<?xml version="1.0" encoding="ISO-8859-1"?><etd lang="de">
   <front>
      <title>Identification and Characterization of the Ion Channel TRPM8 in Prostate Cancer</title>
      <submission>Dissertation</submission>
      <degree>zur Erlangung des akademischen Grades <br/>doctor rerum naturalium <br/>(Dr. rer. nat.)</degree>
      <school>im Fach Biologie</school>
      <major>eingereicht an der <br/>Mathematisch-Naturwissenschaftlichen Fakultät I <br/>der Humboldt-Universität zu Berlin</major>
      <author>
         <given>Simone</given>
         <surname>Kaiser</surname>
         <br/>
         <suffix>geboren am 10.10.1973 in Berlin</suffix>
      </author>
      <dean>Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I <br/>Prof. Dr. Michael Linscheid<br/>
      </dean>
      <approvals>
         <name>Prof. Dr. Thomas Börner</name>
         <name>Prof. Dr. Matthias Dürst</name>
         <name>PD Dr. Wolfgang Kemmner</name>
      </approvals>
      <date>Eingereicht am:30.12.2003</date>
      <date>Tag der mündlichen Prüfung:10.06.2004</date>
      <abstract lang="en">
         <head>Zusammenfassung</head>
         <p>Das Prostatakarzinom ist die häufigste Krebserkrankung des Mannes. Bei den zu Tode führenden Tumoren wird es im Jahre 2003 nach dem Bron­chialkarzinom an 2. Stelle stehen. Diese Inzidenz zeigt, dass dringend neue diagnosti­sche Marker und therapeutische Zielgene zur Be­handlung von Pros­tatakrebs benötigt werden. </p>
         <p>Ziel dieser Dissertation war es, mit Hilfe der DNA-Chiptechnologie neue tumorrelevante Gene für eine Small-Molecule- und Antikörper-Basierte Therapie des Prostatakarzi­noms zu identifizieren. Auf einen proprietären Tumor-Chip der Firma metaGen Pharmaceuticals GmbH wurde mikrodissektiertes Normal- und korrespondieren­des Tumorgewebe von 52 Prostatatumorpatienten hybri­disiert. Mit Hilfe bioinfor­matischer Analysen der Chipergebnisse konnte das Gen TRPM8 identifiziert werden, das in Prostatatumoren in mehr als 56% der Patienten überexpri­miert ist. </p>
         <p>Northern-Blot, Dot-Blot und Chipexperimente zeigten, dass TRPM8 un­ge­wöhnlich gewebespezifisch exprimiert wird. In mehr als 400 getesteten Tumor­patienten und in 23 Normalgeweben wurde TRPM8 ausschließlich in der Prostata und neuroendokrinen Tumoren nachgewiesen. </p>
         <p>TRPM8 gehört zur Familie der Transient Receptor Potential Channel Proteins. Es konnte hier erstmals in Fluoreszenz-Resonanz-Energie-Transfer- Experi­menten (FRET) gezeigt werden, dass TRPM8 Multi-Homomere bildet. Dies wurde bisher nur für Kanäle anderer TRP-Subfamilien (TRPV und TRPC) gezeigt.</p>
         <p>Weiterhin konnten erstmals mehrere Spleißvarianten von TRPM8 identifiziert werden. Quantitative RT-PCR Expe­rimente zeigten, dass diese noch stärker in Prostatatumoren überexprimiert sind als TRPM8 selbst. Des Weiteren wurde ein neues Gen auf dem DNA-Gegenstrang von TRPM8 entdeckt, das mit Exon 11 von TRPM8 100% komple­mentär ist und an der Regulation von TRPM8 beteiligt sein könnte. </p>
         <p>Der Promotor von TRPM8 wurde durch eine in silico Analyse identifi­ziert und in vitro bestätigt. Obwohl eine starke androgenabhängige Ex­pression von TRPM8 in LNCaP Zellen gezeigt werden konnte, wurden keine Bindungs­stellen für androgenabhänginge Elemente gefunden. Allerdings lie­ßen sich drei Bin­dungsstellen des androgenregulierten Homeoboxgens NKX3.1 identifizieren.</p>
         <p>Die Ergebnisse dieser Arbeit zeigen, dass TRPM8 und seine Isoformen aufgrund ihrer Gewebspezifität ausge­zeichnete Angriffspunkte für eine zielgerichtete Prostatakrebstherapie sind.</p>
      </abstract>
		<keywords lang="de">
			<keyword>TRPM8</keyword>
			<keyword>Prostata</keyword>
			<keyword>Krebs</keyword>
			<keyword>Chip</keyword>
			<keyword>
		Ionenkanal</keyword>
		</keywords>

      <abstract lang="en">
         <head>Abstract</head>
         <p>Prostate cancer is the most commonly diagnosed malignancy in men in the Western World. In 2003 malignancies of the prostate will be the second most common fatal cancer in men after lung cancer as estimated by the American Cancer Society. Despite the tremendous efforts made in the past to improve the treatment of prostate cancer patients, there is still an urgent need for new markers and therapeutic targets for medication. </p>
         <p>The aim of this thesis was the identification of new genes relevant in prostate cancer, which could be used in a small-molecule or antibody based therapy of prostate cancers. Microdissected matched prostate cancer and normal tissues of 52 prostate cancer patients were hybridized to a proprietary high density Cancer-Chip based on Affymetrix GeneChip technology. Using a bioinfor­matic analysis, it was possible to identify TRPM8, which was highly overex­pressed in 56% of prostate cancer patients. Northern blot, dot blot and gene chip experiments revealed that TRPM8 expression is extremely tissue specific. Of 400 patients and 23 tissues tested, TRPM8 expression could only be de­tected in the prostate and neuroendocrine tumors.</p>
         <p>Functionally, the protein belongs to the transient receptor potential channel family of non-voltage gated proteins. It could be shown for the fist time that TRPM8 subunits form homomers using FRET technology. </p>
         <p>Molecular characterization of TRPM8 transcription revealed multiple splice forms of TRPM8. Further, it was possible to identify a new mRNA present on the opposite strand of TRPM8, which was 100% complementary to exon 11 of TRPM8, thus it could possibly function as a regulatory RNA of TRP channel. All of these isoforms were found to be even higher overexpressed in prostate tumors than TRPM8 itself.</p>
         <p>The promoter region of TRPM8 was identified using in silico methods and confirmed in promoter reporter assays. Although a high androgen dependent transcriptional activation of TRPM8 could be found by RT-PCR in LNCaP cells, no androgen responsive elements was identifiable within the promoter region. On the other hand three binding sites for the androgen dependent homeobox gene NKX3.1 and several other homeobox genes were discovered. </p>
         <p>The results of the thesis show that TRPM8 and its isoforms are, due to their tissue specificity, ideal targets for the development of new therapeutic drugs for the treatment of prostate cancer.</p>
      </abstract>
		<keywords lang="en">
			<keyword>TRPM8</keyword>
			<keyword>
prostate</keyword>
			<keyword>
cancer</keyword>
			<keyword>
microarray</keyword>
			<keyword>
Ionchannel</keyword>
		</keywords>
<p>
            <pagenumber numbering="lroman" start="1"/>
         </p>
   </front>
   <body><chapter><head>
         <pagenumber numbering="arabic" start="1"/>INTRODUCTION</head><section><head>Incidence of prostate cancer</head>
      <p>Cancer deaths account for 23% of all deaths in Western Europe and the United States ranking second only to deaths from heart disease. When deaths are categorized by age, sex, and cause, cancer is by far the main cause of deaths among men and women between 40 and 79 years of age [<link ref="_bib145">Jemal, 03a</link>]. Among can­cers, malignancies of the prostate are the most commonly diagnosed tumors in European and American males [<link ref="_bib146">Howe, 01</link>; <link ref="_bib3">Kieschke, 02</link>]. In 2003 malignancies of the prostate will be the second most common fatal can­cer in men (10%) after lung cancer (31%), followed by colorectal cancer (10%) [<link ref="_bib145">Jemal, 03b</link>], as estimated by the American Cancer Society. </p>
      <p>In Germany approximately 700,000 men suffer from prostate cancer. It is the most frequently (18,7%) diagnosed tumor with an incidence of 31.500 cases displacing 1998 lung cancer as the most frequently diagnosed carcinoma [<link ref="_bib3">Kieschke, 02</link>]. Prostate cancer afflicts men at an average age of 72 years, 6 years above that of cancer in general. The five-year relative survival rate of prostate cancer in Germany is 70%. In general, the number of diagnosed prostatic malignancies has increased, but the numbers of deaths per year have decreased in the last years. The reasons for this increase in incidence is the aging population and most importantly, the improved early detection methods such as serum testing of prostate specific antigen (PSA) and the digital rectal examination (DRE). Early detection as well as improved surgical intervention and radiation therapy have reduced the number of deaths significantly. But prostate cancer still ranks third of all lethal cancers causing about 18,000 deaths per year in Germany [<link ref="_bib3">Kieschke, 02</link>]. </p>
      <p>Although more men die with prostate cancer than of prostate cancer, there is still no effective cure for many patients suffering especially from aggressive and advanced forms of prostate cancers. PSA screening is one of very few preoperative parameters of prognostic relevance. So far it is not possible to distinguish between aggressive and minor severe forms at an early stage of the disease. </p></section><section><head>Biological function of the prostate</head>
      <p>The prostate is a walnut-sized gland surrounding the urethra at the base of the bladder. It is surrounded by a fibroelastic capsule that penetrates the gland to divide it into lobes. The prostate contributes to the seminal fluid an alkaline liquid which is rich in spermine, phosphlipids, cholesterol, fibrinogenase, cit­ric acid, fibrinolysin, zinc and acid phosphatase and other proteins. The seminal fluid consists further of the fluid produced in the seminal vesicles and the sperm. <pagenumber numbering="arabic" start="2"/>The sperm, produced in the testis, enters the upper portion of the prostate through the vas deferens. Sperm and fluid from the seminal vesicles then mix with secretions emitted from the prostate to form the seminal fluid that is expelled at the time of ejaculation. </p>
      <p>Interestingly, the prostate is neither required for viability nor for basal levels of fertility. It is widely discussed that this might be the reason for its high incidence of cancer as other vitally important organs of the urogenital system, such as the seminal vesicles and bulbourethral glands, are nearly immune to neoplasias [<link ref="_bib1">Abate-Shen, 00a</link>]. </p></section><section><head>Development of Prostate cancer</head>
      <p>The cause of prostate cancer is still not very well understood. A distinguishing feature of this cancer is its intimate association with aging [<link ref="_bib1">Abate-Shen, 00d</link>]. Usually clinically detectable prostate cancer is not manifest until the age of 60 or 70. Hereditary factors account for about 10% of prostate cancers and are generally associated with an early onset of the disease [<link ref="_bib161">Carter, 92</link>]. To date, two family susceptility loci have been mapped to X chromosome and to a region of chromosome 1q, although no candidate gene has been found so far [<link ref="_bib162">Smith, 96</link>; <link ref="_bib163">Xu, 98</link>]. Another feature is that African American men have a higher incidence and more aggressive forms of prostate cancer than white men who in turn have a higher incidence than men of Asian origin. Additionally, androgens play a povital role in all stages of the disease. High fat diets are also suspected to increase the risk of prostate cancer while a diet rich in soy may be protective. These observations have been proposed as reasons for the low incidence of this cancer in Asia [<link ref="_bib164">Kristal, 02</link>].</p></section><section><head>Pathological classifications of prostate cancer</head>
      <p>Prostate cancers are generally of multifocal nature and belong the most heterogeneous tumors in humans [<link ref="_bib160">Macintosh, 98</link>]. 70% of the tumors arise in the peripheral zone, whereas 15-20% arise in the central zone, and 10 -15% arise in the transitional zone.</p>
      <p>Most of the prostate tumors are adenocarcinomas (95%), only about 4% of cases have transitional cell morphology and are thought to arise from the uroehelial lining of the prostatic urethra. Few cases have neuroendcrine morpholgy. These cells are believed to arise from the neuroendocrine stem cells normally present in the prostate (<link ref="_Ref60480263">Fig. 1</link>). </p>
      <p>
         <pagenumber numbering="arabic" start="3"/>
         <mm entity="Grafik1" label="256#210">
            <caption>
               <link id="_Ref60480263"/>Fig. 1 Schematic view of the cell types within a human prostatic duct. Neuroendocrine cells are morphological indistinguishable from basal cells. Taken from [<link ref="_bib1">Abate-Shen, 00b</link>]. </caption>
         </mm>
      </p>
      <p>Prostate cancer progresses from an enlargement (benign prostatic hyperplasia [BPH]) to precursor lesions (prostate intraepithelial neoplasias [PIN]) on to invasive carcinomas and ultimately to metastases. BPH is an abnormal growth of prostate cells occurring in nearly all men over the age of 70. Cells from a BPH are larger in shape but they do not spread to other tissues. Thus benign tumors are not treated unless symptoms such as pain and/or difficulties in the urine flow require treatment. The PIN is a precursor of carcinoma. It is recognized as a continuum between low-grade and high-grade forms with high-grade PIN thought to represent the immediate precursor of early invasive carcinoma [<link ref="_bib1">Abate-Shen, 00e</link>].</p>
      <p>Nowadays there are two major systems used for the pathological graduation of malignant prostate cancers: The Tumor Node Metastasis (TNM), which evaluates the location and size of a tumor and the Gleason grading system, which describes the tumor&#8217;s degree of differentiation and cell anaplasia. For better understanding of the clinical terminology used in this study a brief description of the main characteristics and pathological classifications of prostate cancer is given in the next paragraphs.</p><subsection><head>The TNM staging system for prostate cancer</head>
      <p>The TNM staging system was already developed in 1977 by Ammon et al., but it was not before 1997 that it was predominantly used for evaluating prostate cancer. The TNM staging is based on the location and size of the tumor. It evaluates the local tumor growth (T), the lymph nodes (N) and the distant metastases (M) (<link ref="_Ref55733454">Fig. 2</link>). Tumors staged as T1 (a-c) are small and unapparent, they cannot be felt during rectal examination. It may be found by chance when surgery is done for other reasons, usually for BPH (Benign Prostate Hyperplasia). There is no sign that the tumor has spread outside the prostate. A stage 2 tumor is locally restricted tumor, yet lager in size and which can be detected during rectal examination or through biopsy. Tumors stage 3, have spread outside the prostate to nearby tissues such as the seminal vesicles. The last T stage of the TNM system is characterized by tumors which have spread or <pagenumber numbering="arabic" start="4"/>are attached to organs near the prostate, such as the bladder. The affection of the lymph nodes is described by pathologist as N status (N0-N3). The M status characterizes the existence of metastasis in organs such as lungs, liver or brain.</p>
      <p>
         <mm entity="Grafik2" label="521#400">
            <caption>
               <link id="_Ref55733454"/>Fig. 2 Anatomical staging of prostate cancer. The TNM system evaluates the location and size of a tumor in the prostate. T = local tumor growth, N = the lymph nodes, M = distant metastases. </caption>
         </mm>
      </p></subsection><subsection><head>The Gleason grading system</head>
      <p>In contrast to the TNM system, which evaluates the localization and size of the tumor, the Gleason grading system published by Gleason and Mellinger in 1974 evaluates the tumor&#8217;s degree of differentiation and cell anaplasia [<link ref="_bib60">Gleason, 74b</link>] (<link ref="_Ref55894836">Fig. 3</link>). Thereby the variation in cell size, shape and staining properties are taken into account. It distinguishes between well differentiated cells, moderately and poorly differentiated cells (cells which are distorted and irregular). The Gleason grading is obtained by summing the degree of cellular differentiation found on the two predominant patterns in a pathological specimen. Well differentiated cells which look closest to normal cells receive the Gleason score 1, poorly differentiated cells get score 5. These two grades are referred to as the Gleason grade. Score 2- 4 is considered as low grade, score 5-7 is considered as moderate, and score 8-10 is considered as a high grade tumor which is poorly differentiated. </p>
      <p>
         <pagenumber numbering="arabic" start="5"/>
         <mm entity="Grafik3" label="374#214">
            <caption>
               <link id="_Ref55894836"/>Fig. 3 Gleason Grading of the prostate [<link ref="_bib60">Gleason, 74a</link>]. </caption>
         </mm>
      </p></subsection></section><section><head>Treatment of prostate cancer</head>
      <p>Although especially in older patients with early stage cancers it is enough to carefully watch the tumor growth as these cancers usually grow at a very slow rate and the possible risks and side effects of therapy may outweigh the possible benefits, many prostate tumors need treated through surgery, radiation or hormones. </p><subsection><head>Classical treatment</head>
      <p>The radical prostatectomy and the radiation therapy are the most commonly used treatment forms for clinically localized prostate cancer (T1 and T2). The surgery involves removal of the entire prostate and in some cases of the surrounding tissues as part of the urethra and the seminal vesicles. Radiation may be used to destroy cancer cells that may have remained in the area after surgery, but it is also used as a stand alone therapy<footnote start="1">
            <p>http://www.cancer.gov/cancerinfo/wyntk/prostate</p>
         </footnote>. </p>
      <p>Tumors which have spread out of the prostate gland (T3) and are thus beyond the reach of a local treatment by surgery or radiation, are treated by hormonal therapy. Although hormonal therapy cannot cure, it usually shrinks or stops the advance of the disease. Drugs which are used nowadays for treatment are either antiandrogens, which block the action of the androgens (for example flutamides and bicalutamide) or drugs which block the testicals from producing testosterone (e.g. luteinizing hormone-releasing hormone (LH-RH) agonists as leuprolide and goserelin). Finally aminoglutethimide and ketoconazole are used to prevent the adrenal glands from producing androgens. </p>
      <p>Chemotherapy is seldom used for prostate cancer treatment as the response rate is very low. Usually these unspecific systemic drugs are given when hormone therapy has failed. Today drugs such as Docetaxel, Doxorubicin or Estramustine phosphate are used for treatment. </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="6"/>New treatment forms</head>
      <p>In the last years the development of target drugs for the treatment of cancers has dramatically increased, a progress that is likely to continue in the future. This approach is based on the targeting of genes found to be overexpressed in tumors or other disease by monoclonal antibodies, small-molecules, immunotoxins and antisense oligonucleotides. This form of therapy has considerable advantage over unspecific systemic drugs such as the chemotherapy. They are more specific, thus less toxic, and more effective in the treatment of cancer [<link ref="_bib167">Stockwin, 03b</link>]. Antibodies (150 kD) are used to target the extracellular portion of membrane proteins, whereas small-molecules can also inhibit the function of intracellular localized proteins as they can penetrate through the membrane (smaller than 1 kD) [<link ref="_bib166">Seemann, 90a</link>]. </p>
