Jacobi, Carsten: Charakterisierung von EPB41 - Spleißformen im menschlichen Gehirn

21

Kapitel 2. Material und Methoden

2.1 Standardprozeduren

Alle Standardmethoden wie Plasmidpräparation, Restriktionsanalyse, gelelektro-phoretische Trennung, SDS-PAGE, DNA-Transfektion, RNA-Isolation wurden nach Sambrook et al. (1989) bzw. dem jeweiligen Protokoll des Herstellers durchgeführt. Alle für die Arbeit relevanten, aber modifizierten oder neu entwickelten Methoden werden nachfolgend aufgeführt.

2.2 Gewebespezifikation

Die humanen Gehirne, die in dieser Studie untersucht wurden, stammen aus den neuropathologischen und pathologischen Instituten der Johann Gutenberg Universitätklinik zu Mainz oder dem Universitätsklinikum Charité Campus Mitte der Humboldt Universität zu Berlin und sind im Rahmen von Routineautopsien entnommen worden (siehe Tabelle 2). In der Arbeit wurden nur humane Gehirne verwendet, die keine signifikanten neuropathologischen Veränderungen - mit Ausnahme der Alzheimer Pathologie - aufwiesen. Hippokampus, Zerebellum, Temporal-, Okzipital- und Frontalkortex wurden herauspräpariert und in flüssigem Stickstoff schockgefroren. Die verschiedenen Gehirnareale wurden bei -80°C gelagert. Zusätzlich wurden Mikrostanzen von grauer und weißer Substanz aus kortikalen Arealen, sowie Gewebestanzen von Leber, Niere, Herz, Skelettmuskel tiefgefroren.


22

Tabelle 2: Patientendaten

 

Geschlecht

Alter

Autolyse

in h

Braak-Stadium

Diagnose

1

m

62

10

0

Peritonitis, Blasencarzinom, Nierenversagen

2

w

74

10

I

akute Myokardinsuffiziens; Pneumonie,

3

m

60

32

I

Herzerkrankung; Niereninsuffiziens

4

w

80

22

I

Schizophrenie

5

w

58

7

I

Herz-Kreislaufversagen; Zervix-Carzinom

6

w

60

32

0

Pneumonie

7

w

48

17

0

Dilatative Cardiomyopathie, Herz-Kreislaufversagen

8

w

72

30

I

Postoperative Wundinfektion, septischer Schock

9

w

58

7

I

Herz-Kreislaufversagen; Zervix-Carzinom

10

w

48

17

0

Kardiomyopathie, Herz-Kreislaufversagen

11

w

60

32

0

Sepsis, Pneumonie

12

m

67

27

0

Magenkarzinom; akutes Herzversagen

13

m

83

8

I

Endocarditis, Herz-Kreislaufversagen

 

PCR

 

 

 

 

14

m

86

14

VI

Bronchopneumonie

15

w

84

4

VI

Lungenembolie, Herzinfinfarkt

16

w

81

11

VI

Bronchopneumonie

17

w

75

16

VI

SDAT;Cerebralsklerose, Arteriosklerose

18

w

81

15

VI

Herz-Kreislaufversagen

19

m

68

15

I

Schizophrenie,

20

m

64

24

I

Bronchialcarzinom, Hämorrahrgischer Schock

21

m

59

21

I

Apoplex; Arteriosklerose; Pneumonie

22

m

87

18

0-I

Dekompensierte Herzinsuffient, Pneumonie, Herz-Kreislaufversagen, Cerebralsklerose

23

m

79

17

I-II

Bronchialcarzinom, Blasencarzinom, Herz-Kreislaufversagen

 

Organe

 

 

 

 

24

w

70

20

0

Endogene Psychose

25

m

62

9

0

Sepsis, Aspirationspneumonie

26

w

76

9

0

Meningitis, Herz-Kreislaufversagen


23

2.3 Isolierung von Gesamt-RNA aus humanem post mortalen Gewebe

Die RNA - Isolation wurde mit peqGold RNAPure™ der Firma Peqlab (Erlangen, FRG), nach Angaben des Herstellers durchgeführt.

Um eine Kontamination der RNA durch Lipide und Proteine gering zu halten, wurde das erste RNA-Pellet in 100 µl dH2O gelöst, wiederum mit dem RNA-Isolationspuffer peqGold in dem entsprechenden Volumen versetzt und eine erneute Isolation durchgeführt. Die RNA-Pellets wurden in 20 µl dH2O aufgenommen, mit 1/10 Volumen PCR-Puffer, 5 units DNAse I versetzt und für 15 Min bei 37°C inkubiert. Die RNA wurde mit der Ethanol-Methode nach Sambrook et al. (1989) gefällt. Die RNA wurde in einem Volumen von 30 µl gelöst und die Konzentration photometrisch bestimmt.

