Kabaeva, Zhyldyz: Genetic analysis in hypertrophic cardiomyopathy: missense mutations in the ventricular myosin regulatory light chain gene

15

Chapter 2. Materials and methods

2.1 Clinical evaluation

A total of 71 unrelated HCM patients were consecutively enrolled from Charité/Franz-Volhard-Klinik (Berlin, Germany), the National Center of Cardiology and Internal Medicine (Bishkek, Kyrgyzstan), Hospital Pulido Valente (Lisbon, Portugal) and Klinik für Thorax- und kardiovaskuläre Chirurgie (Düsseldorf, Germany). Informed consent was obtained in accordance with the guidelines of institutional ethic commissions. Clinical evaluation was performed on the basis of medical history, physical examination, 12-lead electrocardiogram, M/B-mode and Doppler echocardiography, and, in some cases, Holter electrocardiography. The echocardiographic evaluation was performed without prior knowledge of genetic results according to the guidelines of the American Society of Echocardiography.60 Left ventricular (LV) wall thickness of =13 mm43 was used as the inclusion criterion in the absence of other known causes for LV hypertrophy (hypertension, aortic stenosis, etc).

Once the mutations were identified in probands, members of family K and B were invited to undergo genetic analysis and clinical evaluation. The clinical diagnosis of HCM in participating family members was based on the presence of LV hypertrophy observed by echocardiography and corrected to age, weight and body surface area according to Henry et al.61

Blood samples were drawn from all HCM patients and family members in tubes containing 1.6 mg/ml EDTA and stored at -20 °C until DNA extraction. Blood for control DNA was obtained from anonymous blood donors.

Statistical analysis was performed using StatView software, release 4.51, PowerPC Version (Abacus Concepts Inc, Berkeley, California). Data are expressed as the mean value ± standard deviation or number (%) of patients.


16

2.2 Genetic analysis

2.2.1 Approach overview

The approach undertaken in the present study allows performing genome screening for unknown mutations in a large patient group. The screening started with the isolation of total genomic DNA from blood of patients. Genomic DNA was used thereafter as a template for amplifying a gene of interest by means of polymerase chain reaction (PCR). All amplified fragments were screened further by single strand conformation polymorphism (SSCP) analysis. Samples showing an aberrant band pattern on SSCP gels were selected for direct automated DNA sequencing for detection of possible mutations. Once a mutation was identified, it was confirmed by another sequencing run or, when possible, by restriction fragment length polymorphisms analysis. The latter was also used for screening family members for the identified mutation (figure 2.1).

Figure 2.1. Schematic representation of the approach for mutation detection undertaken in the present study. DNA, deoxyribose nucleic acid; PCR, polymerase chain reaction; SSCP, single strand conformation polymorphism.


17

2.2.2 Preparation of genomic DNA

Genomic DNA was isolated from peripheral blood obtained from patients and stored at -20 °C. A modified DNA extraction method suggested by Lahiri and co-workers was used.62 It yields up to 150 µg of DNA from 5 ml of blood. An advantage of this method is that it avoids the use of any toxic organic solvents required for elimination of cellular proteins. Unlike other standard techniques, these proteins are removed by using saturated sodium chloride solution. Moreover, the method eliminates the step of prolonged digestion of samples with proteinase K, thus saving costs and time.62

The following protocol was used:

  1. 5 ml of blood sample, 5 ml of low salt buffer TKM1 (10 mM Tris, pH 7.6; 10 mM MgCl2, and 2 mM EDTA) and 100 µl of triton X-100 were mixed and centrifuged at 2500 rpm for 20 min. The supernatant was poured off.
  2. 5 ml of the TKM1 buffer was added to the pellet and followed by centrifugation at 2500 rpm for 20 min; supernatant was then poured off. This step was repeated at least two times more.
  3. The saved pellet was resuspended in 800 µl of high salt buffer TKM2 (10 mM Tris, pH 7.6; 10mM KCl; 10 mM MgCl2; 0.4 mM NaCl, and 2 mM EDTA) and 50 µl of 10% SDS, mixed and incubated at 55° C for 10 min in a water bath.
  4. 100 µl of 5 M NaCl was pipetted in the tube, mixed and centrifuged at 1200 rpm for 5 min. The supernatant containing DNA (about 1 ml) was transferred into a new tube, mixed with two volumes of absolute ethanol (about 2 ml) at room temperature; the tube was then inverted several times until DNA precipitated.
  5. The DNA was further transferred in a new tube containing 1 ml of ice-cold 70% ethanol and centrifuged for 5 min at 1200 rpm at 4 °C. The DNA containing pellet was dried of rest of ethanol for 10 min in a vacuum centrifuge and then resuspended in 500 µl of Tris buffer (10 mM, pH 8.0) at 65 °C for 15 min and used further as DNA stock solution.


