitätsbestimmung des Proteasoms in Kulturzellen wurden die Zellen in der Zellkulturschale mit A. dest + 0,1 % Triton X-100 lysiert. 10 µg des Lysats wurde im Aktivitätstest wie folgt eingesetzt:

↓39

Der Ansatz wurde für 30 Minuten bei 37° C inkubiert. Der Aktivitätstest wurde im Fluostar SLT bei einer Excitation von 390 nm und einer Emission von 460 nm (AMC) gemessen. Der "Gain" betrug 35, die Anzahl der "Blitze" 30.

2.2.8.6 Proteinbestimmung

Die Quantifizierung von löslichen Proteinen erfolgte mit dem „Protein Assay dye reagent co n centrate“ von BioRad nach Bradford (1976). Es wurde das Herstellerprotokoll befolgt. Die Bestimmung der OD erfolgte bei 595 nm in Küvetten im „Ultraspec III“ Photometer von Pharmacia.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
31.10.2005