2.4 Reverse Transkription

Pro RT-Ansatz wurden 1,5 µg Gesamt-RNA mit 10 pmol random-Hexanukleotiden in einem Volumen von 7,5 µl für 10 min bei 70°C inkubiert und anschließend auf Eis gekühlt. 12,5 µl eines Reaktionsmixes, der pro Ansatz 4 µl 5x-Rtase-Puffer, 5 µl 5 mM dNTP´s, 5 units RNAsin (Boehringer, Mannheim, FRG) und 2 units Avian Myeblastosis Virus Reverse-Transkriptase (Promega, Madison, USA) enthielt, wurden hinzugesetzt und die Ansätze für 1 h bei 42°C inkubiert.

2.5 Polymerasen-Ketten-Reaktion

Die als Primer verwendeten Oligonukleotide wurden als Lyophilisat von der TibMolBiol GmbH (Berlin) bezogen und grundsätzlich so gelöst, daß man eine 100 picomolare Lösung erhielt. Für die PCR wurde eine 10 picomolare Lösung verwendet. Ein Standardansatz für die PCR mit einem Endvolumen von 25 µl enthielt: 2 µl des RT-Ansatzes, 15,5 µl dH2O, 2,5 µl PCR Puffer, je 1 µl Primer, 1,5 µl 25 mM MgCl2 und 1 µl 2,5 mM dNTP´s sowie 1 unit advantage - cDNA - Polymerase (Promega). Soweit als möglich wurden die Reaktionsmixturen aus gemeinsamen Komponenten für die verschiedenen Ansätze hergestellt um das Pipettieren kleiner Volumina zu vermeiden, und möglichst vergleichbare Reaktionsbedingungen zu garantieren. Die PCR-Bedingungen wurden wie folgt programmiert (PCR - Cykler; Tripod, Hybaid; Göttingen, FRG):

Einer anfänglichen Denaturierung bei 95°C für 1 min folgten 10 Zyklen: 45 s Denaturierung bei 95°C, 45 s Annealing (Die Schmelztemperatur (Tm) der eingesetzten Primern -5°C), 1 min 30 s Elongation bei 72°C. Anschließend folgten 25 Zyklen mit 45 s Denaturierung bei 95°C, 1 min 30 s Annealing (Tm der eingesetzten Primern), 2 min 30 s Elongation bei 72°C. Abschließend wurde für weitere 5 min bei 72°C inkubiert, bevor die Ansätze auf Raumtemperatur heruntergekühlt wurden. Die Annealingtemperatur wurde entsprechend der niedrigsten Schmelztemperatur der jeweils verwendeten Primer gewählt, die sich aus der Zusammensetzung ihrer Nukleotide ergab. Die Schmelztemperatur der jeweils verwendeten Primer wurde gemäß der AT-Regel ermittelt (Wallace et al., 1972; Formel gültig für lange Oligonukleotide). Bei den verwendeten Primern wurden in der Regel Annealingtemperaturen zwischen 58°C und 63°C gewählt.

10 µl Aliquots der Ansätze wurden zur Analyse der PCR-Produkte auf 1% TAE-Agarose-Gele aufgetragen und elektrophoretisch aufgetrennt.


24

2.5.1 Primerkombinationen für RT-PCR-Experimente

In der folgenden Tabelle sind die verwendeten Oligonukleotide aufgeführt.

Tabelle 3: Oligonukleotidsequenzen

Bezeichnung

Sequenz (5´ -> 3´)

Position im

Gen (nt)

Orientierung

EPB41

GCTCTAGAATTCAACATCATGACAACAGAG

40 - 70

sense

(human)

GCTCTAGAATTCGCCGCACCCAGCCCAGAG

85 - 103

sense

 

CAAAACAGACCATCTTTGGATCTTCATTC

463 - 492

sense

 

GCTGTCGATTCGGCAGACCGAAGTCCTCGGCCC

1583 - 1615

sense

 

CTTAACATCAATGGGCAAATCCCCACAGGA

2295 - 2314

sense

 

TGTAAAATTCCAAGGGACACCACGAACCTG

761 - 790

antisense

 

GAATTGTAGTTACCCGTTTAGGGGTGTCCT

2295 - 2314

antisense

 