18

The quality of extracted DNA was assessed by agarose gel electrophoresis. Concentration of DNA in the stock solution was determined by measuring the absorption at 260 nm (1 absorbance unit corresponds to 50 µg/ml) in the Ultrospec Plus spectrophotometer (Pharmacia). Working solution containing 25 ng/µl of genomic DNA was diluted from the stock solution adding respective volume of Tris buffer (10 mM, pH 8.0). The stock solution was stored at -20 °C, whereas the working solution was further used for PCR.

2.2.3 Amplification of coding exons of MYL2 and MYL3

The polymerase chain reaction (PCR) is one of the most rapid in vitro methods for producing large quantities of a particular DNA region for further molecular analysis. It is based on the extension of two recombinant oligonucleotide primers, each complementary to the opposite DNA strands and flanking the region of interest. The extension is carried out by a recombinant DNA polymerase in the presence of deoxynucleotides (dNTPs) and buffer containing magnesium. Specially designed PCR thermo cyclers allow rapid changing and repeating of different temperatures required for DNA denaturing, primer annealing and extension.

PCR primers were designed on the basis of MYL2 and MYL3 reference genomic DNA sequences downloaded from GenBank (www.ncbi.nlm.nih.gov). GenBank accession numbers for the MYL2 and MYL3 reference sequences are L01652 and J04462, respectively. Forward and reverse primers were designed for each of the seven coding exons of MYL2 and six coding exons of MYL3 using OLIGO software, release 4.06 (National Biosciences, Inc, Plymouth, USA). The primers are listed in table 2.1.


19

Table 2.1. Oligonucleotide primers used to amplify coding exons of MYL2 and MYL3

Gene

Exon

Forward primer

Reverse primer

 

 

 

 

MYL2

1

5'ACCTATGACTGCCAAAAGCG3'

5'GTAGTGGCTTCCTCTCCTCG3'

 

2

5'GGGGCCTGACCTAGTTTTTT3'

5'TTTGGGATTGTTTGGAGGAT3'

 

3

5'TCCACTCCTGCCAACTCCTT3'

5'ACCCACCTCCTGCTCCTCAT3'

 

4

5'GCCTCATCACCCCATCTCTG3'

5'AGCCCCCCCGAAGAAACATA3'

 

5

5'TCATCTCTGGGGGAACTTGG3'

5'TGTGTGTGTGTAGGGGGG AC3'

 

6

5'AAAGGGGTGCTGAAGGCTGA3'

5'AGACGAGAGGGGAGACGGAG3'

 

7(A)

5'TCCGTCTCAGTTCCCCTCCC3'

5'GTACCCATAGCCACCCAGGC3'

 

7(B)

5'GCCCCATTTATCCACCTCCA3'

5'GGCTTTGGTCATCCAGGTAA3'

MYL3

1

5'GGGGTCATGAGGTATCCGGG3'

5'TCCACTCACTTGCCCTGCTC3'

 

2

5'CCACCTTTTAAGCCGGGCAT3'

5'CCGCAGGACATCCCCACACT3'

 

3

5'ATTGAAGGTGAGCAGGGGTC3'

5'TAACACTATGGGGGCTCTCG3'

 

4

5'GTGTGAGAGGTGGGGATAGC3'

5'TGGAAGGAGTTGGGGTAGGG3'

 

5

5 TGACTCAGCCTCCCACTCCT3'

5'CTCCCCTCCCAGAAGACCCC3'

 

6

5'GGTCTTCTGGGAGGGGAGTG3'