      <p>For example antibodies are used to treat indications as diverse as cancer, inflammation and infectious disease. They can be used as cell targeting reagents and thus tag specific cells for complement- or effector-mediated lysis. Antibodies can further be modified to deliver toxic or modulatory payloads (radionuclides or enzymes) [<link ref="_bib167">Stockwin, 03c</link>]. </p>
      <p>Up to now several monoclonal antibodies have been developed, especially those gainst the extracellular portion of receptor tyrosine kinases [<link ref="_bib166">Seemann, 90c</link>]. Herceptin, a humanized monoclonal antibody against the Her2/neu receptor tyrosine kinase, was shown to prolong the survival of women with Her-2/neu positive metastatic breast cancer, when combined with chemotherapy [<link ref="_bib166">Seemann, 90b</link>]. </p>
      <p>As an example for a small-molecule the STI-571 has to be named, it was shown to inhibit the Bcr-Abl, c-kit and platelet derived growth factor receptor tyrosine kinases, and thus produced dramatic clinical responses in patients with Bcr-Abl positive chronic myeloid leukemia and c-kit positive gastrointestinal stromal tumors [<link ref="_bib165">von Bubnoff, 03</link>]. </p>
      <p>It seems possible that targeted drugs will be used in association with existing medical, surgical, and radiotherapeutic therapies and will play an important role in the aim of curing cancer. </p></subsection></section><section><head>androgens in prostate cancer</head>
      <p>The importance of androgens in prostate cancer was first described by Huggins and Hodges in the early 1940s [<link ref="_bib137">Huggins, 02</link>]. Since then, significant research has shown that the interrelationship between hormone and cancer is very complex and is best exemplified by the recurrence and progression of prostate cancer after hormonal therapy to a lethally resistant phenotype [<link ref="_bib118">So, 03</link>]. </p>
      <p>Androgens, principally testosterone, play a critical role in the development and growth of the male reproductive system. Their biological actions are mediated by the androgen receptor (AR), a ligand-dependent transcription factor, belonging to the nuclear receptor superfamily. These androgen-AR complexes interact with various transcription activators or repressors in order to modulate transcription of <pagenumber numbering="arabic" start="7"/>androgen target genes via specific DNA sequences [<link ref="_bib119">Lee, 03</link>]. The AR is composed of an N-terminal domain, a DNA binding domain, a hinge region and a ligand binding domain. In its inactive form the AR is complexed to heat-shock proteins in the cytoplasm. After binding a specific ligand (i.e. 5alpha-dihydrotestosterone) the ligand-receptor-complex translocates to the nucleus and binds a specific androgen responsive element (ARE) within the promoter of various genes. Genes affected by the AR are for example the KLK3 (Kallikrein3) gene which codes for PSA and the homeobox gene NKX3-1 [<link ref="_bib147">Gregory, 98</link>].</p>
      <p>Androgen ablation and anti-androgen therapy has become the cornerstone of treatment for patients with locally advanced or metastatic prostate cancer. Among the earliest detected effects of androgen withdrawal are decreases in the intranuclear concentration of androgens and the AR as well as decreased PSA levels in the blood. Although 80 &#8211; 90% of patients respond initially to this therapy the majority gradually develops resistance [<link ref="_bib138">Laufer, 00</link>]. The mechanism of change from tumors being androgen-responsive to being androgen-unresponsive is poorly understood [<link ref="_bib120">Suzuki, 03</link>]. Interestingly, clinical findings indicated that in androgen ablation therapy-resistant prostate cancer PSA and other genes regulated by androgens as well as the AR by itself are still expressed. This led to the assumption that a ligand-independent activation of the androgen receptor may be the underlying mechanism of androgen independence. In fact, multiple signaling pathways have been implicated in AR non-steroidal activation including estrogen, progesterone, peptide growth factors and cytokines [<link ref="_bib122">Debes, 02</link>]. These factors are able to induce transactivation of the AR under androgen-depleted conditions reviewed in[<link ref="_bib121">Huang, 02</link>]. Dysregulation of the AR in prostate cancer further results in an abnormal profile of AR-regulated genes which include cell cycle regulators, transcription factors and proteins important for cell survival, lipogenesis, and secretion. Additionally, this receptor is a target for somatic mutation and deregulated androgen signaling is a potential consequence of such mutations reviewed in [<link ref="_bib139">Bentel, 96</link>]. Not only is this androgen independence a sign of an emerging disease, it is also associated with a poor prognosis [<link ref="_bib141">Sadar, 99b</link>].</p></section><section><head>Diagnosis of prostate cancer</head>
      <p>Digital rectal examination (DRE), measurement of the prostate specific antigen (PSA) in the blood and the transrectal ultrasonography (TRUS) are the main parameter used in prostate cancer diagnosis. Nowadays prostate cancer is not diagnosed by symptoms, but because of increased levels of PSA in the blood and abnormal findings in the DRE. Thus it was possible to diagnose more and more patients at earlier stages of the disease, hoping to increase the probability of a cure.</p><subsection><head>
         <pagenumber numbering="arabic" start="8"/>Prostate Specific Antigen </head>
      <p>Prostate cancer antigen (PSA) is a tissue specific tumor marker routinely used to diagnose prostate cancer and to monitor treatment response, prognosis and progression of prostate cancer [<link ref="_bib141">Sadar, 99a</link>]. It is a single-chain glycoprotein with a molecular mass of about 33 kD which functions in the liquefaction of seminal coagulum. Serum levels of PSA of healthy patients are between 0 &#8211; 4 ng/ml. In prostate tumor patients the PSA levels can raise up to 100 ng/ml. Generally, PSA levels rise with tumor volume, but it is expressed in all stages of cancer [<link ref="_bib75">Caplan, 02b</link>]. Although PSA is the best marker for prostate cancer existing today, it is still far from being perfect. For example, PSA tends to increase with age and rises in men with evidence of benign prostatic hyperthrophy. Thus many men are diagnosed falsely positive for prostate cancer. On the other hand PSA levels do not increase in some patients with prostate cancer which leads to a false negative diagnosis. Additionally, preoperative PSA cannot be used to predict capsular penetration or seminal vesicle invasion. Further, PSA is not able to predict progression in adenocarcinomas of the prostate following radical prostatectomy [<link ref="_bib88">Sauvageot, 98b</link>].</p></subsection><subsection><head>Regulation of PSA</head>
      <p>The Kallikrein 3 (KLK3) gene which codes for PSA is primarily regulated by androgens. In the proximal promoter of the KLK3 gene are two functional androgen-response elements (AREs) located [<link ref="_bib85">Riegman, 91</link>; <link ref="_bib86">Cleutjens, 96</link>]. The core region of the enhancer could be mapped within a 440-bp fragment. A functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) was identified in the center of this fragment. Mutation of this element almost completely abolished PSA promoter activity. Therefore PSA levels undergo a sharp decline following an anti-androgen therapy or surgical castration. However, when in the absence of androgens the tumors change to an androgen-independent state, PSA levels increase due to an alternative activation mode. At this stage tumor progression is mostly <url href="http://dict.leo.org/?p=/37m..&amp;search=inexorably" type="URL">inexorably</url> and untreatable.</p></subsection></section><section><head>Microarray analysis in cancer research</head>
      <p>The main goal of metaGen Pharmaceuticals GmbH was the identification of novel target genes for the development of therapeutic antibodies or small-molecule drugs in different tumor entities. One of the main questions was to find the best method for the identification of new genes. The first description of a &#8220;high-capacity system to monitor the expression of many genes in parallel&#8221; was published in 1995 [<link ref="_bib61">Schena, 95</link>]. They showed that it was possible to detect the expression of 45 Arabidopsis genes simultaneously by spotting the complementary DNAs of these genes on a glass slide and hybridizing samples of RNA to this chip. The development in this field has been more than dramatic in the last years. Today it is possible to detect the expression of the complete <pagenumber numbering="arabic" start="9"/>human genome, represented by approximately 47,000 transcripts on only one DNA chip (Affymetrix, Santa Clara, CA, USA). </p>
      <p>Nowadays two major groups of DNA microarrays are available: First, cDNA microarrays where oligonucleotides or cDNAs are spotted to a glass microscope slide, second, high density microarrays where nucleotides are synthesized to a specific matrix (Affymetrix). The advantage of the first method is the high flexibility of genes spotted to the slide and the possibility of hybridizing two different samples simultaneously to the chip at relatively low cost. Affymetrix chips only provide the possibility of hybridizing one pool of mRNA at a time at relatively high cost, but have the considerable advantage of synthesizing more than 40,000 genes to one chip. Probe preparation and analysis procedures are quite the same for both chips: The isolated RNA from tissues or cell lines is labeled with fluorochromes before hybridization. A scanner records the intensity of fluorescence per probeset and different bioinformatics tools are used to interpret the huge amount of data sets.</p>
      <p>In order to detect genes relevant in different cancer entities metaGen decided to use the Affymetrix technology. At that time it was not possible to synthesize more than approximately 10,000 genes on one chip. Thus 5 chips would have been necessary to analyze the whole genome for differentially expressed genes. First of all this approach was much too expensive and on the other hand, most of the genes present on these chips are not relevant in prostate cancers.</p>
      <p>Consequently, a customized Cancer-Chip was designed at metaGen for the identification of tumor specific genes (<link ref="_Ref60760390">Fig. 4</link>). The chip design based on a bioinformatic attempt mining systematically expressed sequence tag (EST) libraries [<link ref="_bib8">Schmitt, 99c</link>]. Briefly, about 4 million ESTs of public<footnote start="2">
            <p>
               <url href="http://www.ncbi.nlm.nih.gov/dbEST/" type="URL">http://www.ncbi.nlm.nih.gov/dbEST/</url>
            </p>
         </footnote> and proprietary databases were sorted for tissues specificity and into pairs of benign and cancer tissues. The numbers of ESTs matching to a specific sequence were counted for each pool (normal, tumor and tissue). The sequences which exhibited significant differential expression between normal and cancer tissue were selected and added to the metg001A chip (The procedure is described in detail in &#8220;Methods&#8221;). </p>
      <p>
         <pagenumber numbering="arabic" start="10"/>
         <mm entity="Grafik4" label="436#217">
            <caption>
               <link id="_Ref60760390"/>Fig. 4 The metaGen Affymetrix Cancer-Chip (metg001A). This chip contains about 6200 probe sets which represent roughly 3,000 genes. Nearly half of the sequences represent genes which have been shown to be overexpressed in various tumor entities.</caption>
         </mm>
      </p>
      <p>These sequences and most of the known tumor associated genes made up the main part of the newly developed metg001A Cancer-Chip. This concentration of cancer associated genes on one chip made it possible to screen for relevant tumor markers in different entities at relatively low cost and in dramatically reduced time. By the use of this proprietary chip it was strongly expected to find overexpressed genes in cancers which have not yet been discovered by other groups and by other methods.</p></section><section><head>Transient Receptor Potential Channels </head>
      <p>Hybridization of the metg001A chip with 52 matched prostate normal and tumor tissues revealed a number of genes differentially expressed in prostate cancer patients. One of these genes, the Transient Receptor Potential Protein 8 (TRPM8), was selected for further evaluation. At the time of identification TRPM8 was a completely unknown gene, not described in the literature. </p>
      <p>Up to now, some very interesting features of this gene and especially of this whole protein family have come up. A short overview will be given in the next chapters. </p><subsection><head>The TRP superfamily</head>
      <p>The outstanding feature of the TRP superfamily is its considerable diversity in modes of activation and function. They are involved in processes ranging from sensory physiology of cold and heat to vasorelaxation and male fertility [<link ref="_bib33">Montell, 02d</link>]. The discovery that TRP channels are able to sense temperatures and flavors was honoured as one of the top ten scientific achievements in the year 2002 by Sience, showing the increasing importance of TRPs [<link ref="_bib172">02</link>].</p>
      <p>Biochemically the TRPs belong to the group of non-voltage gated ion channels - the so called capacitive calcium entry (CCE) channels [<link ref="_bib11">Nilius, 03c</link>]. They are activated by various chemical and physical stimuli and also by depletion of <pagenumber numbering="arabic" start="11"/>intracellular Ca2+ stores, which is followed by a cation influx to the cytosol. TRPs consist of six transmembrane spanning helices, a pore region between Transmembrane (TM) 5 and TM 6 and cytoplasmatic N- and C-termini [<link ref="_bib39">Clapham, 01a</link>] (<link ref="_Ref60760879">Fig. 5</link>). </p>
      <p>
         <mm entity="Grafik5" label="520#182">
            <caption>
               <link id="_Ref60760879"/>Fig. 5 Architecture of TRP channels. A) TRP channels consist of six transmembrane spanning helices and a pore region between TM5 and TM6 where different mono- and divalent cations can pass through the pore [<link ref="_bib39">Clapham, 01b</link>]. B) Top view of the TRPV5/6 heterotetrameric channel. The complex is formed by four momomeric subunits of TRPV5/6. The calcium binding site within the pore is formed by 4 aspartate residues [<link ref="_bib40">den Dekker, 03</link>].</caption>
         </mm>
      </p>
      <p>The first member of the TRP family was identified as a Drosophila gene responsible for visual transduction [<link ref="_bib41">Lo, 81</link>]. Because of its transient rather than sustained response to light in mutant flies it was named transient receptor potential (trp). Up to now more than 20 mammalian TRP members are known. They are classified into three subfamilies according to their structural and sequence similarities [<link ref="_bib11">Nilius, 03d</link>; <link ref="_bib37">Grimm, 03b</link>]. The first group are the TRPC (C stands for canonical subfamily) which have a high homology to Drosophila TRP channels. Second, the TRPV subfamily (V stands for vanilloid) which are closely related to vanilloid receptor 1 (TRPV1), and third the TRPM family members which are highly homologue to the tumor suppressor melastatin (TRPM1). </p>
      <p>The phylogenetic tree of all mammalian TRPs as known today is shown in <link ref="_Ref50193760">Fig. 6</link>. </p>
      <p>
         <mm entity="Grafik6" label="391#247">
            <caption>
               <link id="_Ref50193672"/>
               <link id="_Ref50193760"/>Fig. 6 The phylogentic tree of the mammaliean TRP channels based on their homology [<link ref="_bib11">Nilius, 03a</link>].</caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="12"/>TRPs are activated mainly through the phospholipase C (PLC) and G-protein coupled receptors (GPCR) which in turn generate inositol (1,4,5) trisphosphate and diacylglycerol (DAG) [<link ref="_bib30">Bakowski, 02</link>; <link ref="_bib29">Putney, Jr., 97</link>; <link ref="_bib28">Putney, Jr., 99</link>]. But also DAG by itself has proved to activate TRP channels [<link ref="_bib31">Hofmann, 99b</link>; <link ref="_bib32">Chyb, 99</link>]. Surprisingly during the last years new TRPs have been indentified which can be activated by chemical and physical stimuli such as heat, cold, mechanical stress, bitter-sweet compounds, reactive oxygen species, pH, pheromones, phorbolesters and vanilloid compounds. For example TRPV1 responds to capsaicin and temperatures over 43°C by generating inward membrane currents, suggesting that it functions as a transducer of painful thermal stimuli [<link ref="_bib45">Caterina, 97a</link>].These findings are remarkable as these functions give insight into new modes of channel regulation [<link ref="_bib11">Nilius, 03b</link>].</p></subsection><subsection><head>TRPM 1 to 7</head>
      <p>Less research has been done on members of the TRPM family. Until now 8 homologs of TRPMs are known, counting form TRPM1 to TRPM8. The name (TRPM) has been chosen because the first described member of the group was melastatin (MLSN) [<link ref="_bib33">Montell, 02a</link>]. Prior to the implementation of a unified nomenclature by Montell at al. in 2002 this subfamily was also known as LTRPC. Members are characterized by relatively long N- and C-termini with some of them having entire enzyme domains linked to their C-terminus. For example TRPM2 has an ADP-ribose pyrophosphatase [<link ref="_bib24">Perraud, 01b</link>] and TRPM6 and TRPM7 have an atypical &#945;-kinase domain in TRP [<link ref="_bib24">Perraud, 01a</link>; <link ref="_bib26">Runnels, 01</link>; <link ref="_bib27">Schlingmann, 02</link>]. Although most of the functions of TRPMs are not known, some TRPM appear to play an important role in cancer and cell proliferation. For example TRPM1 was described as a putative tumor suppressor gene expressed in melanocytes correlating inversely with tumor aggressiveness and the potential for melanoma metastasis [<link ref="_bib33">Montell, 02b</link>; <link ref="_bib22">Duncan, 98a</link>]. Another channel, TRPM2, was shown to mediate apoptotic cell death when activated by H2O2 in HEK293 cells. This process was accompanied by an increase in intracellular calcium levels ([Ca2+]i) [<link ref="_bib22">Duncan, 98b</link>; <link ref="_bib35">Zhang, 03a</link>]. TRPM3 is expressed in human brain and kidney. It is supposed to play a role in the renal homeostasis as it increases Ca2+ entry during reduction of extracellular osmolarity [<link ref="_bib37">Grimm, 03a</link>]. </p>
      <p>TRPM4 is a remarkable example of the great functional diversity of the TRP protein family. It was shown to be directly activated by cytoplasmatic calcium but the following large inward current is carried primarily by monovalent cations such as Na+ [<link ref="_bib25">Launay, 02</link>]. This shows that TRPM4 is most likely impermeable for calcium. Another striking feature of this protein is that it is the only voltage dependant channel of this group [<link ref="_bib38">Nilius, 03</link>]. TRPM6 was shown to be involved in familial hypomagnesemia being responsible for renal excretion of calcium and magnesium [<link ref="_bib43">Walder, 02</link>]. TRPM7 was described as a channel and a protein kinase as well. </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="13"/>TRPM8</head>