CCTAAAGTCTCTGTGGCATAA

2208 - 2227

antisense

 

TCCTGAGCTCCTCATCAGCAATCTCGG

2546 - 2573

antisense

 

 

 

 

Aktin

GATATCGCCGCGCTCGTCGTCAC

83 - 103

sense

(human)

AGCCAGGTCCAGACGCAGGATGGC

593 - 616

antisense

 

 

 

 

Aktin

GTACAACCTCCTTGCAGCTC

261 - 280

sense

(Ratte)

TTGCCGATAGTGATGACCTG

2509 - 2528

antisense

 

 

 

 

GADPH

AAGATGGTGAAGGTCGGTGTG

20 - 40

sense

(Ratte)

CCTGCTTCACCACCTTCTTGA

770 - 790

antisense

 

 

 

 

Protein 4.1

AAGAAGGCTCAGGAGGAGACT

175 - 195

sense

(Ratte)

ACTGTTCTCCATAGTGGTCGAGA

1316 - 1337

antisense

10 µl der PCR-Reaktion wurden auf einem 1,2%igem Agarosegel elektrophoretisch aufgetrennt, das Gel mit Ethidiumbromid angefärbt und die PCR-Produkte unter UV-Licht sichtbar gemacht. Die Banden wurden mit einem Skalpell aus dem Gel herausgeschnitten und mit dem DNA-Purification Kit der Firma Biozym (Hessisch Oldendorf, FRG) nach den Angaben des Herstellers eluiert. Zur Mengenabschätzung nach der Elution wurden 1/10 des Volumens auf ein Gel aufgetragen.

Die PCR-Amplifikate wurden in den Vektor pGEMTeasy der Firma Promega nach Angaben des Herstellers ligiert.

Die Transfektion von Plasmiden in Escherichia coli DH5alpha wurde nach der bei Sambrook et al. (1989) beschriebenen CaCl2- Methode durchgeführt.

2.6 Sequenzierung

Die Sequenzierung der Klone wurde von der Firma Sequlab Laboratories Göttingen (Göttingen, FRG) durchgeführt. Sequenzvergleiche mit Genbanken erfolgten über das Internet-Programm des NCBI-Blast (www.ncbi.nlm.nih.gov/blast/). Zur weiteren Analyse


25

wurden die Sequenzen mit dem Programm DNASTAR der Firma GATC (Konstanz, FRG) ausgewertet.

2.7 In-situ-Hybridisierung

Humane Gehirngewebe wurde nur verwendet, wenn die Proben einen post mortem delay von bis zu 24 h aufwiesen. Die In-situ-Hybridisierung wurde an hippokampalem Gewebe mit Übergang zum entorhinalen Kortex durchgeführt. Am Kryostaten wurden 10 µm dicke horizontale Schnitte angefertigt, die auf gelatinierte Objekträger aufgezogen wurden. Die Schnitte wurden bei Raumtemperatur 3 h getrocknet und anschließend in 4% Paraformaldehyd für 5 min fixiert. Die Schnitte wurden 10 min in 0,1 M PBS gewaschen, in aufsteigender Ethanolreihe dehydriert und in 100% Ethanol bei 4°C aufbewahrt. Vor Gebrauch wurden die Schnitte in einer absteigenden Alkoholreihe rehydratisiert, und zweimal in 2 x SSC für 10 Min gespült und anschließend für 30 min in 0,1 M Triethanolamine (pH 8,0) azetyliert.

Nach der Azetylierung wurden die Schnitte zweimal in 2 x SSC gewaschen und mit dem Hybridisierungsmix (25% Formamide; 4 x SSC; 50 mM NaH2PO4/Na2HPO4 Puffer, pH 7,0; 1 mM EDTA; Hering Sperma DNA 1 mg/ml; Hefe Gesamt-RNA 1 mg/ml; 5 x Denhardt´s Puffer) für 2 h bei Raumtemperatur vorhybridisiert.