5'TTCCCTGGGCTTCCTGAGAG3'

Each primer was 20 base pairs (bp) in length. Most PCR products were 150-400 bp long, which is in an optimal range for SSCP analysis and DNA sequencing. Exon 7 of MYL2 was divided into two parts, and a primer pair was determined for each part. Primers were located in the exon-flanking intronic region not closer than 30 base pairs to the start/end of exon. This allowed good reading of the sequence of the whole exon. DNA sequencing was performed by the Dye Primer Chemistry method, which requires specific oligonucleotide sequences to be incorporated in a PCR product. This was achieved by attaching the required sequences to 5'-end of primers. The 21-M13 sequence (5'-TGTAAAAGGAGGGCCAGT-3') was attached to each forward primer, whereas the M-13 sequence (5'-CAGGAAACAGCTATGACC-3') was connected to each reverse primer. The primers were produced by BioTeZ.

After obtaining the primers, a PCR protocol was optimised for each exon in terms of primer concentration, primer specific annealing temperature, and number of cycles. Final values are listed in table 2.2.


20

Table 2.2. Optimised parameters of PCR protocols used to amplify coding exons of MYL2 and MYL3

Gene

Exon

Primer concentration

Annealing temperature

Number of cycles

 

 

pmoles/µl

°C

 

MYL2

1

0.125

60

38

 

2

0.125

59

40

 

3

0.2

57

34

 

4

0.16

57

34

 

5

0.125

63

35

 

6

0.125

63

35

 

7A

0.2

59

31

 

7B

0.4

57

35

MYL3

1

0.08

54

32

 

2

0.08

63

34

 

3

0.125

63

34

 

4

0.08

63

34

 

5

0.16

63

29

 

6

1.125

61

32

Note: concentration of forward and reverse primers was identical and calculated for one sample.

The concentration of the required reagents other than primers, i.e. PCR buffer, MgCl2, dNTPs, AmpliTaq DNA polymerase and genomic DNA, was identical for all exons (table 2.3). A PCR mix of final volume of 25 or 38 µl was used. Composition of the reaction mix for amplifying one sample is shown in table 2.3.

Table 2.3. Composition of 25 µl PCR mix for one sample

 

 

MYL2

 

 

MYL3

 

 

ex 1,2,5,6

ex 3,7A

ex 4

ex 1,2,4

ex 3,6

ex 5

 

 

 

 

 

 

 

Reagent, company

end vol,µl

end vol,µl

end vol,µl

end vol,µl

end vol,µl

end vol,µl

 

 

 

 

 

 

 

Deionized water

18,2

17,4

17,8

18,2

18,2

17,8

10xPCR buffer, Appl Bios

2,5

2,5

2,5

2,5

2,5

2,5

MgCl2 , 25 mM, Appl Bios

1,5

1,5

1,5

1,5

1,5

1,5

Forward pr, 5 pmoles/µl, BioTeZ

0,6

1

0,8

0,4

0,6

0,8

Reverse pr, 5 pmoles/µl, BioTeZ

0,6

1

0,8

0,4

0,6

0,8

dNTP, 20 mM, ByoZym

0,3

0,3

0,3

0,3

0,3

0,3

Amplitaq, 5 U/µl, Appl Bios

0,3

0,3

0,3

0,3

0,3

0,3

DNA, 25 ng/µl

1

1

1

1

1

1

Abbreviations used in the table: ex, exon; Appll Bios, Applied Biosystems; Forward pr, forward primer; Reverse pr, reverse primer; dNTP, deoxynucleotides; end vol, end volume


21

All PCR reagents were mixed together in a 0.2 µl PCR tube, which was then placed in a thermal cycler (Peltier Thermal Cycler, MJ Research Inc; Uno-Thermoblock, Biometra). The following cycling programme was used:

I. Initial denaturing

90 °C

2 min

 

94 °C

1min

II. 29 -40 cycles for

 

 

 

annealing

Primer specific annealing temperature (57 - 63 °C)*

15 sec

 

extension

72 °C

2 min

 

denaturation

92 °C

30 sec

III. Final annealing

Primer specific annealing temperature (57 - 63 °C)*

15 sec

IV. Final extension

72 °C

10 min

*Primer specific annealing temperatures are listed in table 2.2.