      <p>TRPM8, formerly known as Trp-p8, is the latest identified gene of all TRP channels. First mentioned in 2001 as a gene upregulated in prostate cancer and other malignancies [<link ref="_bib44">Tsavaler, 01c</link>] it was shown to be expressed also in a large spectrum of nonprostatic primary cancers such as melanoma, colorectal carcinomas and breast carcinomas. In normal human tissues expression was found mainly in the prostate with trace expressions in testis, breast, thymus and lung. </p>
      <p>TRPM8 is closest related to TRPM2 followed by TRPM1 with which it shares 34% sequence identity. Tsavaler et al. suggested that TRPM8 could be an oncogen or tumor promoter gene. It was assumed to belong to the 7-transmembrane proteins. </p>
      <p>To describe the importance of TRPM8 for the development of a small-molecule or antibody based therapy is a deal between Dendreon and Genentech from 2002. The agreement &#8220;provides for upfront and milestone payments totaling over US $ 110 million for the resulting development of TRPM8 products&#8221;<footnote start="3">
            <p>http://www.pharmaventures.com/ag_demo/pr_11144.html</p>
         </footnote> .The deal concerns the development of monoclonal antibodies, small molecules and other products derived from Dendreon's TRPM8 gene platform. </p>
      <p>In 2002 two manuscripts were published showing the identification of the mouse and rat ortholog of TRPM8 [<link ref="_bib9">McKemy, 02a</link>; <link ref="_bib10">Peier, 02e</link>]. Interestingly, both genes were identified in cells from neuronal origin. The mouse ortholog was isolated from newborn dorsal root ganglia and the rats from trigeminal neurons of newborn rats. The striking new discovery was that these channels could be activated by cold and different cooling agents such as menthol, icilin and eucalyptol when overexpressed in cells. Following activation an increase in intracellular calcium was observed which could be suppressed by removal of extracelluar calcium. The authors suggest that TRP channels are the primary transducers of thermal stimuli. Until now 4 heat activated TRP channels and two cold sensing channels have been described: TRPV4 (27-34°C) [<link ref="_bib49">Guler, 02</link>], TRPV3 (20-40°C) [<link ref="_bib47">Xu, 02</link>; <link ref="_bib48">Smith, 02</link>], TRPV1 (&gt;43°C) [<link ref="_bib45">Caterina, 97b</link>] and TRPV2 (&gt;53°C) [<link ref="_bib46">Caterina, 99</link>] TRPM8 (8-28°C) [<link ref="_bib9">McKemy, 02b</link>] and ANKTM1(12-24°C)[<link ref="_bib51">Story, 03</link>]. </p></subsection></section><section><head>Calcium signaling</head>
      <p>Calcium signals control a wide range of cellular events, ranging from secretion and contraction to gene expression. Calcium can control cell growth and cell differentiation but also induce apoptosis. The concentration of free calcium ions in the cytosol is generally less than 10 µM, a thousand times less than that from the extra cellular space. In general, there are two possibilities for increasing intracellular free calcium ([Ca2+]i) levels: 1. opening of channels located in the plasma membrane allowing calcium ions to move along the electrophysiological <pagenumber numbering="arabic" start="14"/>gradient to the interior of the cell. 2. Internal stores as the endoplasmatic reticulum and the sarcoplasmatic reticulum release Ca2+ into the cytoplasm. These stores have a limited capacity and must be refilled from the external environment. This process of replenishing is accomplished by store operated Ca2+ channels (SOC) which are located in the plasma membrane. They trigger calcium from the external environment through processes known as capacitive Ca2+ entry to cell intracellular stores [<link ref="_bib52">Hardie, 92</link>; <link ref="_bib53">Montell, 97</link>]. This group of calcium channels is named non-voltage-gated channels, because their activation is independent of changes in voltage. Consequently the second large group of Ca2+ permeable channels is called voltage-gated channels.</p></section><section><head>Genetic alterations of prostate cancer</head>
      <p>The hypothesis that multiple mutations have to occur before progression from normal to invasive carcinoma can occur has been proven by the identification of multiple chromosomal abnormalities in cancers, including prostate cancer reviewed in [<link ref="_bib123">Bova, 96</link>]. In prostate cancer one of the most frequent ly observed chromosomal aberrations is the loss of chromosomal region 8p12-22 [<link ref="_bib126">Bova, 93</link>; <link ref="_bib127">Macoska, 95</link>; <link ref="_bib128">Vocke, 96</link>]. A loss of heterozygosity in this region occurs in 63% of prostate intraepithelial neoplasias (PIN). Although no bona fide tumor suppressor has been mapped to this region, the most probable candidate at this loci is the NKX3-1 gene, which maps to 8p21 [<link ref="_bib1">Abate-Shen, 00c</link>; <link ref="_bib124">He, 97</link>]. NKX3-1 belongs to the large group of homeobox genes. The homeobox sequence encodes a 60-amino acid domain called the homeodomain responsible for DNA binding. These genes are mainly specific nuclear proteins which act as transcription factors. They are the master developmental control genes which regulate cell differentiation and other morphogenic processes [<link ref="_bib133">Nunes, 03</link>]. Recent research has demonstrated that deregulation of developemental genes cause cancer. In many cancers such as leukemia, colon, skin, breast, ovary and prostate alterations of gene expression of these genes have been described. For example the PRX homeobox family is strongly connected with human diseases, especially cancer [<link ref="_bib134">Silberstein, 02</link>].</p></section><section><head>Control of gene expression</head>
      <p>The ability of cells to determine which gene needs to be expressed at a given time and to coordinate transcription is a complex process. Various elements like transcription factors, matrix attachment regions, locus control regions, promoters, gene methylation, enhancers and silencers control the complex transcription machinery [<link ref="_bib13">Werner, 03b</link>]. First, the chromatin structure of the DNA displays a physical barrier for transcription factors and polymerases to bind to their target DNA sequences [<link ref="_bib12">Emerson, 02</link>]. Diverse enzymes modulate the accessibility of DNA by changing the structure of the histones and by modeling the nucleosomes in an ATP-dependent manner. Second and most important for gene expression is the transcription initiation. Transcription requires binding of transcriptional regulatory proteins, RNA polymerases and proteins called <pagenumber numbering="arabic" start="15"/>mediators to the promoter region of a gene. A promoter is a region of DNA extending 150-300 base pairs upstream from the transcription start site andrepresents the central processor of the transcription control. The sites where the transcription factors bind are generally composed of 10 to 30 nucleotides, but usually only a small number of core nucleotides are necessary for binding [<link ref="_bib13">Werner, 03a</link>]. </p>
      <p>The complexity and precision of intron removal during mRNA splicing is still an amazing process, although it is known since 1977 [<link ref="_bib99">Berget, 77</link>; <link ref="_bib100">Chow, 77</link>]. In recent years it has become clear that most human genes express more than one mRNA by alternative splicing [<link ref="_bib98">Faustino, 03b</link>]. Human genes contain on average 8 exons with an average length of 145 nucleotides. Introns are usually more than 10 times of this size, some are much larger [<link ref="_bib101">Lander, 01b</link>]. The classical splicing signals at the intron/exons borders are present in 99% of all human introns (<link ref="_Ref59545795">Fig. 7</link>). They are necessary for the recognition of exons by the spliceosome, which catalyses the cut-and-paste reactions that removes introns and joins exons [<link ref="_bib98">Faustino, 03a</link>]. Surrounding these major splicing signals different auxiliary elements such as exonic splicing enhancers or silencers (ESE and ESS) and intronic enhancers of silencers (ISE and ISS) are commonly found. Together with the binding factors these elements are required for efficient splicing of constitutive and alternative exons. </p>
      <p>
         <mm entity="Grafik7" label="520#256">
            <caption>
               <link id="_Ref59545795"/>Fig. 7 Classical and auxiliary splicing sites and binding factors taken from [<link ref="_bib98">Faustino, 03c</link>]. A) Classical and auxiliary splicing site. These sites are found in &gt;99% of the human introns necessary for exon recognition (n = G; A; U, or C; y = pyrimidine; r = purine). B) Classical and auxiliary binding factors. (ISE/ISS = Intronic Splicing Enhancer/Silencer; ESE, ESS = Exonic Splicing Enhancer /Silencer)</caption>
         </mm>
      </p>
      <p>Alternative splicing is characterized by the connection of different 5&#8217; and 3&#8217; splice sites within a gene, resulting in multiple mRNAs expressed by one gene. This process leads to transcripts with one or more skipped exons, variable positions of exons and additions of alternative exons, either within a gene or at its 5&#8217; or 3&#8217; end. This effect may lead to an expanded protein repertoire which could explain the apparent discrepancy between gene number and the complexity of higher eukaryotes [<link ref="_bib102">Mercatante, 02b</link>]. Up to 59% of human genes were found to <pagenumber numbering="arabic" start="16"/>be spliced alternatively [<link ref="_bib101">Lander, 01a</link>] and ~ 80% of these splicing results in an altered protein [<link ref="_bib103">Modrek, 02</link>]. In most cases regulation of alternative gene expression is cell type specific. The regulation is mediated by intronic repressors or activator elements distinct from the classical splicing sequences. Expression of these alternative mRNA forms was seen during specific stages of development, in specific cells or tissues as well as in numerous diseases including cancer [<link ref="_bib102">Mercatante, 02a</link>]. </p>
      <p>Until now four classes of mRNA splicing (two cis acting and two trans acting) leading to a disease have been described reviewed in [<link ref="_bib98">Faustino, 03d</link>]: First and most common are mutations in the constitutive splice sites. These can lead to unnatural mRNAs which are deleted by a nonsense-mediated decay or to the loss of function of the resulting protein (protein instability, truncations). Second the disruption of alternative splice sites which have been described for 4 diseases (Familial isolated growth hormone deficiency type II- caused by mutations in the growth hormone gene; Frasier syndrome - caused by mutations in the WT-1 gene; Frontotemporal dementia and Parkinsonism linked to Chromosome 17 - caused by mutations in the MAPT gene and the atypical cystic fibrosis - caused by polymorphisms of the CFTR gene) The two trans-acting classes are characterized by mutations either in the basal splicing machinery or mutation in factors regulating the alternative splicing machinery. The major group of splicing factors are the serine/arginine-rich (SR) proteins which are members of a conserved family of proteins that bind to the active sites of RNA polymerase II and thus function as key regulators of alternative RNA splicing [<link ref="_bib110">Zahler, 92a</link>; <link ref="_bib111">Fu, 95b</link>; <link ref="_bib112">Graveley, 00a</link>]. They have dual functions and serve as splicing enhancer or splicing repressor proteins, depending on where in the pre-mRNA they bind reviewed in [<link ref="_bib113">Akusjarvi, 03</link>]. </p>
      <p>Aberrations in alternative splicing were found as a contributing factor or cause to the development, progression or maintenance of cancer. Up to now there are only models of how this process is regulated. Most likely specific repression of activation complexes surrounding the regulated splice sites serve to enhance or inhibit the recognition of the classical splice sites by the basic splicing machinery [<link ref="_bib104">Charlet, 02</link>]. But it remains unclear why the expression of different transcripts is enhanced in one tissue, whereas it is repressed in others. One interesting question is, if the altered expression of splice variants in cancer is a cause for the disease (i.e. due to mutations within the auxiliary elements within exons or introns) or the effect from other disordered genes which might be involved in the splicing machinery. </p></section><section><head>
         <pagenumber numbering="arabic" start="17"/>Aim of the Thesis</head>
      <p>The aim of this thesis was the identification of new genes differentially expressed in prostate tumors. Therefore microdissected matched prostate cancer and benign tissues of 52 prostate cancer patients were hybridized to a proprietary high density Cancer-Chip based on Affymetrix GeneChip technology. The intention was to identify genes differentially expressed in prostate cancers which had not yet been discovered by other groups. One of these genes was then selected for a more detailed analysis. </p>
      <p>In order to answer, whether the selected gene could be used as a target for a small-molecule or antibody based therapy the following questions were aimed to be answered. </p>
      <p>
         <ol numbering="arabic">
            <li>
               <p>Is the gene expressed in other cancer entities than the prostate?</p>
            </li>
            <li>
               <p>In which normal tissues is it expressed? </p>
            </li>
            <li>
               <p>Does it correlate with prostate cancer progression?</p>
            </li>
            <li>
               <p>In which cell compartiment(s) is the gene expressed?</p>
            </li>
            <li>
               <p>Is the gene an oncogene?</p>
            </li>
            <li>
               <p>How is it regulated?</p>
            </li>
            <li>
               <p>Is the gene also useful for diagnostics or other possible cancer therapies?</p>
            </li>
         </ol>
      </p>
      <p>The answers should provide evidence whether it is worth to develope a specific drug against this gene or not. </p></section></chapter><chapter><head>
         <pagenumber numbering="arabic" start="18"/>RESULTS</head><section><head>Gene Chip Expression analysis of prostate cancer patients</head>
      <p>High throughput gene expression profiling has become an outstanding method for identifying genes differentially expressed in normal and diseased tissue. In order to identify new genes differentially expressed in cancerous tissue, metaGen Pharmaceuticals GmbH designed a customized DNA Cancer-Chip based on Affymetrix technology (Affymetrix, Inc. USA). This oligonucleotide microarray contained 6200 probe sets representing approximately 3,000 genes. The chip design based on a bioinformatic attempt mining approximately 4 million expressed sequence tags (ESTs) of public<footnote start="4">
            <p>
               <url href="http://www.ncbi.nlm.nih.gov/dbEST/" type="URL">http://www.ncbi.nlm.nih.gov/dbEST/</url>
            </p>
         </footnote> and proprietary databases [<link ref="_bib8">Schmitt, 99b</link>]. These ESTs were sorted for tissues specificity and into pairs of benign and cancer tissues. The numbers of ESTs matching to a specific sequence were counted for each pool (normal, tumor and tissue). The sequences which exhibited significant differential expression between normal and cancer tissue were selected and added to the metg001A chip. This selection and concentration of genes relevant in tumors on the metg001A chip was expected to increase immensely the percentage of genes differentially expressed in tumors. Additionally, it was expected to identify new genes, which were not yet discovered by other groups and methods.</p>
      <p>Therefore 52 prostate tumor samples and its corresponding normal tissues were collected at the time of radical prostatectomy (RP) at the Department of Urology at the University Hospital Charité from 1999 to 2000. All samples were microdissected and hybridized to the metg001A microarray. Microdissection was used in order to specifically select tumor areas and normal glands to further increase the number of identified differentially expressed genes, especially as prostate tumors are among the most heterogeneous of cancers [<link ref="_bib150">Singh, 02</link>]. The clinical and pathological features as well as the follow-up data of all patients hybridized to the chip are listed in <link ref="_Ref60743649">Tab. 7</link> of the attachment. </p>
      <p>Analysis of hybridization experiments was done according to the metaGen criteria, described in &#8220;Methods&#8221;. Briefly, a gene was called differentially when it was significantly expressed in both normal and tumor tissue (p-value &lt; 0.05) and the quotient (fold change [FC]) of the normalized perfect match quintile (PMQ) value of each patient and probe set (tumor/normal) was &gt; 2. For genes present only in normal or tumor tissue (p-value &gt; 0.05) no fold change was calculated, but marked as differentially expressed (FC was set to 2). Finally, genes were ranked according to their differentially expression between normal and tumor tissue. </p>
      <p>
         <table orient="port" frame="none" tocentry="1">
            <caption>
               <link id="_Ref55721839"/>
               <pagenumber numbering="arabic" start="19"/>Tab. 1 Upregulated genes in prostate cancer patients identified by Affymetrix GeneChip experiments. Genes were sorted by numbers of patients with a fold change &gt; 2 (quotient of PMQ-values of matched tumor and normal sample for each gene), HGN for HUGO Gene Nomenclature, FC for fold change.</caption>
            <tgroup cols="1" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>
                           <mm entity="Grafik8" label="522#242"/>
                        </p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p>
      <p>Microarray analysis of prostate cancer patients revealed that 26% of the probesets (1434 probesets) present on the microarray showed a differential expression in at least one patient. Two criteria were applied for the identification of possible target genes. First, the gene should be overexpressed in tumors in at least 30% of the patients. Second, this gene should not be downregulated in more than 10% of the patients. Following these criteria 38 genes could be identified as overexpressed in prostate tumor patients. From these genes, seven were even upregulated in more than 50% (27 patients) of the tumors. The list of overexpressed genes in prostate tumor patients is shown in <link ref="_Ref55721839">Tab. 1</link>.</p>
      <p>
         <table orient="port" frame="none" tocentry="1">
            <caption>
               <link id="_Ref55728670"/>Tab. 2 Downregulated genes in prostate cancer patients identified by Affymetrix GeneChip experiments. Genes were sorted by numbers of patients with a fold change &lt; 0.5 (quotient of PMQ-values of matched normal and tumor sample for each gene), HGN for HUGO Gene Nomenclature, FC for fold change.</caption>
            <tgroup cols="1" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>
                           <mm entity="Grafik9" label="522#188"/>
                        </p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p>