Als Sonde wurden Oligonukleotide, die am 5´Ende mit Digoxigenin markiert waren, verwendet. Die Oligonukleotide wurden von der Firma Interaktiva Biotechnologie GmbH (Ulm, FRG) bezogen und lyophilisiert geliefert. Nach Angaben des Herstellers wurde eine Stammkonzentration von 1 µg/µl hergestellt. In dem Hybridisierungsmix (25% Formamide; 4 x SSC; 50 mM NaH2PO4/Na2HPO4 Puffer, pH 7,0; 1 mM EDTA; Hering Sperma DNA 1 mg/ml; Hefe Gesamt-RNA 1 mg/ml; 5 x Denhardt´s Puffer) wurden die Oligonukleotide in einer Endkonzentration von 10 ng/ml eingesetzt und bei Raumtemperatur für 16 h hybridisiert. Nach der Hybridisierung wurden die Schnitte dreimal in 2 x SSC jeweils 15 min, zweimal in 1x SSC jeweils 20 min und dreimal in 0,25 x SSC jeweils 30 min gewaschen.

2.7.1 Der Digoxigenin-Nachweis:

Die Schnitte wurden für 5 min in DIG-1 Puffer (100 mM Tris-HCl, pH 7,5; 150 mM NaCl) bei Raumtemperatur gewaschen und anschließend in 1% Blocking-Reagenz (Boehringer) in DIG-1 Puffer für 30 min geblockt. Für die Detektion des Digoxigenins wurden die Schnitte in 0,3% Triton X-100/DIG-1 Puffer für 15 min äquilibriert. Anschließend wurde das anti-Digoxigenin-Fab-Fragment (alkalische Phosphatase gekoppelt) (Boehringer) in einer Verdünnung von 1:500 in 0,3% Triton X-100/DIG-1 Puffer, für 60 min bei Raumtemperatur in einer feuchten Kammer inkubiert. Die Schnitte wurden zweimal in DIG-1 Puffer für 5 min bei Raumtemperatur und einmal in DIG-3 Puffer (100 mM Tris-HCl; pH 9,5; 100 mM NaCl; 50 mM MgCl2) für 5 min bei Raumtemperatur gewaschen. Das Entwicklungsmedium (in 10 ml DIG-3 Puffer werden 45 µl Nitroblue tetrazolium chlorid (NBT)-Lösung (75 mg/ml in 70% Dimethylformamid), 35 µl 4-bromo-4-chloro-3-indolyl-phosphat (BCIP)-Lösung (50 mg/ml in Dimethylformamid) und 1 mM Levamisol gegeben) wurde auf die Schnitte gegeben und bis zu 48 h bei 4°C im Dunkeln entwickelt.

Die Entwicklung wurde mit Dig-4 Puffer (10 mM Tris-HCl; pH 7,5; 10 mM EDTA) abgestoppt und die Schnitte mit Immunmount (Pittsburgh, USA) eingedeckt.

Als Negativkontrolle wurden verschiedene markierte Sense-Oligonukleotide verwendet.


26

Tabelle 4: Sequenzen der verwendeten Sonden

Bezeichnung

Orientierung

Sequenz (5´ -> 3´)

Exon 4

Antisense

TCTCCACAACACATTCATAAACTGTT

Exon 2

Antisense

CTTCTTTGCCTTCTTCCTCGGA

Spleißstelle Klon 9

Antisense

CAGCCATGTCTGTGTTTCTGCACTG

Exon 4

Sense

TGTGTTGTGGAGAAACATGCTAAGG

Exon 2

Sense

GCAGAAACACAGAAACATGCTAAGG

2.8 Antikörperherstellung

2.8.1 Herstellung von Antikörpern gegen erythrozytäres Protein 4.1

Das Protein 4.1 wurde aus um Spektrin verminderten inside-out-Vesikeln von humanen Erythrozyten isoliert. Das gereinigte p4.1 wurde gegen PBS dialysiert und 250 µg Protein wurden mit Freund´schem Adjuvants emulgiert. Die Proteinemulsion wurde subskapulär in Neuseeland-Kaninchen injiziert. [Drenckhahn et al., 1993]. Innerhalb von 8 Wochen entwickelten die Kaninchen einen hohen Antiserum-Titer, der mittels Protein-Immunoblots kontrolliert wurde. Durch diese Technik wurden zwei unterschiedliche polyklonale p4.1 Antiseren hergestellt, die als H30 und H31 weitergehend bezeichnet werden. Der Antikörper H9-85 ist ebenfalls ein polyklonales p4.1 Antisera gegen erythrozytäres p4.1 und wurde von Dr. T. Jöns mir zur Verfügung gestellt.

2.8.2 Herstellung von Protein 4.1 - Peptidantikörpern

Die Peptide wurden von Eurogentec (Hestal, Belgien) synthetisiert und mittels HPLC aufgereinigt (Reinigungsgrad von 75%) geliefert.