The quality of obtained PCR products was assessed by agarose gel electrophoresis.

2.2.4 Single strand conformation polymorphism analysis

Single strand conformation polymorphism (SSCP) analysis is a widely used method for carrying out efficient and economical screening for unknown mutations in the PCR amplified region of interest in the genome. The sensitivity of SSCP analysis has been shown to be about 80-90% if fragments are shorter than 400 bp and if optimal running conditions are used.63,64 The method is based on assessment of mobility of a single DNA strand by non-denaturing polyacrylamide gel electrophoresis. Amplified fragments are thermally denatured and rapidly cooled. This results in single DNA strands, which refold in specific conformations unique to the nucleotide sequence. In comparison with wild type, a mutated DNA strand adopts different conformations and, consequently, migrates differently when subjected to electrophoresis. On a stained SSCP gel, such mobility shift can be recognized as an aberrant band pattern. Generally, aberrant band patterns are characterized by the presence of additional bands in comparison with neighbouring patterns. Samples showing an aberrant pattern are selected for further sequence analysis.

In the present study, experimental conditions were optimised for each PCR amplified fragment. Two different conditions with respect to gel composition and running temperature were used to test each sample (table 2.4).


22

Table 2.4. SSCP conditions used to screen MYL2 and MYL3

 

 

MYL2

 

 

MYL3

 

 

 

ex 1- 6

ex 7A

ex 7B

ex 1,3,6

ex 2

ex 4

ex 5

Condition I

 

 

 

 

 

 

 

Gel type

MDE

MDE

MDE

MDE

MDE

MDE

MDE

Temperature, °C

5

5

20

20

20

25

5

Run duration, min

75

75

75

120

120

120

80

 

 

 

 

 

 

 

 

Condition II

 

 

 

 

 

 

 

Gel type

MDE

MDE-F5%

MDE-F10%

MDE

6% PAA

6% PAA

MDE

Temperature, °C

10

20

10

25

17

25

10

Run duration, min

75

75

75

120

100

100

80

Abbreviations used in the table: ex, exon; MDE, Mutation Detection Enhancement gel; MDE-F5%, 2XMDE gel containing 5% of Formamide; 2xMDE-F10%, 2XMDE gel containing 10% of Formamide; 6% PAA, 6% polyacrylarmide gel.

As shown in table 2.4, four different modifications of polyacrylamide gel were used. The Mutation Detection Enhancement (MDE) gel solution is a polyacrylamide matrix that has a high sensitivity to DNA conformational differences. This ready to use solution was purchased from BioWhittaker Molecular Application. MDE gels were used for screening most of the exons. In two exons of MYL2, MDE gels were modified by addition of 5% and 10% of formamide. In two exons of MYL3, 6% acrylamide gel was prepared from a Rotiphorese gel 29:1 ready to use solution (acrylamide/bisacrylamide in ratio 29:1), which was purchased from Roth. Composition of these gels is given in table 2.5.

Table 2.5. Composition of SSCP gels used to screen MYL2 and MYL3

Gel name

Compounds

Quantity, ml

MDE

2xMDE solution

7.5

 

10xTBE buffer

1.8

 

Deionized water

20.8

MDE-F5%

2xMDE solution

7.5

 

10xTBE buffer

1.8

 

Formamide

1.5

 

Deionized water

19.3

MDE-F10%

2xMDE solution

7.5

 

10xTBE buffer

1.8

 

Formamide

3.0

 

Deionized water

17.8

6% PAA

Rotiphorese gel 29:1

4.7

 

10xTBE buffer

1.8

 

Deionized water

20.8

Note: 10xTBE buffer contained 450 mM Tris, 450 mM Boric acid, 20 mM EDTA.


23

An apparatus for casting a SSCP gel consisted of two glass plates sized 26 x20 cm (Amersham Bioscience). One of the plates was coated with 0.5 mm thick and 5 mm broad rubber around the side and foot edges and had a row of 26 small slots. Special firm plastic foil (Serva) was put between the glass plates and used for gel backing. SSCP gel compounds (see table 2.5) were mixed in a glass beaker. Immediately after adding 24 µl of 99% TEMED and 48 µl of 40% ammonium persulfate, a gel was cast in the space between the foil and the rubber-coated plate and polymerised for 1-2 hours.