      <p>62 genes could be identified being underexpressed in at least 30% of the patients (FC &lt; 0.5) using the same criteria as for genes downregulated in prostate cancer. <pagenumber numbering="arabic" start="20"/>From these, 5 genes could be identified to be downregulated in more than 50% of the tumors, listed in <link ref="_Ref55728670">Tab. 2</link>. </p>
      <p>For a more detailed analysis of this prostate cancer profiling, please refer to the thesis of Christoph Wissmann [<link ref="_bib72">Wissmann, 02</link>]. </p><subsection><head>Expression of TRPM8 in prostate cancers</head>
      <p>After the identification of genes upregulated in prostate cancer, the next task was to find out which genes would be the best targets for an antibody or small-molecule therapy. The following criteria were set up for genes to be further evaluated: 1. The gene had to be upregulated in at least 30% of all tumors, while downregulation should be less than 10%. 2. The gene had to be new (neither mentioned in the literature nor in patent applications nor filed patents) 3. The gene products should be drugable with preference for proteins located in the plasma membrane. Surprisingly not many genes could be found fulfilling these criteria. One of them was the protein standing on position four of the list of genes upregulated in prostate cancer: TRPM8. It was expressed significantly (p &lt; 0.05) in 103 of the 104 specimens and it was overexpressed in 56% of all tumor patients with a fold change &gt; 2. (p &lt; 0.000001) (<link ref="_Ref59627376">Fig. 8</link>). Only in one patient TRPM8 was downregulated in tumors (FC &lt; 0.5). </p>
      <p>
         <mm entity="Grafik10" label="522#217">
            <caption>
               <link id="_Ref55732146"/>
               <link id="_Ref59627376"/>Fig. 8 Affymetrix microarray analysis of TRPM8 expression in matched tumor and normal prostatic tissues. A) Changefold of PMQ values of 52 matched prostate cancer and normal tissues. B) Boxplots of PMQ-values of TRPM8 expression of prostate tumor patients grouped into normal and tumor. TRPM8 is significantly overexpressed in prostate tumors (p &lt; 0.000001).</caption>
         </mm>
      </p>
      <p>At the time of data analysis, TRPM8 was completely unknown and database search of the partial cDNA of TRPM8 revealed a high homology to the transient receptor potential (TRP) family of non-voltage-gated cation channels. </p></subsection><subsection><head>Expression of TRPM8 in human cell lines</head>
      <p>In order to characterize the expression of TRPM8 among various cell lines 30 established human cell lines were hybridized to the metg001A chip. These cell lines were derived from normal and cancer tissues from the prostate, bladder, colon, mammary gland, lung and pancreas (<link ref="_Ref57554571">Fig. 9</link>). Results indicated that <pagenumber numbering="arabic" start="21"/>TRPM8 is exclusively expressed in prostate tumor cell line LNCaP (p&lt;0.05). No significant TRPM8 expression could be detected in any other cell lines tested.</p>
      <p>
         <mm entity="Grafik11" label="521#319">
            <caption>
               <link id="_Ref48552094"/>
               <link id="_Ref57554571"/>Fig. 9 Affymetrix GeneChip analysis of TRPM8 expression in different cell lines. PMQ values of TRPM8 mRNA expression in 30 cell lines dived from six different tissues including prostate, bladder, colon, mammary gland, lung and pancreas.</caption>
         </mm>
      </p></subsection></section><section><head>
         <link id="_Ref48454741"/>TRPM8 expression in Human tissues</head>
      <p>Affymetrix gene chip experiments and electronic Northern analysis revealed that TRPM8 expression is restricted to the prostate. To confirm these high-throughput methods and to analyze the distribution of TRPM8 expression in &#8220;wet&#8221; experiments, classical Northern blots and dot blots as well as Real Time PCR were performed on a large number of patient and tissues. </p><subsection><head>Electronic Northern of TRPM8 </head>
      <p>In order to use a gene as a target for a therapeutic approach it has to be shown, that its expression is restricted to the tissue (and disease state) to be targeted, or at least, it should not be expressed in organs essentially for survival such as heart or brain. Ideally, the expression of the therapeutic target gene should be restricted to the tissue of interest. Thus, the drug - its specificity presumed - would not affect any healthy tissue and side effects could be minimized. </p>
      <p>
         <pagenumber numbering="arabic" start="22"/>
         <mm entity="Grafik12" label="522#363">
            <caption>
               <link id="_Ref57554917"/>Fig. 10 Electronic Northern analysis of TRPM8 expression in 22 human tissues. FREQ = Frequency of a TRPM8-EST in a pool ESTs derived from either normal or cancer tissues N = Normal tissue, T = Tumor tissue, P-val = p-value, Sig = Significance. </caption>
         </mm>
      </p>
      <p>Therefore the TRPM8 expression pattern among diverse normal tissues was examined by electronic Northern (<link ref="_Ref57554917">Fig. 10</link>). This in silico approach is a very effective tool to examine expression patterns of genes among divers tissues. Using the proprietary data set of metaGen approximately 4 million ESTs could be analyzed for the expression of TRPM8. Analysis showed impressively that TRPM8 expression among 22 human tissues was significantly restricted to the prostate. (Significance = 100%; p-value &lt; 10-5). This is one of the rare events that a gene is solely expressed in one organ. Further it could be shown that TRPM8 is highly differential expressed between tumor and normal prostate tissues with a significance of 99.8 and a p-value of 0.00158. </p></subsection><subsection><head>Northern and Dot blot analysis of TRPM8 </head>
      <p>The probe specific for TRPM8 comprised the first 2700 base pairs of the TRPM8 open reading frame (ORF). Hybridizing this probe to a Northern blot from Clontech (Heidelberg, Germany) representing 16 different human normal tissues revealed that TRPM8 expression is restricted completely to the prostate (<link ref="_Ref48391090">Fig. 11</link>). Interestingly, besides the expected 5.6 kb fragment two other transcripts of approximately 7.3 and 4.1 kb could be detected. </p>
      <p>
         <pagenumber numbering="arabic" start="23"/>
         <mm entity="Grafik13" label="512#365">
            <caption>
               <link id="_Ref48391090"/>Fig. 11 Northern blot analysis of TRPM8 expression in various normal human tissues (Clontech, Heidelberg, Germany). The 5&#8216;-probe was 32P-labeled and hybridized to the membrane. TRPM8 is expressed exclusively in prostate with different transcripts sizes of approximately 7.3 kb, 5.6 kb and 4.1kb. </caption>
         </mm>
      </p>
      <p>Hybridizing the same probe to a Cancer Profiling Array (CPA) (Clontech) which represents cDNA dots of 241 matched normal and tumor tissues of 14 human cancer entities and 9 cancer cell lines confirms the results seen in electronic Northern analysis. TRPM8 is exclusively expressed in the prostate with the exemption of one kidney tumor (<link ref="_Ref57555322">Fig. 12</link>). </p>
      <p>
         <pagenumber numbering="arabic" start="24"/>
         <link id="_Ref48391071"/>
         <mm entity="Grafik14" label="521#616">
            <caption>
               <link id="_Ref57555322"/>Fig. 12<link id="_Ref48391062"/>Cancer Profiling Array representing 241 matched tumor and normal human tissues from 13 cancer entities and several cell lines. A) The TRPM8 specific probe was 32P-labeled and hybridized to the membrane. B) The Ubiquitin specific probe was 32P-labeled and hybridized subsequently to the same blot. </caption>
         </mm>
      </p></subsection><subsection><head>Real Time PCR of TRPM8 in matched prostate cancer patients </head>
      <p>Quantitative Real Time PCR of TRPM8 expression was done on 42 cDNA from matched tumor and normal prostate cancer patients. Results show that TRPM8 is overexpressed in 64% of prostate tumor patients (<link ref="_Ref60766297">Fig. 13</link>). In some patients the relative expression levels of tumor versus normal tissue are very high (20-100 x) which indicates the remarkable overexpression of TRPM8 in prostate tumors. In comparison to microarray experiments Real Time PCR are much more sensitive. <pagenumber numbering="arabic" start="25"/>These experiments confirm the results gained in gene chip and dot blot experiments.</p>
      <p>
         <link id="_Ref55732512"/>
         <mm entity="Grafik15" label="522#384">
            <caption>
               <link id="_Ref60766297"/>Fig. 13 Relative expression of TRPM8 mRNA in 42 prostate tumor samples by RT-PCR. Data is shown as relative expression levels from matched tumor and normal prostate tissues. <link id="_Ref48460616"/>T = tumor, N = normal</caption>
         </mm>
      </p></subsection><subsection><head>In situ hybridization of TRPM8 in prostate tumors and other entities</head>
      <p>In situ hybridization of TRPM8 expression was performed on 60 normal, 23 prostatic intraepithelial neoplasia (PIN) and 91 adenocarcinomas (Gleason Grading 1-10) of the prostate. Additionally, 10 specimens of each tissue from tumors of the mammary gland, ovary, liver, pancreas and bladder were tested for TRPM8 expression. Expression could be detected in 37 of the 60 normal tissues, in 17 of the 23 PINs and in 75 of the 91 adenoncarcinomas of the prostate. All other tissues remained negative. In normal prostate sections, the epithelial cells showed moderately positive hybridizations signals. Strongest signals however were observed in the epithelial cells forming the lumen of the duct (<link ref="_Ref57556516">Fig. 14</link>). Smooth muscle cells and connective tissue remained negative. Relative expression levels comparing normal and tumor samples from the prostate samples showed an upregulation in 28 of 56 matched tumor and normal samples. TRPM8 expression correlated positively with disease progression from normal over PIN to low grade tumors, but TRPM8 expression was lost in completely undifferentiated tumor cells (Gleason Grading 9-10). This could be observed <pagenumber numbering="arabic" start="26"/>especially in cases were high grade tumors and low grade tumors were present in the same section of a specimen.</p>
      <p>
         <mm entity="Grafik16" label="522#396">
            <caption>
               <link id="_Ref57556516"/>Fig. 14 In situ hybridization of TRPM8 mRNA to a prostate adenocarcinoma. 4 µm sections were hybridized with the TRPM8 probe used in Northern and dot blot experiments. A) and B) hybridization of the antisense TRPM8 probe to an adenocarcinoma of the prostate. C) sense probe of TRPM8 and D) Haematoxilin and Elaun staining of the same patient. </caption>
         </mm>
      </p></subsection></section><section><head>FISH experiments of TRPM8 on 2.Q37.2 in LNCaP cells</head>
      <p>Fluorescence in situ hybridization (FISH) analysis of the genomic region of TRPM8 was performed to gain insight into the molecular mechanism of the overexpression of TRPM8 in prostate tumors and LNCaP cells. As TRPM8 is located at the very end of chromosome 2 (2q37.2), the chromosomal region could possibly by either amplified and/or translocated to other chromosomes. Through translocation, the TRPM8 gene might get under the control of an alternative promoter or enhancer resulting in an altered expression profile. Both chromosomal amplification and translocation are known mechanisms often occurring in tumor tissues [<link ref="_bib168">Nowell, 97</link>]. In order to address this question FISH experiments were performed on LNCaP cells. This cell line was chosen, as it is the only cell line expressing TRPM8. The BAC AC005538 (2q37.2) was used as a TRPM8 specific probe for hybridization. As a positive control a commercially available probe for identifying MYC on 8q24.12-q24.13 was used (Vysis Inc., Downers Grove; IL, USA). A comparison of hybridization signals of TRPM8 <pagenumber numbering="arabic" start="27"/>between LNCaP cells to normal human XY specimens showed that TRPM8 hybridized exclusively to the expected position on chromosome 2, in both the LNCaP cell and the XY patient (<link ref="_Ref55735570">Fig. 15</link>). No hybridization signal could be detected anywhere else in the chromosomes. </p>
      <p>
         <mm entity="XY_Meta_inter_6B_1u2" label="522#567">
            <caption>
               <link id="_Ref55735570"/>Fig. 15 FISH mapping of the genomic region of TRPM8 and MYC in normal human XY patients and LNCaP cells. Hybridization signals for TRPM8 (AC005538 on 2q37.2.) are shown in green; hybridization signals for MYC (8q24.12-q24.13) are indicated in red. Picture A1 to C1 show metaphase chromosomes. Pictures A2 to C2 show interphases of the same sample. A) 1 and 2 show hybridization signals specific for TRPM8 in a healthy XY-person. B) 1 and 2 show mapping of TRPM8 in LNCaP cells. C) 1 and 2 show the hybridization signal of MYC to chromosome 8.</caption>
         </mm>
      </p>
      <p>The finding that chromosome 2 is tripled in LNCaP cells and chromosome 8 (MYC-specific binding) is quadruplicated, is in coherence with the literature [<link ref="_bib142">Augustus, 03</link>]. A spectral karyotyping of LNCaP cells shows a predominantly tetraploid karyotype of LNCaP cells. Only chromosome 2 (triploid), 6 (diploid), 19 (triploid) and 21 (triploid) differ from that pattern (<link ref="_Ref55735581">Fig. 16</link>).</p>
      <p>
         <pagenumber numbering="arabic" start="28"/>
         <mm entity="Grafik17" label="522#199">
            <caption>
               <link id="_Ref55735581"/>Fig. 16 Spectral karyotyping (SKY) of LNCaP cells taken from [<link ref="_bib142">Augustus, 03</link>]. Chromosome 2 and 8 are boxed as these are the chromsomes where TRPM8 and MYC are localized, respectively.</caption>
         </mm>
      </p>
      <p>Additionally, the signal strength was not enhanced in LNCaP cells compared to normal XY patients. Therefore, it can be concluded that the overexpression of TRPM8 in LNCaP cells and thus most likely also in prostate tumor patients is not due to chromosomal amplifications or rearrangements. </p></section><section><head>Homomultimerization of TRPM8 subuntis</head>
      <p>TRPs are known to form either homo- or hetero-tetrames. In order to prove direct interactions between TRPM8 subunits, channel multimerization was assessed using the fluorescence resonance energy transport (FRET) technology. Therefore TRPM8 was terminally fused to CFP and YFP vector construct. These plasmids where transiently coexpressed in HEK293 cells and the proximity of the homomerization was measured with FRET. FRET signal was obtained by measuring the increase in fluorescence of donor (CFP) emission during photobleach of the acceptor (YFP). The recovery of donor fluorescence emission was then monitored at 480 nm and was expressed as percentage of CFP emission after acceptor bleach. The FRET analysis showed a strong interaction of TRPM8 homomultimers which is shown in FRET efficiencies of 15.3% (<link ref="_Ref56412829">Fig. 17</link>, A). </p>
      <p>
         <pagenumber numbering="arabic" start="29"/>
      </p>
      <p>
         <mm entity="Grafik18" label="522#217">
            <caption>
               <link id="_Ref56412829"/>Fig. 17 FRET analysis of transiently transfected HEK293 with TRPM8-CFP and TRPM8-YFP after 24 h. A) and B) Recovery of fluorescence intensity of the FRET donor (&#8710;FCFP) during disruption of energy transfer by photobleaching of the acceptor (FYFP). The acceptor was selectively bleached at &#1490; = 515 nm. The relative increase of CFP (&#916;FCFP (%) intensities compared to initial levels and YFP fluorescence intensity decrease (FYFP (%)) over time. The increase of CFP fluorescence intensity of 15, 3% is a direct evidence of FRET. Data shown are representative for several FRET analyses. </caption>
         </mm>
      </p></section><section><head>activation of TRPM8 by the cooling agent icilin</head>
      <p>It was shown by McKemy et al., that the TRPM8 rat orthologue CMR1 can be activated by cold inducing agents such as icilin, menthol and eucalyptol as well as by temperatures below 28 °C resulting in an increase of intracellular calcium levels. The mouse orthologue of TRPM8 could also be activated by menthol and temperatures ranging from 25°C to 15°C [<link ref="_bib10">Peier, 02d</link>]. In order to find out whether human TRPM8 could also be activated with different cooling agents, TRPM8-stable expressing HEK293 cells were loaded with the Ca2+- indicator Fura-2 and exposed to 50 µM of Icilin. These experiments were done in cooperation with Stefan Mergler from the Charité in Berlin.</p>
      <p>As displayed in <link ref="_Ref60768798">Fig. 18</link> (A, B) TRPM8 expressing cells showed a threefold increase in intracellular calcium upon stimulation with Icilin. That response was not observed in nontransfected and empty vector transfected cells. The icilin mediated calcium influx occurred within msec. Washout of icilin induced recurrence of [Ca2+]i back to levels of unstimulated cells (recovery effect). The response was dependent on Ca2+ in the buffer, because removal of extracellular calcium suppressed the Icilin response. The result indicated that TRPM8 is localized in the plasma membrane, although transmembrane localization could not be seen in most of the TRPM8-expressing HEK293 cells. This is most likely due to limitations of sensitivity in the cytochemistry procedures. </p>
      <p>
         <pagenumber numbering="arabic" start="30"/>
         <mm entity="Grafik19" label="522#201">
            <caption>
               <link id="_Ref60768798"/>Fig. 18 Analysis of calcium influx of HEK293 cells expressing TRPM8 using Fura-2. Representative measurement data were taken from calcium experiments of transfected and nontransfected HEK293 cells loaded with Fura-2. WT = wild type</caption>
         </mm>
      </p></section><section><head>Gene Chip Analysis of TRPM8 expression in 7 human tissues </head>
      <p>As prostate was the first entity to be hybridized to Affymetrix GeneChips at metaGen, it was interesting to check two years later the expression on TRPM8 in entities other than the prostate. Until today 6 other tissues have been hybridized to several Affymetrix chips (either proprietary or custom designed). Bladder, ovary, mammary gland and pancreas were hybridized to the metg001A Cancer-Chip; lung and colon were hybridized to the U133A and B Affymetrix GeneChip. The probe sets on the U133B were not identical to the ones on the metg001A chip but adequate, as described in detail in &#8220;Methods&#8221;. Bioinformatic analysis of these 7 tissues revealed that TRPM8 expression was restricted to the prostate with two exceptions. One bladder-tumor sample (out of 79) and one lung cancer (out of 172) expressed TRPM8 (<link ref="_Ref57524287">Fig. 19</link>). </p>
      <p>
         <link id="_Ref51157014"/>
         <pagenumber numbering="arabic" start="31"/>
         <mm entity="Grafik20" label="522#335">
            <caption>
               <link id="_Ref57524287"/>Fig. 19 Expression of TRPM8 in Affymetrix GeneChip experiments of 7 human tissues. Hybridization experiments were performed with 123 prostate -, 21 ovary -, 90 mammary gland -, 78 bladder -, 102 colon -, 11 pancreas - and 172 lung &#8211;specimens of normal and cancer tissue. </caption>
         </mm>
      </p>