Tabelle 5: Peptide für die Immunisierung

Peptid

Position

Sequenz (NH2 -> COOH)

Exon

1

376 - 391

EHHTFFRLTSTDTIPK

10, 11

2

512 - 528

KTHIEVTVPTSNGDQTQ

14

3

529 - 542

KLAEKTEDLIRMRC

15

4

544 - 563

KRERLDGENIYIRHSNLMLE

16

5

Klon 9

CAETQTWLD

2, 6

Zu 5 mg Peptid wurde 5 mg Ovalbumin gegeben und in 5 ml PBS unter Rühren auf Eis gelöst. Anschließend wurde 5 ml einer 2,5% Glutaraldehydlösung zugetropft und 1 h bei 4°C unter Rühren inkubiert. Nach Zugabe von 10 mg Natriumborohydrid wurde für 1 h bei 4°C inkubiert und die gekoppelte Peptidlösung über Nacht gegen PBS dialysiert. 0,5 mg des eingesetzten Peptides wurden wie oben beschrieben mit Freund´schem Adjuvants emulgiert und subskapulär in Neuseeland-Kaninchen injiziert.

Sämtliche hergestellten anti-p4.1 Antikörper wurden im Western-Blot anhand von aufgetrennten präparierten inside-out Vesikeln von humanen Erythrozyten, sowie an Temporalkortexgewebe von Ratte und Mensch getestet.


27

2.9 Herstellung von Proteinhomogenaten aus post mortalem Gewebe für die Immunoblotanalyse

500 mg gefrorenes humanes Gewebe von Hippokampus, Temporalkortex, Zerebellum, Herz, Leber, Niere und Muskel, sowie Kortex der Ratte wurden mechanisch zerkleinert und im 10fachen Volumen des Homogenisierungspuffers (10 mM Tris-base pH 7,4; 1 mM EDTA; 0.1 mM DTT; 1 µM Leupeptin; 0.3 µM Aprotinin und 1 mM PMSF) homogenisiert. Das Homogenat wurde bei 2000 g für 20 min bei 4°C zentrifugiert, der Überstand wurde in ein neues Eppendorfgefäß überführt und bei 20.000 g für 30 min bei 4°C zentrifugiert. Der Überstand wurde wiederum in ein neues Eppendorfgefäß überführt und bei 100.000 g für 30 Min bei 4°C zentrifugiert. Das 100.000g Pellet und die Überstände wurden in der Immunoblotanalyse eingesetzt.

2.10 Immunoblot und SDS-PAGE

Von Pellet und Überstand wurde eine Proteinbestimmung durchgeführt. Gleiche Mengen an Protein wurden in einem 10%igen SDS-Polyacrylamidgel elektrophoretisch aufgetrennt und im Semi-dry-Blot-Verfahren auf eine Polyvinylidin Difluorid Membran (Schleicher und Schüll, Dassel, FRG) transferiert. Die Membran wurde mit 5% Magermilchpulver geblockt und die gebundenen Immunglobuline (anti-Protein 4.1) wurden durch Meerrettich - Peroxidase - gekoppelten anti-Kaninchen IgG aus Ziege (Dakopatts, Hamburg, FRG) und Chemolumineszens unter Benutzung des ECL - Detektion Reagents (Amersham, Braunschweig, FRG) sichtbar gemacht.

2.11 Präparation von neuronalem Rattengewebe

Zusätzlich zu den Untersuchungen von humanem Gehirngewebe wurden auch Gehirngewebe der adulten Ratten analysiert. Nach Anästhesieren der Tiere mit Äther, wurden die Ratten dekapitiert und das Gehirn aus der Schädelkalotte entnommen, in flüssigem Stickstoff schockgefroren und bei -80°C gelagert. Um die Rolle der Autolyse in den Proteinuntersuchungen zu klären, wurden Rattengehirne entnommen und Proteinhomogenate zu Beginn des Experimentes hergestellt. Für die Zeitpunkte 12, 24 und 48 h wurden die Gehirne in Plastikfolie gewickelt, um sie vor dem Austrocknen zu schützen und im Kühlraum bei 4°C aufbewahrt. Anschließend wurde zu den jeweiligen Zeitpunkten Proteinhomogenate hergestellt.