The PCR products were mixed with equal or double volume of formamide loading buffer (formamide 0.9 g/ml, 10 mM NaOH, 11mM EDTA), denatured at 95 °C for 3 min and quenched on ice for 1 min prior to loading. 8 µl of diluted samples were loaded onto the polymerised gel, which was previously taken out of the glass plates and placed in electrophoresis unit Multiphor II (Pharmacia). The gel was run at 35 Volt and at corresponding temperatures (table 2.4). After electrophoresis, bands on the gel were visualized by silver staining according to a protocol adapted from Pharmacia (table 2.6).

Table 2.6. Silver staining protocol used to visualize DNA on a SSCP gel

Step

Solutions

Time

Fixation

Acetic acid glacial 25 ml

20 min

 

Make up to 250 ml with deionized water

 

Washing

Deionized water

3x2 min

Silver reaction

1% silver nitrate solution 25 ml

20 min

 

37% formaldehyde 0.25 ml

 

 

Make up to 250 ml with deionized water

 

Washing

Deionized water

0.5 min

Developing

Sodium carbonate 6.25 g

until bands become visible

 

37% formaldehyde 0.25 ml

 

 

2% Sodium thiosulphate 0.25 ml

 

 

Make up to 250 ml with deionized water

 

Stopping

Glycin 5 g

10 min

 

0.5 M EDTA 18.8 ml

 

 

Make up to 250 ml with deionized water

 

Preserving

99.5% glycerol 25 ml

10 min

 

Make up to 250 ml with deionized water

 

After silver staining, the gel was transferred onto another glass plate, covered with thin soft plastic foil (Cotech) and fixed by tape. The gel was dried for 24-48 hours, removed form the plate and evaluated. Samples showing an aberrant pattern were


24

selected and subjected to direct automated DNA sequencing for detection of possible mutations.

2.2.5 Automated DNA sequencing

Direct genomic DNA sequencing was performed using the Dye Primer Chemistry method on a 373 DNA sequencing system (Applied Biosystems). The method employs four specific sequencing primers labelled with one of four fluorescent tags (JOE, FAM, TAMRA, ROX) corresponding to the four nucleotides. Using a PCR amplified DNA fragment as a template, each primer is extended in a separate tube in the presence of corresponding dideoxynucleotides and deoxynucleotides as well as DNA polymerase and specific buffer. In each tube, cycle sequencing reaction produces fluorescently labelled, chain-terminated DNA fragments. The contents of all four tubes are pooled together after cycle sequencing and loaded in a single lane on a denaturing gel. During electrophoresis, the labelled fragments pass through a laser beam, directed near the bottom of the gel, which excites the fluorescent tags. The emitted light is then detected by a photomultiplier and directed into a computer, which displays the readout as series of four different coloured peaks, one colour for each nucleotide.

The Dye Primer Chemistry kits for cycle sequencing were purchased from Applied Biosystems. In order to sequence both the sense and antisense DNA strands, two kits containing either forward or reverse primers were used. Each kit included four different ready to use mixes (A-, C-, G-, T-mix) corresponding to each of the four nucleotides (table 2.7).

Table 2.7. Components of Dye Primer Chemistry kit

Ready Reaction Mix

Reagents

A-mix

ddATP, forward/reverse JOE dye primer

C-mix

ddCTP, forward/reverse FAM dye primer

G-mix

ddGTP, forward/reverse TAMRA dye primer

T-mix

ddTTP, forward/reverse ROX dye primer

All mixes

dATP, dCTP, 7-deaza-dGTP, dTTP, Tris-HCl (pH 9.0 at 25 °C),MgCl2, thermall stable pyrophosphatase, ampliTaq DNA polymerase FS


25

Apart from samples with an aberrant band pattern on SSCP gels, two HCM samples with a normal band pattern were sequenced for each exon of MYL2 and MYL3. Control DNA was sequenced when needed.