      <p>These results were quite unexpected as dot blot and Northern blot experiments showed exclusive expression of TRPM8 in the prostate. The bladder and the lung cancer sample stoud out very clearly from the other samples. Looking closer at the bladder cancer patient, this sample did not only express TRPM8, but also Kallikrein (PSA), Folathydrolase1 (PSMA) and the Acidic Phosphatase Prostate (ACPP) all of which are prostate specific markers (<link ref="_Ref55736973">Fig. 20</link>). None of the other 71 bladder samples did express any of these genes. In general these 4 genes were expressed conjointly in nearly 100% of all prostate samples, but very rarely (and never all 4 gene together) in any non-prostatic tissue tested (data not shown). As it was most unlikely that this patient really expressed prostate specific genes, the pathologist at the University of Regensburg (from where the tissue came from) was asked to diagnose this sample again. In response, she told us that this patient was indeed a bladder cancer patient, but that some prostate glands had infiltrated into the bladder. Unfortunately these glands were also microdissected and thus amplified and hybridized on the chip. Consequently this sample was taken out of further analysis of the bladder-experiments at metaGen. The most important aspect of this feature was not the fact that the sample was no pure bladder sample, but the confidence it provided regarding the data gained from the microarray experiments.</p>
      <p>
         <pagenumber numbering="arabic" start="32"/>
         <mm entity="Grafik21" label="521#375">
            <caption>
               <link id="_Ref55736973"/>Fig. 20 Affymetrix GeneChip analysis of prostate specific genes in bladder cancer patients. Expression values are shown as PMQ for TRPM8, KLK3, FLOH1 and ACCP. </caption>
         </mm>
      </p>
      <p>
         <mm entity="Grafik22" label="522#372">
            <caption>
               <link id="_Ref60769741"/>Fig. 21 GeneChip analysis of prostate specific genes in lung cancer patients. Expression values are shown as PMQ for TRPM8, KLK3, FLOH1 and ACCP.</caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="33"/>Strikingly, in lung cancer patients TRPM8 was the only prostate specific gene expressed (<link ref="_Ref60769741">Fig. 21</link>). Neither Kallikrein nor Folathydrolase1 nor acidic phosphatase were expressed in this sample. A contamination with prostatic tissue or a prostatic metastasis in the lung could thus be excluded. In order to find an answer to this result the patients data sheets were checked in collaboration with the pathologist and an interesting observation could be made: Lu93 was the only patient run on microarray chips which had a fraction of 10% neuroendocrine tumor cells.</p></section><section><head>TRPM8 expression in neuroendocrine tumors of the lung</head>
      <p>Real-Time PCR was performed to evaluate the assumed expression of TRPM8 in the patient with a 10% neuroendocrine tumor of the lung (Lu93). Additionally, a 100% neuroendocrine tumor from the lung and a lung adenocarcinoma were analyzed. The mRNA of normal and tumor material of these patients was isolated and quantitative PCR was performed. Results shown in <link ref="_Ref57103714">Fig. 22</link> indicate that TRPM8 is highly overexpressed in both the 10% and the 100% neuroendocrine tumors, but not in the andenocarcinoma of the lung.</p>
      <p>
         <mm entity="Grafik23" label="522#191">
            <caption>
               <link id="_Ref57103714"/>Fig. 22 Strong overexpression of TRPM8 in neuroendocrine tumors. Real-Time PCR of TRPM8 shown as relative expressions to corresponding normal tissue of each patient. A) Pure adenocarcinoma of the lung (panel 1), a lung adenocarcinoma with 10% of neuroendocrine cells (panel 2) and a 100% neuroendocrine tumor also located in the lung (panel 3). B) Expression of TRPM8 in neuroendocrine cell lines. RT-PCR results are shown as relative expression levels to the normal prostate epithelial cell line PrEC. </caption>
         </mm>
      </p></section><section><head>Genomic structure of TRPM8 </head>
      <p>TRPM8 is located on chromosome 2q37.2 TRPM8 distributed over 100kb at the very end of chromosome 2. The gene consists of 26 exons resulting in 5641 base pairs (<link ref="_Ref57521822">Fig. 23</link>). The open reading frame (ORF) has 3312 basepairs resulting in an ORF of 1104 amino acids. The ion pore of TRPM8 consists of 6 transmembrane spanning domains located between exon 16 and 20. Both N and C-termini are located in the cytoplasm.</p>
      <p>
         <pagenumber numbering="arabic" start="34"/>
         <mm entity="TRPM8_Ex_In" label="522#107">
            <caption>
               <link id="_Ref57521822"/>Fig. 23 Genomic structure of TRPM8 on Chromosome 2q37.2. </caption>
         </mm>
         <link id="_Ref48462456"/>
      </p></section><section><head>Identification of TRPM8 splice variants </head>
      <p>TRPM8 splice variants could be identified while cloning the TRPM8 full length gene. The TRPM8 gene was amplified from a normal prostate mRNA pool (Ambion, Huntington, UK). A polyT-T7 primer was used in the reverse transcription RT-reaction which was followed by a PCR reaction using TRPM8 specific primer which bound to the first and last exon of TRPM8. It was interesting to observe that after cloning and sequencing of the constructs a short variant of TRPM8 could be identified. Exons 1-6 of this variant were identical to TRPM8, but exon 6 was elongated by 245 bp ending with a polyadenylation signal (SV 6b). Cloning of the product was possible as the primer used for the cDNA synthesis functioned as the reverse primer in the PCR reaction. This finding was in accordance with the results gained in the Northern blot experiments where two other isoforms of TRPM8 could be detected, although splice variant 6b was smaller than the shortest fragment (4.1kb) seen in the Northern blot experiments (<link ref="_Ref48391090">Fig. 11</link>).</p>
      <p>In the course of performing genome database search using public<footnote start="5">
            <p>http://www.ncbi.nlm.nih.gov/dbEST/</p>
         </footnote> and proprietary (Incyte Genomics, Palo Alto, CA, USA) cDNA libraries 5 additional alternative transcripts of TRPM8 (<link ref="_Ref59451374">Fig. 24</link>) were identified. Using PCR-techniques it was possible to elongate most of the isoforms. The splice variant 6b of the TRPM8 has the SEQ ID NO 1. The splice variant 4a_4b has the SEQ ID NO: 2. It contains of at least 5 exons. Exon 2x is a separate exon (3&#8217;end is incomplete) and is located several hundred bases in front of exon 3 of trp-p8. Exon 3 is transcribed as in trp-p8 but exon 4 starts 46 bases earlier compared to trp-p8. The sequence continues from exon 5 to 6a and ends with 6b. Splice variant 16b of TRPM8 has the SEQ ID NO 3. It contains of 16 exons. Exons 1- 15 are identical with TRPM8. Exon 16 has an extention of 104 basepairs immediately beginning after exon 16 and ending in a poly-A signal. </p>
      <p>
         <pagenumber numbering="arabic" start="35"/>
         <mm entity="Grafik24" label="521#307">
            <caption>
               <link id="_Ref59451374"/>Fig. 24 Six splice variants of TRPM8. Alternative exons of TRPM8 are indicated as black boxes. Exons of TRPM8 are shown in grey and regions which are not transcribed are shown in stripy.</caption>
         </mm>
      </p>
      <p>Splice variant 20b has the SEQ ID NO: 4. The sequence contains of 26 exons. Exons 1-19 and 21-25 are identical to TRPM8. Distinct from TRPM8 splice variant 20b contains an elongated exon 20 with an addition of 127 basepairs immediately beginning after exon 20; exon 26 is truncated: The poly-A signal starts already at basepair 1136. The splice variant avant25 of TRPM8 has the SEQ ID NO: 5. This sequence contains of at least 3 exons with an unknown 3&#8217; end. Avant25 contains an exon of 570 basepairs not found in TRPM8. This exon extends into in exon 25 and 26 but exon 26 is truncated as in splice variant 20b with a poly-A signal beginning at basepair 1136. The splice variant avant13 has the SEQ ID NO: 6. The sequence contains of at least 6 exons with an unknown 3&#8217; end. Avant13 has an exon of 272 basepairs not found in TRPM8. This exon extends into exon 21 but only 20 bases of the 3&#8217;end of this exon are within the transcript. The last 4 exons are identical to TRPM8 with a different splice pattern (exons 22, 23, 24 and 26, but exon 26 is truncated with a poly-A signal beginning at basepair 654).</p>
      <p>Though it was possible to identify more splice variants, but as they were less abundant and less differentially expressed than those 5 they will not be further discussed here. </p>
      <p>The structure of TRPM8 isoforms 16b and 20b is shown in <link ref="_Ref56921466">Fig. 25</link>. 16b has one transmembrane spanning domain which results in an extracellular C-terminus. Isoform 20b consists of the same transmembrane spanning domain as TRPM8 but the C-Terminus ends a few amino acids after the last transmembrane spanning domain.</p>
      <p>
         <pagenumber numbering="arabic" start="36"/>
         <mm entity="Grafik25" label="521#169">
            <caption>
               <link id="_Ref56921466"/>Fig. 25 schematic structure of TRPM8 its isoforms 20b and 16b. Number boxes (grey) indicate tranmembrane spanning domains. The blue horizontal beam represents the cell membrane. </caption>
         </mm>
      </p><subsection><head>Identification of the TRPM8-regulatory-RNA</head>
      <p>On the basis of in silico analysis of different ESTs in the region of TRPM8 it was possible to identify a gene which is positioned on the opposite strand of the TRPM8 gene on chromosome 2q37.2. (SEQ ID NO: 6) Exon 1 of this RNA lies in intronic regions between exon 12 and 11 of TRPM8; Exon 2 lies in front, over, and behind exon 11. Exon 3 is located between exon 8 and 7 of the TRPM8 gene (<link ref="_Ref57803594">Fig. 26</link>). It was named TRPM8-Regulatory-RNA, because it may bind to TRPM8 or its splice variants and thus alter the expression of these genes. Additionally, binding of the mRNA may cause destabilization through activation of mRNA degradation mechanisms or stabilization of the mRNA altering in an elongated translation.</p>
      <p>
         <mm entity="Grafik26" label="521#150">
            <caption>
               <link id="_Ref57803594"/>Fig. 26 Genomic localization of the human TRPM8-Regulatory-RNA. The exons of TRPM8 are marked in grey. Black boxes indicate exons of TRPM8 regulatory RNA. Arrows indicate the direction of transcription.</caption>
         </mm>
      </p></subsection><subsection><head>Expression of TRPM8 splice variants in prostate tumors</head>
      <p>Real time PCR of the 5 splice variants and the regulatory RNA was performed in order to find out whether these isoforms are as differentially expressed as TRPM8 itself. PCR was performed on samples from prostate cancer tissues used for gene chip experiments and on some additional samples. <link ref="_Ref59507160">Tab. 3</link> shows the results. The splice variants 16b, 20b and avant25 were overexpressed in prostate tumors to 65%, 67% and 60%, respectively, altering an even higher differentially expression than TRPM8 itself. The TRPM8-Regulatory-RNA was overexpressed <pagenumber numbering="arabic" start="37"/>in 80% of the prostate patients which was the highest differential expression seen. Additionally, relative expression values between a corresponding normal and cancer sample of the isoforms were significantly higher than those of TRPM8 (data not shown). But absolute expression levels of the slice variants were generally lower.</p>
      <p>
         <table orient="port" frame="none" tocentry="1">
            <caption>
               <link id="_Ref59507160"/>Tab. 3 Summary of quantitative RT-PCR of splice variants of TRPM8. Expression values were normalized to ß-actin and relative expression was calculated using the &#916;&#916; CT method. </caption>
            <tgroup cols="1" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>
                           <mm entity="Grafik27" label="504#282"/>
                        </p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p></subsection><subsection><head>Characterization of TRPM8 Splice variant 16b</head>
      <p>The splice variant 16b was chosen for a detailed analysis because a) it is one of the highest differentials expressed splice variants in prostate cancer patients seen in RT-PCR experiments (<link ref="_Ref59507160">Tab. 3</link>) and b) most importantly, the N-terminus is probably located in the extracellular space. This extracellular localization makes it an ideal target for the development of a therapeutic antibody, even better than TRPM8 itself as it has a larger epitope for the production of an antibody. </p>
      <p>In order to determine the expression profile of splice variant 16b, Northern and dot blot experiments with the 32P-labeled 16b-specific probe were performed on the commercial Cancer Profiling Array (Clonech, Heidelberg, Germany) (<link ref="_Ref49249647">Fig. 27</link>). </p>
      <p>
         <pagenumber numbering="arabic" start="38"/>
         <mm entity="Grafik28" label="521#613">
            <caption>
               <link id="_Ref49249647"/>Fig. 27 Cancer Profiling Array representing 241 matched tumor and normal human tissues from 13 cancer entities and several cell lines. A) The 16b specific probe was 32P-labeled and hybridized to the membrane. B) The Ubiquitin specific probe was 32P-labeled and hybridized subsequently to the same blot.</caption>
         </mm>
      </p>
      <p>Additionally dot blot experiments were carried out on a self spotted blot, to which cRNA from 48 tumor and corresponding normal prostate tissues were spotted to the membrane (<link ref="_Ref57559285">Fig. 28</link>). The cRNA spotted was derived from amplified cRNA used for gene chip experiments. Strikingly, the expression pattern of 16b is the same as for TRPM8. The self made dot blots reveal that 16b is overexpressed in 65% of all prostate tumors. These results show that SV 16b would be an even better target for the development of a therapeutic antibody than TRPM8. </p>
      <p>
         <pagenumber numbering="arabic" start="39"/>
         <mm entity="Grafik29" label="521#334">
            <caption>
               <link id="_Ref57559285"/>Fig. 28 Dot blot of matched prostate cancer and normal tissue hybridized with a SV 16b specific probe. cRNA of samples used for hybridization in Affymetrix microarray analysis were spotted to a nitrocellulose membrane a 16b specific probe was 32P-labeled and hybridized to the membrane. </caption>
         </mm>
      </p></subsection><subsection><head>Generation of HEK293 cell stable for 16b and TRPM8 </head>
      <p>HEK293 cells stable for TRPM8-pcDNA3.1-V5 were transfected with the 16b-pcDNA6-myc constructs for 24h. After antibiotic selection clones were checked for TRPM8 and 16b expression using V5- and myc-specific fluorescent antibodies in the fluorescence activated cell sorter (FACS) (<link ref="_Ref59534971">Fig. 29</link>). The percentage of cells which were positive for TRPM8 ranged from approximately 52% to 71% (<link ref="_Ref59534971">Fig. 29</link> A and B). By contrast, cells positive for 16b exhibited only a percentage of 1,3 to 7,6% (<link ref="_Ref59534971">Fig. 29</link> C and D). For control purpose these constructs were checked in Western Blot experiments for the expression of SV 16b (88kD). These experiments showed a strong expression of 16b in all of the six clones tested (<link ref="_Ref56931443">Fig. 30</link>). </p>
      <p>
         <pagenumber numbering="arabic" start="40"/>
         <mm entity="Grafik30" label="430#431">
            <caption>
               <link id="_Ref59534971"/>Fig. 29 FACS analysis of TRPM8 and 16b stable transfected cells. HEK293 cells stable transfected for TRPM8 and 16b were double stained for V5- and myc-epitope with FITC and PE labeled antibodies respectively. A) and B) show TRPM8-V5 expression of clones 18 and 19 stained with the anti-V5-PE antibody. C) and D) show the same clones, this time stained with anti-myc FITC antibody. M1 represents the mock clone (pcDNA3-1-V5-TOPO (A+B) and pcDNA6-myc-his (C+D). M2 gates the positively stained cells for TRPM8 (A+B) and 16b (C+D). </caption>
         </mm>
      </p>
      <p>
         <mm entity="Grafik31" label="489#225">
            <caption>
               <link id="_Ref56931443"/>Fig. 30 Western Blot of TRPM8-HEK293 cells stable transfected with 16b. Detection was performed with an anti-myc antibody. Lane 1 shows the 16b-protein of an in vitro translation reaction; lane 2 the transient transfected protein; lane 3-5 the empty vector of pcDNA6-myc-his (mock), lane 6-9 shows the 16b stable transfected TRPM8-HEK293 clones (Clone 19, 22, 9 and 16).</caption>
         </mm>
      </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="41"/>Cellular localization of TRPM8 and SV16b in HEK293 cells</head>
      <p>Cellular localization of TRPM8 and its splice variants were analyzed by cloning TRPM8 and 16b into the pcDNA3.1-V5-TOPO and pcDNA6-myc-his vector, respectively. HEK293 cells were used for the genration of stable cell lines expressing TRPM8. SV 16b was transiently transfected into these cells and also into wild type cells for 24 hours, prior fixation and staining with fluorescent antibodies for V5 and myc. Subcellular distribution of TRPM8 and 16b was detected by confocal fluorescence microscopy (Leica Microsystems, Solms, Germany) <link ref="_Ref56931868">Fig. 31</link>. </p>
      <p>
         <mm entity="Grafik32" label="522#522">
            <caption>
               <link id="_Ref56931868"/>Fig. 31 Co-expression and cellular localization of TRPM8 and SV 16b in HEK293 cells. A) Expression of TRPM8-V5 (red), B) Expression of 16b-myc (green), C) Overlay of pictures (A) and (B). D) Overlay of pictures (A) and (B) plus DAPI staining (blue).</caption>
         </mm>
      </p>
      <p>TRPM8 expression could be seen within the cytosol and in the membrane of intracellular compartments, predominantly in the endoplamatic reticulum. The expression exhibited a spotty cluster, which has already been shown for other TRP channels as for example TRPC3 [<link ref="_bib31">Hofmann, 99a</link>] (<link ref="_Ref56931868">Fig. 31</link> A). By contrast <pagenumber numbering="arabic" start="42"/>16b distributed homogenously within the cytoplasm which led to the conclusion that 16b is a soluble protein (<link ref="_Ref56931868">Fig. 31</link> B). In order to examine whether 16b interacts in any form with TRPM8 in vitro, co-transfection of SV 16b in to HEK293 cells stabel transfected for TRPM8 were performed. As shown in <link ref="_Ref56931868">Fig. 31</link> C and D 16b did not alter the localization of TRPM8.</p></subsection><subsection><head>Influence of SV 16b on the activation of TRPM8 by icilin</head>
      <p>In order to examine whether the splice variant 16b had any influence on the activation of TRPM8 by icilin different HEK293 clones expressing TRPM8 and 16b stably, were exposed to 50 µM of Icilin. It could be shown that 16b reduces generally the calcium influx in HEK293 cells. (<link ref="_Ref55812698">Fig. 32</link> D - F), but the results obtained were very unstable. For an unknown reason the empty vector control showed also some inhibiting function (repeated experiments). These findings were supported by FLIPR calcium assay experiments.<link ref="_Ref56421955">Fig. 33</link>shows the calcium influx which was induced by 1 µM of Icilin in TRPM8 and 16b transfected HEK293 cells. Again, wild type HEK293 cells show no increase in intracellular calcium when exposed to Icilin. Only when these cells were transfected with TRPM8 a calcium flux could be measured. When cells were co-transfected with TRPM8 and 16b the influx in calcium was quite noticeable reduced, but some clones of 16b transfected cells show an increase in calcium flux (i.e. Clone 19). Additionally, the empty vector (ev) control showed also reduced flux of Ca2+.</p>