2.12 Neuronale und gliale Zellkulturen von Ratten

2.12.1 Neuronale Primärkultur

Hippokampale Neurone wurden aus E18 Rattenembryonen (Wistar) isoliert und in Kultur genommen. Die Zellen wurden dabei in 6 Loch-Platten (Falcon, Becton Dickinson, Heidelberg, FRG), auf beschichteten Poly-D-Lysin Glasplättchen (Durchmesser 25 mm) mit einer Zelldichte von 60.000 Zellen pro Plättchen ausplattiert. Die Neurone wurden in serumfreiem Neurobasalmedium (Life Technologies GmbH; Gibco, Mannheim FRG), das Supplement B-27 (Life Technologies), 50 µg/ml Gentamycin und 2 mM L-Glutamin (Life Technologies) enthielt, bei 37°C in 95% Luftfeuchtigkeit und 10% CO2 kultiviert. Das Kulturmedium wurde zweimal wöchentlich gewechselt. Für die Experimente wurden 7 Tage alte Kulturen mit einer Zelldichte von 200 Zellen pro mm2 benutzt. Unter diesen Bedingungen waren vor allem neuronale Zellen vorhanden. In der Zellkultur konnten mit


28

spezifischen Markern weniger als 5% Astrozyten (anti-GFAP, Sigma, Hamburg, FRG) und Mikroglia (anti-Lektin B4, Sigma) nachgewiesen werden.

2.12.2 Primäre astrogliale Kulturen

Astroglial angereicherte Kulturen wurden aus Hippokampi von p1 Wistar Ratten, wie bei McCarthy and de Vellis et al. (1980) beschrieben, präpariert. Die Zellen wurden in 6 Loch-Platten (Falcon, Becton Dickinson) auf Poly-D-Lysin beschichteten Glasplättchen (Durchmesser 25 mm) mit einer Dichte von 30.000 Zellen pro Plättchen ausgesät. Die Astrozyten wurden in DMEM Medium (Life Technologies) mit 10% (w/v) FCS, 50 µg/ml Gentamycin und 100 µM L-Glutamin (Life Technologies), bei 37°C in 95% Luftfeuchtigkeit und bei 5% CO2 kultiviert. Das Kulturmedium wurde zweimal wöchentlich gewechselt. 14 Tage alte Kulturen wurden für die Experimente verwendet. Unter diesen Bedingungen dominierten in der Kultur astrogliale Zellen. Weniger als 10% Neurone ( MAP-2, Sigma) und weniger als 20% Mikroglia (anti-Lektin B4, Sigma) konnten mit spezifischen Markern nachgewiesen werden. Die durchschnittliche Zelldichte betrug 150 Zellen pro mm2.

2.12.3 Mikroglia Zellkulturen

Zur Gewinnung von Mikroglia Zellkulturen wurden Mischkulturen aus Hippokampi von P1 Wistar Ratten in poly D-Lysin beschichteten Kulturflaschen (25 cm2, Nunc; Life Technolgies GmbH, Karlsruhe, FRG) angezogen und 14 Tage lang kultiviert. Zur Trennung der Mikroglia von den Astrozyten wurden die Kulturflaschen für 30 min auf einem Schüttler (100 rpm) inkubiert. Die flottierenden Zellen wurden abgezogen, in ein 15 ml Falcon Gefäß überführt und für 10 min bei 500 g abzentrifugiert. Der Überstand wurde verworfen und das Zellpellet in Kulturmedium (DMEM, 10% FCS) resuspendiert. Ca. 50 Zellen pro mm2 wurden auf Poly-D-Lysin beschichteten Plättchen gegeben. Die Kulturen wurden bei 37°C in 95% Luftfeuchtigkeit bei 10% CO2 kultiviert. Die Kulturen wiesen eine Reinheit von 70% auf (30% waren noch Astroglia).

2.12.4 Behandlung der Neuronenkultur

Die neuronalen Zellkulturen wurden mit den folgenden Substanzen behandelt. Die Substanzen wurden in der folgender Stammkonzentration aufgenommen und im Medium auf die Endkonzentration eingestellt.


29

Tabelle 6: Konzentration der Substanzen in den Zellkulturexperimenten

Substanz

Stammlösung

Endkonzentration

Lovastatin(Calbiochem, Bad Soden, FRG)

10 mM (1)

10-50 µM

Mevalonat (Sigma)

2 M in PBS

2 mM

Geranylgeranylpyrophosphat (Sigma)

2 mM in 0,1 M

NH4Cl4/MEOH

10 µM

Geranylgeranyltransferase Inhibitor(Calbiochem)

1,5 mM in DMSO

10 µM

Cytochalasin D (Sigma)

100 mM in DMSO

10 µM

Colchizin (Sigma)

100 mM in PBS

50 µM

(1) Ansetzen von Lovastatin nach Cutts et al., BBA 1988

2.12.5 Probenaufbereitung der Zellkultur für die Immunoblotanalyse

Die Zellen wurden zweimal mit PBS gewaschen und anschließend wurde siedender 4 x SDS Probenpuffer (30 µl / Loch) zugegeben. Die lysierten Zellen wurden mit einem Zellschaber vom Untergrund gelöst. Das Lysat wurde in Eppendorfgefäße überführt, bei 90°C für 5 min erhitzt, bei 10.000 g für 5 min zentrifugiert und anschließend bei -20°C tiefgefroren.