PCR products were mixed with the ready reaction mixes in four 0.2 µl tubes in following proportions:

Reagent

A, µl

C, µl

G, µl

T, µl

Ready reaction mix

4

4

8

8

PCR product

1

1

2

2

Total volume

5

5

10

10

After brief centrifugation, tubes were put in a thermal cycler pre-heated at 94 °C. The following programme was used:

I.15 cycles of

96 °C

10 sec

 

55 °C

 

5 sec

 

70 °C

60 sec

II.15 cycles of

96 °C

10 sec

 

70 °C

60 sec

After cycle sequencing, contents of the four tubes were centrifuged and pooled together in a 2.0 ml tube already containing 80 µl of 95% ethanol and 1 µl of 2% blue dextran. The sample was further placed on ice for 15 min and thereafter centrifuged for 30 min at 1200 rpm at 4 °C. The supernatant was then poured off, and pellet was dried of rest of ethanol for 10 min in a vacuum centrifuge. For loading, the pellet was resuspended in 3.5 µl of formamide loading buffer (deionised formamide and EDTA/5 % blue dextran in ratio 5:1) or stored at -20 °C, when it was not loaded on the gel the same day.

A 0.3 mm thick sequencing gel was cast between two glass plates sized 25x59 cm (Applied Biosystems) previously washed with 1% alconox solution and cleaned with 70% ethanol. The gel composed of 30 g urea, 10 ml of 30% acrylamide solution, 6 ml of 10xTBE buffer (450 mM Tris pH 8.0, 450 mM boric acid, 20 mM EDTA) and 22 ml of deionized water. 15 µl of 99% TEMED and 350 µl of 10% ammonium persulfate were added to the gel briefly before pouring in. The gel was poured in between the glass plates with the aid of a 50 ml syringe and polymerised for 2 hours.


26

The resuspended pellet (see above) was denatured at 95 °C for 3 min and loaded onto the gel. The gel was run for 15 hours at 2500 Volt. The generated sequences were stored and further analysed manually and by using the Sequencher software, release 4.1, PowerPC Version (Gene Codes Corporation, USA), which facilitated comparison of generated sequences to the corresponding reference sequences obtained from GenBank.

2.2.6 Restriction fragment length polymorphism analysis

Restriction fragment length polymorphism (RFLP) analysis is a method of detecting known mutations by digestion of DNA fragment with a restriction enzyme. In the present study, this method was used to confirm the presence of mutations initially identified on sequencing as well as to screen for it in family members. The method is more rapid and less time consuming when compared to sequencing, but it is possible only when restriction enzyme recognition sequence is affected by a mutation. Some mutations remove existing recognition sites of an enzyme, whereas others introduce new ones. In both cases, the presence of a mutation is recognized by observation of particularly sized restriction fragments.

Screening for the Glu22Lys mutation in exon 2 of MYL2 within family K and controls was done by digestion with the Taqalpha I restriction enzyme (New England Biolabs). 4 µl of amplified fragments were mixed with 4 Units (0.2 µl) of Taqalpha I, 1 µl of 10xNEB buffer, 1 µl of 10xBSA, and 3.8 µl of deionized water. The samples were then incubated at 65 °C for 2 hours in a thermal cycler.

The Sty I restriction enzyme (New England Biolabs, USA) was used to confirm the c.169C>G variant in exon 3 of MYL2. 4 µl of amplified fragments were mixed with 5 Units (0.5 µl) of Sty I, 1 µl of NEBuffer, 1 µl of 10xBSA, and 3.5 µl of deionized water. The samples were then incubated at 37 °C for 2 hours in a thermal cycler.

The digested products were separated on a 4% agarose gel and stained with ethidium bromide.


27

2.2.7 Agarose gel electrophoresis

Agarose gel electrophoresis was used for assessing the quality of genomic DNA and amplified PCR products as well as for separating products of RFLP analysis. A 1.5% agarose gel was used to check the quality of genomic DNA after it was extracted from blood, whereas a 4% agarose gel was used for loading PCR amplified fragments and restriction enzyme digests (table 2.8). DNA was stained with ethidium bromide added into a gel and visualized under UV light on Transilluminator TI 1 (Biometra).