      <p>
         <mm entity="Grafik33" label="522#270">
            <caption>
               <link id="_Ref55812698"/>Fig. 32 Analysis of calcium influx of HEK293 cells co-expressing TRPM8 and 16b using Fura-2. Representative measurement data were taken from calcium experiments of transfected and nontransfected HEK293 cells loaded with Fura-2. WT = wild type.</caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="43"/>
         <mm entity="Grafik34" label="396#282">
            <caption>
               <link id="_Ref56421955"/>Fig. 33 Calcium flux induced by 1 µM Icilin in TRPM8 and 16b transfected HEK293 cells. Free calcium was measured using the FLIPR calcium assay kit and is presented as a change in fluorescence versus time.</caption>
         </mm>
      </p></subsection><subsection><head>Aberrant splicing of SV 16b </head>
      <p>In RT-PCR experiments using TRPM8 and 16b specific primers, it was further possible to identify even more splice variants named 16b -1 to 16b - 4 by RT-PCR using primer specific for TRPM8 (forward primer) and 16b (reverse primer) (<link ref="_Ref59538219">Fig. 34</link>). Sequencing of the PCR products revealed the exon scipping shown in <link ref="_Ref59538219">Fig. 34</link> B. </p>
      <p>
         <mm entity="Grafik35" label="367#290">
            <caption>
               <link id="_Ref59538219"/>Fig. 34 Aberrant splicing of splice variant 16b. A) Agarose gel of a RT-PCR with 5&#8217; TRPM8 and 3&#8217; 16b specific primers. B) Blue indicates transcribed exons, shaded blue and red indicates untranscribed exons and red marks the alternative exon 16b. </caption>
         </mm>
      </p></subsection></section><section><head>
         <pagenumber numbering="arabic" start="44"/>Promotoranalysis of the TRPM8 Gene </head>
      <p>In the first part of this study it was demonstrated that TRPM8 is an extremely tissue specific gene expressed exclusively in the prostate and neuroencorine tumors. Out of this characteristic arose the question, whether this specificity could be used not only for a small-molecule or antibody based therapy but also for gene therapy. The idea was to clone the TRPM8 promoter in front of the sequence of a certain toxin, such as diphteria toxin A into a viral vector used for gene therapy (<link ref="_Ref60236055">Fig. 35</link>) (Li, Diphteria Toxin, cancer research 2002). Expression of the toxin would be restricted to the prostate as the transcription of the toxin would be under the control of the tissue specific TRPM8 promoter. Following that approach several questions need to be answered. 1. How does the TRPM8 promoter look like and which transcription factor (TF) binding sites are present? 2. Is the promoter responsible for the tissue specific expression of TRPM8? 3. And if, is it possible to narrow down a specific part (TF- binding site) responsible for transcriptional activation or repression? 4. As it has been shown that TRPM8 is expressed under the control of androgens, are androgen responsive elements (ARE&#8217;s) present? All of these questions will be addressed in the next chapters.</p>
      <p>
         <mm entity="Grafik36" label="521#97">
            <caption>
               <link id="_Ref60236055"/>Fig. 35 Gene therapy approach using the TRPM8 promoter as the prostate specific transcriptional regulator of the Diphteria-Toxin-A expression. </caption>
         </mm>
      </p><subsection><head>Characterization of the TRPM8 Promoter</head>
      <p>TRPM8 is a very tissue specific gene of which the expression is restricted to the prostate and neuroencorine tumors. One goal of this study was to identify and characterize the promoter of TRPM8. By blasting the cDNA sequence of TRPM8 gene against the public HTGS (High Throughput Genomic Sequences) database<footnote start="6">
            <p>http://www.ncbi.nlm.nih.gov/HTGS/</p>
         </footnote> a BAC AC005538 was identified which covered the whole genomic region of TRPM8 including 100 MB of the 5&#8217; regions. <link ref="_Ref55815889">Fig. 36</link> shows the 1.9 kb sequence of the TRPM8 promoter including the short 5&#8217; UTR as well as the transcription start site and the first exon of TRPM8. That fragment was subjected to in silico analysis for potential transcription factor binding sites using the commercially available software MatInspector<footnote start="7">
            <p>
               <url href="http://www.gene-regulation.com/" type="URL">http://www.gsf.de/biodv/matinspector.html </url>
            </p>
         </footnote> [<link ref="_bib58">Quandt, 95b</link>]. </p>
      <p>
         <pagenumber numbering="arabic" start="45"/>
         <mm entity="Grafik37" label="491#811">
            <caption>
               <link id="_Ref55815889"/>Fig. 36 Sequence of the promoter region of the human TRPM8 gene on 2q37.2. Grey boxes indicate putative transcription factor binding sites. +1 shows is the transcription start site. Met = methionine, shows the translation start site.</caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="46"/>This software utilizes the TRANSFAC<footnote start="8">
            <p>http://www.gene-regulation.com/pub/databases.html#transfac</p>
         </footnote> library, which emphasis on sequences with experimentally verified binding capacity. <link ref="_Ref57200177">Tab. 4</link>lists the transcription factors with the highest prediction values. The score for the core sequences listed was in all cases 1.0 which means that the 4-8 basepairs (capital letters) matched 100% to the core sequence of the transcription factor from the database. The matrix similarity comparing the given sequence of the flanking region of the core with the sequence form the database were between 0.90 and 0.99 indicating that even the matrix similarity shows a high identity to known cis-elements (values &gt; 0.8 were designated as good). For the transcription factor NKX3-1 the matrix value was left out as the identification of this transcription factor binding site was based on an own literature [<link ref="_bib131">Steadman, 00b</link>]. Steadman identified in gel shift experiments that these hexamers strongly bind NKX3-1. The average frequenz/1kb of these sequences was calculated by blasting each hexamer against a 5 MB sequence of Chromosome 21 which should represent a general distribution of the sequence within the whole genome. </p>
      <p>
         <table orient="port" frame="none" tocentry="1">
            <caption>
               <link id="_Ref57200173"/>
               <link id="_Ref57200177"/>Tab. 4 Transcription factor binding sites in the TRPM8 promoter. HGNC stands for the official name given by the &#8220;<url href="http://www.gene.ucl.ac.uk/nomenclature/" type="URL">HUGO Gene Nomenclature Committee&#8221;. </url>The average frequency/1kb gives an expectation value of matches per 1kb of genomic DNA as given in TRANSFAC and * as blasted against a 200kb region of chromosome 21. Core similarity shows the similarity of the core sequence (usually between 4-6 base pairs) to the database sequences (capital letters). Matrix similarity shows the similarity of a sequence flanking the core region to the databases sequences (lower case letters). A perfect match of a matrix gets 1.0 a "good" match to the matrix usually has a similarity of &gt; 0.80. Both calculation algorithms of the core and matrix are described in Quant et al. [<link ref="_bib58">Quandt, 95a</link>].</caption>
            <tgroup cols="1" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>
                           <mm entity="Grafik38" label="441#361"/>
                        </p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p>
      <p>
         <pagenumber numbering="arabic" start="47"/>It was interestingly to note that the predominant transcription factor binding sites identified were from the family of homeobox genes. Cis-elements for the binding of PRX2 (paired related homeobox protein 2) and NKX3-1 was present 5 times each in the 1.9kb promoter sequence of TRPM8. This is a dramatic overrepresentation. The TRPM8 promoter contains a TATA-box and a GC-Box at positions -42 and -67, respectively. Transcription factor binding sites for NKX3-1 (5x), NKX2-5 (5x), USF1 (4x), MYCMAX, LMO2, MYC and ARNT were found in this fragment. Only those binding site were listed which have maximum similarity with described binding sites expressed in core and matrix similarity- values (<link ref="_Ref57200177">Tab. 4</link>). </p></subsection><subsection><head>Genomic structure of the human and mouse TRPM8 promoter</head>
      <p>Genomic analysis of the promoter region of mouse and human TRPM8 revealed that the mouse orthologue misses the first exon of human TRPM8. But it alters 4 additional exons at the 5&#8217; end, which were so far not seen in humans (<link ref="_Ref60543236">Fig. 37</link>). A Dotter analysis of the 700 bp region 5&#8217; to the transcription start site of human TRPM8 to the mouse TRPM8 genomic region is shown in <link ref="_Ref60544882">Fig. 38</link>. It demonstrates the high homology between mouse and human of the 172-base pair conserved element. Additionally, it could be illustrated that the GC- and TATA-Box are also conserved between these species.</p>
      <p>
         <mm entity="Grafik39" label="521#254">
            <caption>
               <link id="_Ref60543232"/>
               <link id="_Ref60543236"/>Fig. 37 Comparison of the genomic structure of the human and mouse TRPM8 promoter region.</caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="48"/>
         <mm entity="Grafik40" label="521#269">
            <caption>
               <link id="_Ref60544882"/>Fig. 38 Homology analysis of the TRPM8 promoter between human and mouse. The 700 bp 5` to the transcription start site of the human TRPM8 were dotted against the mouse genomic region of the TRPM8 gene. Grey lines indicate high homology between the sequence of human and mouse. </caption>
         </mm>
      </p></subsection><subsection><head>Transcription repression by a highly conserved promoter fragment </head>
      <p>Alignment of the 1.9 fragment of the human TRPM8 promoter sequence with the mouse and rat orthologes revealed an overall identity between human and mouse of 56%. Strikingly a section of 172 bp showed a much higher concordance between the species than the overall sequence. Mouse and human display a similarity of 83% and rat and human of 82% (<link ref="_Ref55815889">Fig. 36</link>, <link ref="_Ref57202343">Fig. 39</link>). The first assumption, that this could be an alternative exon of TRPM8 was disapproved by repeated RT-PCR demonstrating that it was neither possible to amplify this fragment from any cDNA bank by itself nor with any known exon of TRPM8. To determine if the short part and the 1.9 sequence were able to induce transcription activation these two fragments were cloned each in front of the luciferase reporter vector pGL3-Basic. Different cell lines were transiently transfected with the constructs using PhRL-0 vector for transfection efficiency control. The 1.9 kb TRPM8 promoter showed a more than 13-fold transcriptional activation in DU145 cells (<link ref="_Ref57284657">Fig. 40</link>). In LNCaP, PC3 and HEK293 activation ranged from a 9-fold, over 7-fold to nearly 4 fold, respectively. Interestingly, the short element exhibited in all experiments a decrease in activation compared to the pGL3-Basic vector. This indicated that the conserved element might contain a repressor element (<link ref="_Ref57284657">Fig. 40</link>). </p>
      <p>
         <pagenumber numbering="arabic" start="49"/>The observation that the 172bp and the 1.9kb fragment -although oppositional- both regulate expression identifies this region as promoter site of the human TRPM8 gene. Especially, because a TATA-box with a high significance could be identified at the expected 30-45 base pairs away from the start site. Within the conserved region transcription factor binding site for PRX2 (2x) NKX2-5 and NKX3-1 (2x) were identified. The responding transcription factors all belong to the group of proteins which are characterized by the presence of the homeobox which binds the DNA, indicating that these genes play a predominant role in the activation or repression of TRPM8. </p>
      <p>
         <mm entity="Grafik41" label="521#433">
            <caption>
               <link id="_Ref57202343"/>Fig. 39 The TRPM8 promoter revealing a highly conserved region. A) TRPM8 gene promoter. The transcription start is shown as +1, the black box indicates the TRPM8 protein; the grey box indicates a highly conserved sequence among species. B) Alignment of the human, mouse and rat highly conserved 172 bp region in the TRPM8 promoter. DNAs were aligned using CLUSTAL program. Grey boxes indicate the transcription factor binding sites with the 4-6 core base pairs framed in black. </caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="50"/>
         <mm entity="Grafik42" label="522#325">
            <caption>
               <link id="_Ref57284657"/>Fig. 40 Transcriptional activation of the TRPM8 promoter in different cell lines. HEK293, PC3, LNCaP and DU145 were transfected with the 1.9 kb-TRPM8 promoter fragment cloned in front of the luciferase reporter gene (1.9-kb-TRPM8-pGL3). Luciferase activity in the lysates was measured after 24 h. Data were normalized to the PhRL-0 which was used to normalize transfection efficiency. Data is shown relative to the pGL3-Basic vector.</caption>
         </mm>
      </p></subsection><subsection><head>Site-directed mutation in the 1.9kb promoter</head>
      <p>The promoter of TRPM8 exhibits multiple transcription factor binding sites. In order to identify which transcription factor would alter the activity either through activation or repression 13 site-directed deletions of the core 6-8 base pairs of each potential TF-binding site were introduced into the 1.9kb-pGL3-reporter vector using site-directed mutagenesis (<link ref="_Ref57294932">Fig. 41</link>). LNCaP cells were transfected for 24 h with these constructs and luminescence was measured. All of the mutations led to a reduction of the activation potential. The strongest inhibition of activation (up to 80%) was achieved when the GC-Box or the TATA-Box were mutated. Neither all NKX3-1 nor PRX2 binding sites showed an agreeing repression pattern. </p>
      <p>
         <pagenumber numbering="arabic" start="51"/>
         <mm entity="Grafik43" label="522#439">
            <caption>
               <link id="_Ref57294932"/>Fig. 41 Site directed mutated reporter gene constructs of the TRPM8 promoter cloned into the pGL3-basic reporter vector. The deletions in the constructs (SDM 1 to SDM 13) are marked in dark grey. In each mutation at least the core region of the transcription factor binding site was deleted, thus usually 6-8 bases were eliminated (see &#8220;Methods&#8221; for details). </caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="52"/>
      </p>
      <p>
         <mm entity="Grafik44" label="522#343">
            <caption>Fig. 42 Effect on activation activity of different cis-acting elements in the TRPM8 promoter. The 13 TRPM8 promoter (1.9 kb) constructs were designed each carrying a deletion of 6-9 base pairs specific for one ore more transcription factor binding sites shown in <link ref="_Ref57294932">Fig. 41</link>. The mutated constructs were located in front of a luciferase reporter gene in the pGL3-vector. LNCaP cells were transfected for 24 h with the wild-type promoter and the 13 constructs carrying the specific site directed deletions. Activation potential of each deletion construct is shown in relative expression to the wild type promoter (100%). </caption>
         </mm>
      </p></subsection><subsection><head>Androgens enhance transcription of TRPM8 </head>
      <p>In order to evaluate if TRPM8 is regulated by androgens, LNCaP cells were cultured in steroid reduced medium and subsequently treated with 1nM, 10nM and 100nM of the androgen R1881. After 24 hours of treatment mRNA was isolated and RT-PCR was performed using gene specific primers for TRPM8, KLK3, NKX3-1 and MYC. The results were adjusted to the house keeping gene SDHA (succinate dehydrogenase complex, subunit A) and shown as relative expression to solvent ethanol (<link ref="_Ref57446518">Fig. 43</link>). R1881 enhances the transcription of TRPM8 nearly 90 times in LNCaP cells whereas KLK3, the gene which codes for PSA and NKX3-1 are upregulated 30 times and 6 times, respectively. The expression of the transcription factor MYC is not regulated by androgens. </p>
      <p>
         <pagenumber numbering="arabic" start="53"/>
         <mm entity="Grafik45" label="512#323">
            <caption>
               <link id="_Ref57446518"/>Fig. 43 Effects of androgen on the TRPM8 expression. KLK3, NKX3-1 and MYC expression in LNCaP cells. * indicate the significant upregulation in expression compared to ethanol, the solvent of R1881, with p values at least &lt; 0.001 (t-test). </caption>
         </mm>
      </p>
      <p>This was also an interesting finding, especially as the 1.9 kb fragment of the promoter did not show any androgen responsive element (ARE). Additionally, it should be analyzed if androgens alter the activation potential of the 1.9kb-pGL3 promoter construct. Therefore LNCaP cells were treated in the same manner as described above, but additionally when treatment of androgens started, cells were transfected with the 1.9-pGL3-promoter construct and the phRL-TK vector as a transfection efficiency control. After 24 h cells were lysed and luminescence measured. Results are shown in <link ref="_Ref57449625">Fig. 44</link>: The activation of the 1.9-pGL3 promoter compared to the pGL3-empthy vector was approximately 8 times, however the addition of R1881 did not activate the promoter significantly when results were adjusted to the empty pGL3 vector (data not separately shown). Thus androgens do not enhance this part of the promoter. </p>
      <p>
         <pagenumber numbering="arabic" start="54"/>
         <mm entity="Grafik46" label="504#279">
            <caption>
               <link id="_Ref57449625"/>Fig. 44 Influence of androgens on the promoter activity of TRPM8. LNCaP were cultured in androgen depleted serum before the experiment. The 1.9kb promoter of TRPM8 was cloned in front of the luciferase reporter gene into the pGL3-basic vector (promega). Upon transfection with the TRPM8 promoter, cells were treated with R1881, 10% FCS or ETOH. Analysis was performed after 24h of treatment. Data is shown as relative luciferase activity to the transfection control plasmid phRLTK-null. </caption>
         </mm>
      </p></subsection></section><section><head>Correlation of TRPM8 to grading and staging of prostate cancer</head>
      <p>Affymetrix gene chips experiments were analyzed for correlation of TRPM8 expression to the Gleason grading and the TNM staging system. Patients&#8217; PMQ values for TRPM8 and PSA were grouped by staging and grading and the median of each group was calculated. Results showed that TRPM8 mRNA expression increases with Gleason sum from normal tissue to a Gleason sum of 8, but mRNA levels fall to nearly normal levels in high grade tumors (Gleason sum of 9) (<link ref="_Ref60480228">Fig. 45</link> A and B). Correlating TRPM8 expression to the TNM staging system showed similar results. Expression of TRPM8 first rise in early stage tumors compared to normal tissues, but when the tumor has extended through the prostatic capsule into the seminal vesicles (T3) TRPM8 levels fall. Stage 4 cancers, which are characterized by the spreading of the tumor into the bladder neck, show further reduced expression of TRPM8 compared to T3 tumors (<link ref="_Ref60480228">Fig. 45</link> C and D). On the other hand, PSA levels do not show any correlation to either staging or grading. </p>