2.13 Immunhistochemie

2.13.1 Immunhistochemische Analyse von humanem post mortalen Material.

Nach der Autopsie wurde die linke Hemisphäre in 10 mm große Scheiben geschnitten und in 4% Paraformaldehyd, 15% gesättigte Pikrinsäure in 0,1 M Phosphatpuffer (PB, pH 7,4) fixiert. Der Hippokampus wurde herauspräpariert und in einem Saccharosegradienten (15% und 30% Saccharose, 0,05% NaN3 in 0,1 M PB) kryoprotektiert. Am Kryostaten wurden senkrecht zu der longitudinalen Achse des Hippokampus 80 µm dicke Schnitte angefertigt und fünfmal für 10 min in PB gewaschen. Anschließend wurde für 30 min in 10% normal goat serum (NGS) in PB geblockt. Die Schnitte wurden für 16 h bei 4°C mit den verschiedenen Antiseren in einer Verdünnung von 1:250 (1% NGS, 0,1% Triton X-100 und 0,1% NaN3 in PB) inkubiert. Die Schnitte wurden viermal in PB gewaschen und mit anti-Kaninchen biotinylierte Sekundärantikörper aus der Ziege in einer Verdünnung von 1:250 (1% NGS, 0,1% Triton X-100 und 0,1% NaN3 in PB) für 90 min bei Raumtemperatur inkubiert. Anschließend wurde viermal in PB gewaschen und die ABC-Reaktion mit dem Vectastain Elite Kit (Vector Laboratories, Burlingham, USA) und Diaminobenzidin (1 mg / ml, 0,01% H2O2 in PB) nach Angaben des Herstellers durchgeführt. Die Schnitte wurden abschließend in PB gewaschen, auf gelatinierte Objektträger gezogen, dehydriert und mit Entellan (Merck, Darmstadt) eingedeckt. Als Kontrolle dienten Schnitte, auf die präabsorpierter Primärantikörper (Inkubation des Primärantikörpers 1:250 mit 3 mg/ml des jeweiligen Antigens) und Schnitte ohne Zugabe von Primärantikörper, wobei die Schnitte aber sonst auf gleiche Weise behandelt wurden. Die Auswertung der Schnitte erfolgte an einem Mikroskop (BX 50) mit Fluoreszenz Aufsatz (BC-FLA) der Firma Olympus (Hamburg, FRG)


30

2.13.2 Immunzytochemie an Neuronenkulturen

Die auf Glasplättchen kultivierten Neurone wurden zweimal mit PB für 5 min gespült und anschließend in 4% Paraformaldehyd für 15 min bei Raumtemperatur fixiert. Danach wurden die Neurone dreimal mit PB für 10 min gewaschen, in PB (1,5% BSA, 0,1% Triton X-100) für 15 min lysiert und in PB (1,5% BSA) für 15 min blockiert. Als Primärantikörper für die Detektion von EPB41 - Isoformen wurde der Peptidantikörper H2B6 (Peptid 1; siehe Tabelle 5) in einer Konzentration von 1:250 in PB (1,5% BSA) und für die Darstellung des Aktin-Mikrofilamentes wurde FITC-markiertes Phalloidin (Molecular Probes, Leiden, NL) in einer Konzentration von 1:300 in PB verwendet. Die Inkubationszeit für den Antikörper H2B6 betrug 1 h bei Raumtemperatur und für das Phalloidin 2 h bei Raumtemperatur im Dunkeln. Für die Detektion des Primärantikörpers H2B6 wurden die Neurone dreimal für 10 min in PB (1,5% BSA) gespült und anschließend mit einem TRITC-markierten anti-Kaninchen Sekundärantikörper (Molecular Probes) in einer Konzentration von 1:200 in PB (1,5% BSA) für 1 h im Dunkeln inkubiert, wiederum dreimal für 5 min mit PB gespült und mit Vectashield Einbettmedium (Vector Laboratories) auf gelatinierten Objektträger eingedeckt. Als Kontrolle wurde den auf Glasplättchen kultivierten Neurone kein Primärantikörper zugesetzt, aber sonst auf gleiche Weise behandelt wurden. Die Auswertung erfolgte an einem Mikroskop (BX 50) mit Fluoreszenz Aufsatz (BC-FLA) der Firma Olympus.