Table 2.8. Agarose gel composition

 

1% gel

4% gel

Agarose, g

0.3

0.8

1xTBE, ml

20

20

1% Ethidium bromide, µl

1.5

1.5

Note: 1xTBE buffer contained 45 mM Tris (pH 8.0), 45 mM Boric acid and 2 mM EDTA.

Agarose powder was mixed with 1xTBE buffer and boiled in a microwave until agarose melted completely. 1.5 µl of ethidium bromide was added into the solution, and it was briefly boiled again. The gel was poured into a horizontal apparatus (GibcoBRL) and polymerised for 20 min. The apparatus was then filled with 1xTBE buffer until it covered completely the gel and appropriate amount of a sample was loaded onto the gel. Loading volume was 2 µl, 3 µl, and 10 µl for genomic DNA, PCR products, and restriction fragments, respectively. 25 base pair and VIII-DNA molecular weight markers (Roche and GibcoBRL) were used to estimate fragment size of amplified and digested products.


28

2.3 Devices and Chemicals

2.3.1 Devices

373 DNA Sequencer

Applied Biosystems

Centrifuge 3K12

Sigma

Centrifuge 3K30

Sigma

Centrifuge RC 5B

Sorvall

Electrophoresis unit Multiphor II

Pharmacia

Enchanced Analysis System 429K

Herolab

Eppendorf Thermomixer 5436/5437

Eppendorf

Horizon 58 Gel electrophoresis Apparatus

GibcoBRL

Ice machine AF - 100

Scotsman

Metallblock-Thermostate DB-3D

Techne

Microwave Micromat

AEG

OPTILAB-Plus-System

MembraPure

Pelitier Thermal Cycler, PTC - 100

MJ Research, Inc

Pelitier Thermal Cycler, PTC - 200

MJ Research, Inc

pH - Meter Calimatic

Knick

Power supply Power Pack P 25

Biometra

Power supply Power Pack ST 606

GibcoBRL

Power supply PS 9009 TC

GibcoBRL

Spectrophotometer Ultrospec Plus

Pharmacia LKB

Thermal cycler Uno-Thermoblock

Biometra

Thermostate Multitemp II/III

Pharmacia

Transilluminator TI 1

Biometra

Vacuum Centrifuge UNIVAPO 150/100

UniEquip

Vacuum pump Cryo Vac

Appligene

Video copy processor

Mitsubishi

Weighing machine Kern 510

Kern


29

2.3.2 Chemicals

Acetic acid (glacial) 100%

Merck

Acetone

Merck

Acrylamide/Bis 29:1

BioRad

Agarose

BioWhittaker Molecular

 

Application

Alconox

Alconox, Inc

Ammonium persulfate

Amresco, Inc

AmpliTaq DNA polymerase

Applied Biosystems

Blue dextran

Pierce

Boric acid

Merck

Bromphenol blue

Pierce

10xBSA buffer

New England Biolabs

DNTPs

ByoZym

Dye Primer Chemistry sequencing kit

Applied Biosystems

Ethanol absolute

Merck

Ethidium bromide

Roth

Ethylenedinitrilotetraacetic acid (EDTA)

Merck

Formaldehyde solution 37%

Merck

Formamide 99.5%

Merck

Glycerol 99.5%

Merck

Glycine

Merck

Hydrochloric acid 32%

Merck

LiChrosolv water for chromatography

Merck

Magnesium chloride

Roth

MDE Solution 2x

BioWhittaker Molecular

 

Application

Mineral oil

Serva

MgCl2 buffer for PCR

Applied Biosystems

10xNEBuffer

New England Biolabs

PCR-buffer

Applied Biosystems


30

Potassium chloride

Roth

Rotiphorese gel 29:1

Roth

Silver nitrate

Merck

Sodium carbonate

Merck

Sodium chloride

Roth

Sodium hydroxide pellets

Merck

Sodium thiosulfate pentahydrate

Merck

Sty I restriction enzyme

New England Biolabs

Taqalpha I restriction enzyme

New England Biolabs

TEMED

Promega

Tris (hydroxymethyl) aminomethane

Merck

Triton X-100 99.6%

Calbiochem

Urea

Merck

Xylene cyanol FF

Pierce


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon Jan 6 12:37:59 2003