      <p>
         <pagenumber numbering="arabic" start="55"/>
         <mm entity="Grafik47" label="506#322">
            <caption>
               <link id="_Ref60480228"/>Fig. 45 Microarray results of TRPM8 and KLK3 in correlation to Gleason sum and TNM staging (pT). Data is shown as the median of PMQ for each patient group. At least 3 patients represent one group.</caption>
         </mm>
      </p></section></chapter><chapter><head>
         <pagenumber numbering="arabic" start="56"/>Discussion</head><section><head>Microarray Experiments and Prostate Cancer profiling</head>
      <p>Microarrays represent a very effective technique for the simultaneous screening of many genes. They are ideal tools for the identification of new molecular markers and therapeutic targets in cancer and other diseases. In this study a special custom designed array was used to screen for new genes differentially expressed in prostate cancer. It was possible to identify more than 100 genes over- or underexpressed. Comparing these results with published data sets revealed a general congruence: two thirds of the genes found in this study were also found by other prostate cancer profiling studies [<link ref="_bib66">Welsh, 01b</link>; <link ref="_bib70">Rhodes, 02b</link>; <link ref="_bib71">Pilarsky, 03</link>; <link ref="_bib65">Magee, 01</link>; <link ref="_bib64">Luo, 01b</link>; <link ref="_bib63">Dhanasekaran, 01b</link>]. Only a small fraction (less than 15%) was found in this study, but not in others, although the probesets for the genes were present on their chips. This is an interesting finding as one would expect more discrepancies between the studies based on so many different parameters such as patient material, treatment of the material (microdissected or bulk) and the used chip technique (spotted or synthesized). For example, in this study the very time consuming microdissection of the tissue was performed, which but not in the others. However, still similar results were obtained. This leads to the conclusion, that microdissection may not be as important for prostate cancer profiling as previously expected. </p>
      <p>A meta-analysis of gene expression profiles in prostate cancer [<link ref="_bib70">Rhodes, 02a</link>] showed that the influence of the chip technique used was also negligible as two spotted studies [<link ref="_bib63">Dhanasekaran, 01a</link>; <link ref="_bib64">Luo, 01a</link>] showed approximately similar results in comparison with a synthesized study of Welsh et al. [<link ref="_bib66">Welsh, 01a</link>]. The main reason why each study found approximately 20% varying differentially expressed genes is the fact that in each study different chips were used, representing different genes. Indeed, TRPM8 could only be identified in this study because it was present on the metaGen Cancer-Chip. None of the other studies performed between 1997 and 2001 represented this gene on their chips. In the future gene profiling studies of cancers (or of other diseases) will not come up with many new genes as the human genome is more or less sequenced and approximately 95% of the genes known are present on whole human chips (HG-U133 Plus 2.0) representing 47,000 genes (Affymetrix, Santa Clara, CA ). The next challenge will be the characterization of these genes in a more detailed way, looking closer at splice variants and in a next step at the protein level.</p></section><section><head>
         <pagenumber numbering="arabic" start="57"/>overexpression of TRPM8 in Prostate Tumors </head>
      <p>Chip experiments revealed that TRPM8 was overexpressed in 56% of all prostate tumor patients, ranking on position 4 of the most overexpressed genes. In order to approve the results from the microarray experiments Real Time PCR was performed. The analysis showed that TRPM8 was indeed highly overexpressed in prostate cancer patients (64%). The most striking and important feature concerning the potential of TRPM8 as a drugable target was seen in experiments characterizing its expression among diverse normal tissues. Northern and dot blotting as well as in situ hybridization experiments over a wide range of tissues and patients revealed an exclusive expression of TRPM8 in the prostate, with no expression detectable either in any other normal human tissue, or in any other cancer tissue, with notable exception of the very rare neuroendocrine tumors. These findings stand in contrast to results from Tsavaler et al. [<link ref="_bib44">Tsavaler, 01b</link>] who indicated that TRPM8 is expressed at least in trace amounts in normal tissues such as testis, lung, breast, thymus and lung. They also showed that TRPM8 is expressed in different other primary cancers, such as melanoma, colorectal carcinomas and breast carcinoma. The reason for this discrepancy may be due to the different probes used for hybridization. Tsavaler et al. used a 342 bp fragment of which they do not specify the exact localization in the TRPM8 gene. But as they isolated this clone from a cDNA library which was prepared from an mRNA pool it is most likely that the fragment is located near the poly-A tail. In first experiments performed in this study using a short probe derived from the 3&#8217; UTR of TRPM8 it was also observed that transcripts- although different in size- were seen in other organs such as liver and brain (<link ref="_Ref56069379">Fig. 46</link> B). When hybridization was done with a 2.7 kb probe of the open reading frame of TRPM8 the exclusive expression in prostate tissue could be seen as shown in <link ref="_Ref56069379">Fig. 46</link> A. This fact explains also the discrepancies in in situ hybridization experiments seen in this study compared to results from Tsavaler et al. However, it can not be excluded that the expression seen was due to some unspecific binding of the probe. On the other hand results from this study and literature search revealed that often many isoforms of a gene exist which exhibit different expression patterns. In a very recent and interesting finding it could be proven that the differential expression of a gene was only due to just one specific exon [<link ref="_bib77">Gandini, 03</link>]. They showed that only exon 4 of the prostate cancer antigen 3 (DD3) is differentially expressed in prostate tumors, whereas exons 1-3 are uniformly expressed in both tumor and normal tissue. Interestingly, this gene was the most differentially expressed gene found in this study by microarray experiments (77% overexpressed; <link ref="_Ref55721839">Tab. 1</link>). These findings do not show only how carefully one has to choose the probe for hybridization experiments, but it also indicates that a more detailed experiment design will reveal much better insight in the understanding of the complexity of gene expression. </p>
      <p>
         <pagenumber numbering="arabic" start="58"/>
         <mm entity="Grafik48" label="522#186">
            <caption>
               <link id="_Ref56069379"/>Fig. 46 TRPM8 Northern blot using 2 different probes for hybridization. A) Northern blot using a 2.7 probe from the 5&#8217;-end of the TRPM8 gene. B) Hybridization with a probe from the 3&#8217; end of TRPM8. All other conditions were exactly the same. </caption>
         </mm>
      </p></section><section><head>TRPM8- a functional calcium Channel</head>
      <p>TRPM8 belongs to the transient receptor potential family. It has a six membrane spanning domain with both COOH and NH2 termini located intracellularly. In FRET experiments it was possible to demonstrate for the first time that TRPM8 subunits homomultimerize. Most likely they form tetramers as it was shown for several TRP channel such as TRPV1, TRPC4 and TRPV5 [<link ref="_bib154">Schaefer, 02b</link>; <link ref="_bib156">Strubing, 01</link>]. Coexpression of C-terminal fusion proteins (TRPM8-CFP and TRPM8-YFP) yielded FRET efficiencies of nearly 16%. Comparing these data with published FRET efficiencies, the interaction of TRPM8 subunits is quite strong. For example FRET efficiencies of approximately 9% and 8% were detected for TRPC4&#945; and TRPC4ß, respectively [<link ref="_bib154">Schaefer, 02c</link>]. The TRPV1 altered FRET efficiencies of 18.5%. </p>
      <p>Two studies analyzing the TRPM8 orthologs in mouse [<link ref="_bib10">Peier, 02c</link>] and rat [<link ref="_bib9">McKemy, 02c</link>] showed that TRPM8 is activated by cold stimuli and cooling agents such as menthol and icilin. Following these findings it was possible to show that the human TRPM8 could be activated by a cooling agent, too. The human TRPM8 channel could be activated strongly with icilin, which was followed by a large Ca2+ invard current into the cell. The mechanism of TRPM8 activation by icilin is not yet known. Either it is directly activated through conformational changes or by activation through a second messenger pathway [<link ref="_bib10">Peier, 02b</link>]. The observations made by Peier et al. and also in this study reveal that TRPM8 is activated immediately after exposure to the agent suggesting a direct gating mechanism. </p>
      <p>TRPM8 is the only member of the TRPM8 subfamily for which activation by cooling agents and by cold has been shown. Although all TRPM proteins are Ca2+ permeable channels, their mode of activation is different. For example TRPM2 is activated by H2O2 [<link ref="_bib157">Kraft, 04</link>; <link ref="_bib158">Wehage, 02</link>], TRPM1 by switching the cells from Ca2+-free to Ca2+ containing medium [<link ref="_bib21">Xu, 01c</link>]. TRPM5 could be activated by the depletion of intracellular calcium stores [<link ref="_bib159">Perez, 02</link>]. </p></section><section><head>
         <pagenumber numbering="arabic" start="59"/>TRPM8 expression is regulated by androgens</head>
      <p>Analysis of TRPM8 expression among different cell lines revealed exclusive expression in the LNCaP cell line. Neither any of the 4 additional prostate cell lines nor any of the other cell lines derived form various human tissues express TRPM8. One of the profound features of the LNCaP is their androgen dependency. Thus it was analyzed whether TRPM8 was regulated by androgens or not. Indeed, Real Time PCR experiments performed on LNCaP cells incubated with different concentrations of the androgen R1881 revealed a 90 times upregulation of TRPM8. This is a new and interesting finding especially as KLK3, the gene coding for PSA, could just be activated by androgens up to 30 times. However, absolute KLK3 mRNA levels in untreated and in treated cells were higher than TRPM8 mRNA levels. This could be many reasons for these findings: 1. KLK3 is additionally co-activated by other factors, 2. the AR activation of transcription of the KLK3 gene is more pronounced, due to a higher specific transcription factor binding site to the KLK3 promoter, 3. Expression of TRPM8 is regulated by specific other transcription factors, or 4. the AR activates the TRPM8 gene to a lesser extent which might be due to less specific TF- binding sites in the TPM8 promoter. A study from this summer supports the finding that TRPM8 is androgen regulated [<link ref="_bib73">Henshall, 03b</link>]. They grew the androgen prostate cancer xenograft LuCaP-35 subcutaneously in nude male mice. Tumor bearing animals were castrated and tumors were harvested at several time points after castrations (0 -100 days). They showed that TRPM8 expression levels were high in mice on day 0 &#8211; 2 after castration but not 5 -100 days post castration. Further, TRPM8 mRNA expression correlated significantly with KLK3 expression in the same mice (Person P = 0.80). </p>
      <p>Collectively, these data suggest that TRPM8 is regulated by androgens, a mechanism by which it could also be regulated in human prostate tumors. </p></section><section><head>TRPM8 Promoter</head>
      <p>Taking advantage of the specific expression of TRPM8 in the prostate, it was analyzed whether the TRPM8 promoter could be used for gene therapy. The strategy was to clone the TRPM8 promoter in front of the sequence of a certain toxin, such as diphtheria toxin A into a viral vector used for gene therapy. Expression of the toxin would thus be restricted to the prostate as the transcription of the toxin would be under the control of the tissue specific TRPM8 promoter. </p>
      <p>In order to analyze whether the promoter could be used following this approach the 1.9 kb fragment of the 5&#8217; flanking region of the transcription start site of TRPM8 was analyzed in silico. It was possible toidentifying multiple tran­scription factor binding sites such as PRX2, NKX3-1, NKX2-5, USF1 and MYCMAX. The most striking feature is the high abundance of binding sites for homeobox genes such as PRX2, NKX3-1and NKX2-5. </p>
      <p>
         <pagenumber numbering="arabic" start="60"/>In reporter assays cloning the TRPM8 promoter in front of a luciferase reporter gene it could be demonstrated that the 1.9 kb-promoter of TRPM8 was able to activate the transcription significantly, ranging from 3.9 times in HEK293 cells to nearly 14 times in DU145 cells. In LNCaP cells the activa­tion level was about 9 times. This was an unexpected result as in other ex­periments it could be shown that expression of TRPM8 was restricted to the cell line LNCaP. Therefore it was expected that the promoter would be strongest activated in this cell line. Concluding, the identified promoter region does not represent the functional element for prostate specific expres­sion, especially as androgens, in this case R1881 was not able to enhance the basal transcription activation. But as androgens definitely raised transcription of TRPM8 up to 90 fold in R1881 treated LNCaP cells, there must be enhancement through other mechanisms. Either, activation of TRPM8 is regulated by additional enhancer elements upstream or downstream from the transcription start site or the activation is regulated by other mechanism than on the transcriptional level. Most likely the first assumption is correct: It could be shown for the FLOH1, which is largely regulated by androgens, that the basal activation of the promoter was greatly enhanced by a DNA fragment found in intron 3 of the FLOH1 gene[<link ref="_bib136">Warren D.W., 03</link>]. Unfortunately they neither describe the basic promoter nor the DNA-piece from intron 3 precisely, but it indicates that activation of androgen responsive genes can be regulated by elements more than several 1000 base pairs away from the transcription start site. </p>
      <p>Additionally, in silico analysis of the 30 kb upstream and downstream of the transcription start site of the TRPM8 gene showed many potentially androgen responsive elements (AREs). Although it was not possible to find any classical consensus sequences for AREs, several sequence altering the core base pairs for potential AREs could be identified. Additionally, some of the AREs were present in conserved regions which stress their importance. Further promoter studies including these binding sites will give further insights into the transcriptional regulation of TRPM8. </p>
      <p>It was further possible to identify a highly conserved 172-bp element within the TRPM8 promoter, which functions as a transcriptional repressor. This is consistent with previous reports demonstrating that a NKX3-1 element can repress the activity of a basal promoter containing a multimerized NKX3-1 binding site when it was expressed in TSU-Pr prostate cells [<link ref="_bib131">Steadman, 00a</link>]. However, this observation was only made when artificial NKX3-1 was co-transfected: When the multimerized NKX3-1-reporter construct was transfected alone, the promoter activity was even enhanced. In this study the repression was independently of exogenous TF indicating that this element is a strong repressor; especially as repression could also be seen in non-prostate cells such as the HEK293 kidney cells. Experiments co-expressing the 172-pGL3 construct with NKX3-1 will show if this could further reduce the activation potential. Another possibility to analyze the function of this repressor would be to exclude the 172-base pair fragment from the 1.9 kb construct. It is likely that this would enhance the activation potential of the promoter. </p></section><section><head>
         <pagenumber numbering="arabic" start="61"/>Expression of TRPM8 in neuroendocrine Tumors</head>
      <p>Microarray analysis of lung cancer patients revealed that one lung carcinoma sample expressed TRPM8. The analysis of the clinical data of all 172 lung cancer samples indicated that this patient was the only one with a 10% neuroendocrine infiltration. As this finding could be pure coincidence, Real-Time PCR was performed including a 100% neuroendcrine tumor (not used in chip experiments) of the lung and as a negative control an adenocarcinoma of the lung. The result was convincing: TRPM8 was more than 60 and 900 times overexpressed in the 100% and 10% neuroendocrine tumors, respectively. Most likely that the normal tissues did not have any expression at all and the trace expression seen was just due to contamination. RT-PCR experiments with cell lines of neuroendocrine origin supported these results: TRPM8 was expressed also in LCC18 (colon), QGP1 (pancreas) and BON1 (pancreas) cells. </p><subsection><head>Expression of TRPM8 in neuroendocrine and prostate cells</head>
      <p>The finding that TRPM8 is expressed in neuroendocrine cells (NE) and prostate tissues raises the question, whether both cell types have something in common. For example, is it possible that neuroendocrine (NE) cells are present in the prostate? The answer is yes. NE cells represent, beside the basal and the secretory cells, the third form of epithelial cells of normal prostate epithelium [<link ref="_bib96">Abrahamsson, 96</link>]. They are located in all regions in the prostate and are present in normal, hyperplastic and dysplastic prostate tissue. NE cells have a complex appearance with irregular dendrite like processes extending between adjacent epithelial cells. Abrahamsson et al. summarizes the cytological and histological patterns of NE cells as follows:&#8221; Ideally, a NE cell is defined as a cell of neuronal or epithelial type that fulfills all or most of the following criteria: it contains secretion granules; its secretion is essentially derected towards the blood, &#8230;, and is immunoreactive to antisera against neurone-specific enolase or chromogranin A or other NE markers&#8221;. </p>
      <p>This &#8220;nerve like&#8221; appearance could also be observed when LNCaP cells were cultured for a period longer than 10 days in steroid deprived medium (own observation). Therefore it might be possible that TRPM8 is expressed in the prostate from neuroendocrine cells. But, are neuroendocrine cells amplified in prostate tumors, which may solve the question why TRPM8 is overexpressed in neoplastic tissue? The answer is again yes. It was shown that neuroendocrine differentiation in prostatic adenocarcinomas is associated with a poor prognosis [<link ref="_bib148">Bostwick, 02</link>]. The most common form observed in prostate carcinomas is a focal neuroendocrine differentiation, which may be pronounced in approximately 10% of adenocarcinomas. Further, it could be shown that NE are positive for a nuclear located (and thus fuctional) androgen receptor [<link ref="_bib149">Nakada, 93</link>]. In another study, Singh et al. showed that Cromogranin A, which is a marker for NE cells, is significantly overexpressed in prostate tumors. These findings support the speculation that TRPM8 might be expressed in neuroendocrine cells of the <pagenumber numbering="arabic" start="62"/>prostate, but double staining of TRPM8 and neuroendocrine markers such as Chromogranin A or serotonin will have to be performed in the future. </p></subsection><subsection><head>Expression of TRPM8 in neuroendocrine cells and cells from the nervous system</head>