2.14 Konfokale Laserscanning-Mikroskopie

Die Schnitte für die konfokale Laserscanning-Mikroskopie wurden analog der oben beschrieben Immunhistochemie behandelt. Als Sekundärantikörper wurden fluoreszenzmarkierte Antikörper verwendet. Die Messung wurde an einem Leica Mikroskop DMIRBE, das an einem konfokalen Laser-System von Leica (TCS 40) angeschlossen war, durchgeführt. Als Lichtquelle diente ein Argon-Krypton Laser. Die folgenden Filter wurden verwendet: Fluorus Avidin Anregung 488 nm, Detektionsfilter FITC; Texas Red Anregung 568 nm, Detektionsfilter Tetramethylrhodamin-isocyanat (TRITC). Die erhaltenen Bilder wurden als Tiff-Bitmap abgespeichert. Um eine mögliche Kolokalisation zwischen p4.1R-Isoformen und dem Aktin-Mikrofilament festzustellen, wurden mittels der Software Corel Draw-Photopaint Version 9 (Corel Corporation Limited, Halberg, FRG) roter (p4.1R) und grüner (Aktin) Kanal überlagert, die Kolokalisation der beiden Proteine drückt sich in der Farbe gelb aus.

2.15 Semiquantitative RT-PCR

RNA wurde aus jeweils 1x105 behandelten und unbehandelten neuronalen Zellen mit dem „Total RNA Purification Kit Micro“ (Eppendorf, Hamburg) nach Angaben des Herstellers isoliert. Eine mögliche Kontamination von genomischer DNA wurde, wie schon beschrieben, durch DNAse Restriktion entfernt. Für die reverse Transkription wurden 1,5 µg Gesamt-RNA eingesetzt. Nach der reversen Transkription wurde der Ansatz mit dem gleichen Volumen dH2O verdünnt. Die PCR wurde in einem Endvolumen von 25 µl durchgeführt (PCR-Cykler, Biometra, Göttingen, FRG). Zwei µl cDNA wurden als Template, 10 µM Primer, 0,2 mM dNTP-Mix, sowie 0,2 units AGS Taq-Polymerase Gold (Hybaid, Heidelberg) in einem Reaktionsansatz verwendet.


31

Protein 4.1 Programm

„hot start“ 94°C ; 2 min

Denaturierung: 94°C 15 s

Anlagern: 59°C; 15 s

Elongation: 68°C; 1 min rarr 29 Zyklen

Endelongation 68°C, 5 min

GAPDH PCR Programm

„hot start“ 94°C; 2 min

Denaturierung: 94°C 15 s

Anlagern: 58°C; 15 s

Elongation: 68°C; 1 min rarr 22 Zyklen

Endelongation 68°C, 5 min

Aktin PCR Programm

„hot start“ 94°C; 2 min

Denaturierung: 94°C 15 s

Anlagern: 58°C; 15 s

Elongation: 68°C; 1 min rarr 22 Zyklen

Endelongation 68°C, 5 min

Die PCR-Produkte wurden auf einem 1,5%igen mit Ethidiumbromid gefärbten Agarosegel aufgetrennt und unter UV-Licht sichtbar gemacht.

Die PCR-Produkte der Haushaltsgene GAPDH und Aktin wurden als Referenz für die verhältnismäßige Expression von Protein 4.1 benutzt. Die PCR-Protokolle wurden so standardisiert, daß die Verdoppelung des PCR-Amplifikates sich noch in der exponentiellen Phase befand. Zur Quantifizierung der p4.1 Expression wurde die optische Dichte der PCR-Bande bestimmt. Anschließend wurde die optische Dichte der p4.1 Bande durch die optische Dichte der Haushaltsproteine dividiert. Als Ergebnis erhält man das Verhältnis von p4.1 zu dem jeweiligem Haushaltsprotein. Durch diese Normierung kann man nun die einzelnen Werte miteinander vergleichen. Die Rohdaten wurden mittels der Software GraphPad Prism Version 2.01 (GraphPad Software Inc., San Diego, USA) ausgewertet. Die statistische Auswertung der Daten erfolgte mit dem Student´s T-Test.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon Oct 1 14:07:23 2001