      <p>The mouse and the rat orthologes of TRPM8 were isolated from RNA of DRG (dorsal root ganglia) and from trigeminal neurons of newborn rats, respectively [<link ref="_bib10">Peier, 02a</link>; <link ref="_bib9">McKemy, 02d</link>]. In humans TRPM8 it is expressed in the prostate with elevated levels in early stages of prostate cancers. All three orthologes (mouse, rat and human) can by activated by cooling agents such as icilin, menthol or by temperatures below 28°C. Looking at these characteristics, is there a regulation link between expression in prostate cancers and neuronal cells? Most likely, cold or cooling agents are not the biological stimulus of TRPM8 in the prostate. But are androgens expressed in neuronal cells? Most likely they are not. One possibility is that the transcriptional regulation of TRPM8 is completely different in these three species. For example it could be shown in this study that the mRNA of the mouse orthologe misses the first exon of human TRPM8, but alters 4 additional exons at the 5&#8217; end, which so far were not seen in humans. Thus the promoter regulating the TRPM8 gene transcription in human and mouse might be completely different leading to different activation of the transcription. </p>
      <p>Another point to be discussed is the question why TRPM8 expression is regulated by androgens, but channel activation occurs through cooling agent such as icilin? This is another point why the TRP family has been denoted as &#8220;a very interesting and versatile family&#8221; [<link ref="_bib33">Montell, 02c</link>] .</p></subsection></section><section><head>TRPM8 expression correlates with disease Progression</head>
      <p>In situ experiments on prostate cancer patients in this study revealed that TRPM8 is expressed moderately in all normal prostate cells, strongly enhanced in PIN and in adenocarcinomas. However it was not possible to correlate in situ expression with disease progression; neither the Gleason Grading System nor the TNM System showed any significant correlation to TRPM8 expression. Locally TRPM8 is predominantly expressed in basal epithelial cells, which is conform to results from Tsavaler et al. [<link ref="_bib44">Tsavaler, 01a</link>].</p>
      <p>Affymetrix gene chips experiments were analyzed for correlation of TRPM8 expression to Gleason grading or TNM staging. Results showed that TRPM8 mRNA expression increases with Gleason sum linearly from normal tissue up to a Gleason sum of 8, but mRNA levels dropped significantly to nearly normal levels in highly undifferentiated tumors (Gleason sum of 9). Correlating expression of TRPM8 to the TNM staging system showed similar results: Expression of TRPM8 first rise in tumors of early stages (N - T2), but when the tumor has extended through the prostate capsule into seminal vesicles (T3), TRPM8 levels fall. In cancers stage 4, when the tumor has spread further into the bladder neck or other nearby tissues, expression drops even more. Collectively, <pagenumber numbering="arabic" start="63"/>TRPM8 increases at the beginning of the disease, but in very undifferentiated tumors which have extended through the prostate capsule expression decreases significantly. In situ hybridization further supported these findings as it was observed in cases where high grade tumors and low grade tumors were present in the same specimen, that TRPM8 was lost in undifferentiated tumor cells (GGs 9-10). </p>
      <p>The next question to be answered was whether TRPM8 also correlated with PSA-relapse after radical prostatectomy. Interestingly this was not the case. In July this year a study was published showing that TRPM8 is a good prognostic marker of PSA-relapse [<link ref="_bib73">Henshall, 03a</link>]. They analyzed (using also Affymetrix GeneChip) 17 patients with a PSA relapse after radical prostatectomy, compared to 55 patients who remained free of PSA relapse after surgery. It indicates that patients with low TRPM8 expression prior to radical prostatectomy have a higher risk of getting a relapse of PSA. According to this study until now 8 patients out of 52 had a relapse of PSA, but it was not possible to correlate this to TRPM8 expression. It may be assumed that the number of patients was too small and/or the follow-up time too short in order to find any correlation, but the other study was not much bigger for statistical significance. Thus it remains to prove in larger studies whether TRPM8 is a prognostic marker for PSA relapse. </p></section><section><head>TRPM8- target For Treatment of prostate cancer</head>
      <p>Prostate specific antigen (PSA) and the digital rectal examination (DRE) are the two major screening parameters for prostate cancer. But neither PSA nor any of the other prostate cancer specific markers available today meet the requirements of a good marker: sensitive, specific, providing prognostic information, and indicating post treatment progression or cure. For example prostatic acid phosphatase (PAP) has been used extensively for diagnosis, staging and monitoring of prostatic cancer in the last century, but it is ineffective for screening of prostate cancer as it has a low positive predictive value, a low specificity and sensitivity. Also PSA, it is specific for the prostate, but not for prostate cancer as it is expressed in all stages of cancer [<link ref="_bib75">Caplan, 02a</link>]. It tends to increase with age and rises in men with evidence of benign prostatic hypertrophy. Additionally, preoperative PSA cannot be used to predict capsular penetration or seminal vesicle invasion. Neither PSA nor PAP are able to predict progression in adenocarcinomas of the prostate following radical prostatectomy [<link ref="_bib88">Sauvageot, 98a</link>]. But is TRPM8 at better diagnostic marker than PSA? Most likely it is not. 1. TRPM8 mRNA expression rises and falls with progression of the disease, which makes it difficult for the pathologist to distinguish (at least alone) whether the patient alters a tumor of very high or very low grading or staging. 2. The findings in this study were based on RNA data, thus pathological classification would be very time consuming and expensive. Whether TRPM8 expression could be useful for immunhistochemical classification remains to be demonstrated. 3. As TRPM8 is not a secreted protein, it will not be measurable in the blood, excluding it for the usage as a general screening parameter. </p>
      <p>
         <pagenumber numbering="arabic" start="64"/>On the other hand TRPM8 is an extremely good target for the development of a drug. It was shown in this study that a drug against TRPM8 would only affect prostate tissues and neuroendocrine tumors, as TRPM8 is exclusively expressed in these tissues. The data from this work at least proves that TRPM8 mRNA could be a good target for an antisense drug. Although it was not part of the study to analyze the expression of TRPM8 on the protein level it could be proven in experiments done in parallel within the company that TRMP8 is also highly overexpressed on the protein level in prostate cancer patients. Further, mRNA expression correlated with protein expression in prostate cancer patients. Thus therapeutic approaches using antibody and small-molecule are also possible. But would it be enough to develop a therapeutic that inhibits the function of TRPM8 and thus prevents the cancer from growing or even better diminishes it? Is TRPM8 a promotor of tumor growth? Most likely it is not. In experiments overexpressing TRPM8 in cell lines, the division of the cells was neither enhanced nor did the cells have a different morphology. Thus the development of a therapeutic must focus on the design of a drug which binds to and destroys the tumor cells. That could be achieved either by using modified antibodies delivering toxic or modulatory payloads (small-molecules, radionuclides and enzymes) to the cancer cell or by the specific delivery of a radioactive payload carried on a small-molecule[<link ref="_bib169">Chang, 02</link>]. That this approach is feasible has been shown over the years since it was introduced more than 20 years ago</p></section><section><head>Splice variants of TRPM8 </head>
      <p>In this study more than 10 splice variants (SV) of TRPM8 could be identified using an in silico approach and RT-PCR experiments. All of them were as differentially expressed as TRPM8 itself, some of them exhibited even a significantly higher differentially expression in prostate tumors. Especially the regulatory RNA, located on the opposite strand of TRPM8, exhibited an 80% overexpression of TRPM8 in prostate tumors as analyzed by RT-PCR experiments. The identification of splice forms of a member of the transient receptor potential family is not unique. It is the fourth TRPM family member for which isoforms have been identified. Up to now splice variants of TRPM1 (MLSN) [<link ref="_bib21">Xu, 01b</link>], TRPM2 [<link ref="_bib35">Zhang, 03b</link>] and TRPM5 (MTR1) [<link ref="_bib23">Prawitt, 00</link>] have been described. In this study splice variant 16b was more closely examined. It has a truncated C-terminus leading to truncated transmembrane domains with loss of the functional pore. Interestingly, in addition to 16b of TRPM8, isoforms of TRPM1 and TRPM2 also have a deletion of the C-terminus. The three short forms alter different numbers of transmembrane domains. TRPM1 is devoid of all, 16b has one and TRPM2 has two transmembrane segments. The short form of TRPM1 is uniformly distributed in the cytoplasm, whereas the long form localizes in the plasma membrane. Published data show that the short form of TRPM1 suppresses the function of the long form by inhibiting the transportation of the long form to the plasma membrane [<link ref="_bib21">Xu, 01a</link>]. By contrast the TRPM2 short form does not alter the localization of the long form. It inhibits the function of the long form by an unknown mechanism [<link ref="_bib35">Zhang, 03c</link>]. The data in this study <pagenumber numbering="arabic" start="65"/>show similar results as shown for TRPM2. 16b does not alter the location of TRPM8 (at least not visible in confocal microscopy experiments), but shows -at least partially- an inhibiting effect on the activation of TRPM8 by icilin. </p>
      <p>All of the study discribed above were performed in vitro overexpressing both, the long form and the short form through expression-vectors. No study is available which discribes functions of endogenously expressed splice forms of TRP channels. There will be further studies necessary in order to prove that the truncated transcripts are a) endogenously translated into proteins and b) expressed by the cell in a sufficient amount to alter the functions of the longer form. One reason why no publication is available might be the difficulty in finding working antibodies which selectively recognize only the truncated forms. In most cases the splice variants do not differ in a large number of amino acids. Thus the availability of a good epitope is very limited. </p>
      <p>What might be the function of all the other identified splice variants? Do they have any functional properties? It is quite difficult to believe that all of the identified transcripts have a distinct function. But if so, does the abundance of spliced transcripts contribute to the malignant transformation? Most likely only a few of them have functional properties. The great majority might be overexpressed just because of diverse disregualtions in cancers. </p>
      <p>Interestingly, most of the identified splice variants in this study were isolated from mRNAs derived from tumor tissues. This might indicate that not only the overexpression, but also the diversity of splice variants in tumors is increased. Real-Time PCR experiments as well as dot blot experiments revealed that some of these isoforms are much stronger differentially expressed as TRPM8 itself. That makes them excellent markers for the detection of prostate cancer. </p>
      <p>Alternative splicing has been shown to be tightly regulated in a tissue and developmental- specific manner [<link ref="_bib106">Nissim-Rafinia, 02b</link>]. Therefore, changes in the absolute or relative expression of isoforms are expected to effect cellular functions which might be a contributing factor or cause to the development, progression or maintenance of cancer. Indeed, for many genes dramatic changes in alternative splicing patterns are associated with neoplasia and metastasis [<link ref="_bib106">Nissim-Rafinia, 02a</link>; <link ref="_bib117">Philips, 00</link>]. In example WT1 (Wilms tumor), CD44 (renal, lung, gastric and urothelial cancers), BCL2 (prostate, lymphoma and gastric cancers) and FGFR2 (prostate cancers) are alternatively spliced genes found in cancers. BCL2L1 (formerly Bcl-x) a member of the BCL2 family, produces two alternative splice forms, one having a pro-apoptotic and one having an anti-apoptotic effect [<link ref="_bib114">Boise, 93</link>]. It remains to find out what the reason for the upregulation of TRPM8 splice forms in prostate cancers could be. Four explanations are possible: First, mutation in the basal cis-splicings sides might be mutated. Second, mutation in auxiliary ISE/ISS or ESE/ESS elements might lead to the inappropriate expression of the isoforms. Third and fourth, trans-acting factors of the basal and the auxiliary splicing machinery are defective. </p>
      <p>Most likely the overexpression of TRPM8 splice variants is due to changes in trans-acting factors of the auxiliary splicing machinery as mutations in cis-elements of the splicing machinery can not explain the immense diversity of <pagenumber numbering="arabic" start="66"/>splice variants as demonstrated especially in splice variant 16b. Point mutations in the basal or auxiliary cis-elements would only lead to a few alterations in splicing, thus only a handful of new isoforms would be expected to be seen. Mutations in proteins functioning in the basal trans-system of the splicing machinery would cause all genes to be alternatively spliced, which is not very likely as this mutation would be lethal for the organism. Support for the theory of the alterations in the auxiliary trans-splicing machinery is coming from literature. It has been shown that tumor cells express high levels of a broad spectrum of a group of splicing factors which are members of a conserved family of proteins. These factors bind to the active sites of RNA polymerase II transcription and thus function as key regulators of alternative RNA splicing, whereas preneoplasias often express only a sub-set of the family [<link ref="_bib109">Stickeler, 99</link>]. The major group of these proteins belongs to Serine/arginine-rich (SR) proteins [<link ref="_bib110">Zahler, 92b</link>; <link ref="_bib111">Fu, 95a</link>; <link ref="_bib112">Graveley, 00b</link>]. They have dual functions and serve as splicing enhancer or splicing repressor proteins, depending on where they bind in the pre-mRNA reviewed in [<link ref="_bib113">Akusjarvi, 03</link>].</p>
      <p>Although the majority of the isoforms of TRPM8 expressed in prostate tumors are most likely due to splicing defects resulting in unnatural splicing with no biological relevant functions, some of those splice variants might be of biological significance. In Northern blot experiments two isoforms of TRPM8 could be identified: one longer transcript as TRPM8 with a length of 7.3 kb and a shorter one with a length of 4.1kb, but neither of these matches the length of the transcripts identified in prostate tumors. </p>
      <p>In conclusion it can be said that the splice variants found in this study are extremely good markers for the detection of prostate cancer. They would be good targets for a pay load based therapeutic approach. Their potential for being a target for a small-molecule has to be analyzed in further studies, as their contribution to malignant transformations has not yet been proven.</p></section></chapter><chapter><head>
         <pagenumber numbering="arabic" start="67"/>Outlook</head>
      <p>In the last years the development of target drugs for the treatment of cancers has dramatically increased, a progress that is likely to continue in the future. It is obvious that targeting molecular abnormalities has considerable advantage over unspecific systemic drugs such as the chemotherapy. They are more specific, thus less toxic, and more effective in the treatment of cancer [<link ref="_bib167">Stockwin, 03a</link>]. It seems possible that targeted drugs will be used in association with existing medical, surgical, and radiotherapeutic therapies and will play an important role in the aim of curing cancer. </p>
      <p>In the present work it was possible to identify TRPM8, as a perfect target for a specific prostate cancer therapy. </p>
      <p>The focus in future experiments will be the development of specific drugs targeting TRPM8. It is hoped and expected that these therapeutics will lead to new and promising treatment forms of prostate cancer.</p></chapter><chapter><head>
         <pagenumber numbering="arabic" start="68"/>MATERIALS AND METHODS</head><section><head>metg001A Chipdesign</head>
      <p>A custom designed oligonucleotide microarray based on Affymetrix technology (Affymetrix, Santa Clara, CA) was developed by metaGen Pharmaceuticals GmbH in order to profile different cancer entities. This chip contains about 6200 probe sets which represent roughly 3.000 genes. Nearly half of the sequences were genes to be shown as overexpressed in various tumor entities derived from EST mining approaches [<link ref="_bib8">Schmitt, 99a</link>]. The other sequences are known tumor associated genes, sequence-tagged site (STS) markers and sequences derived from protein motives. </p>
      <p>The identification of genes overexpressed in tumors for the chip design was based on the counting of expressed sequence tags (EST) in different tissues and diseases. The sequences were derived from public<footnote start="9">
            <p>http://www.ncbi.nlm.nih.gov/dbEST/</p>
         </footnote> and proprietary (Incyte Genomics, Palo Alto, CA, USA) databases. About 4 million ESTs were presented in both databases at the time of the study, which were sorted for tissues specificity and into pairs of benign and cancer tissues. </p><subsection><head>Automated extension of cDNA sequences (AUTEX)</head>
      <p>ESTs are single pass-reads from randomly selected cDNA clones. They are approximatly 500bp in length. Of the 4 million ESTs screened, many represent the same gene covering different sections of the gene. In order to represent each gene only by one probeset on the chip these ESTs were assembled using the in house AUTEX (automated extension of cDNA sequences) algorithm [<link ref="_bib8">Schmitt, 99d</link>]. First, a BLAST (Basic Local Alignment Sear Tool) program was used to search for ESTs which represented the same gene using dbEST and Incyte databases. Second, alignment of these ESTs was performed to elongate the sequences. These contigs were again blasted to the EST databases. After repeated rounds it was thus possible to receive the maximal length of a contig representing the sequence of a gene. </p></subsection><subsection><head>Electronic Northern</head>
      <p>The assembled cDNA contig from the AUTEX program was then analyzed for its distribution among these 4 millions ESTs. The number of ESTs matching to each sequence originating from one EST pool was counted and normalized to the EST pool size for each tissue. Fisher&#8217;s exact test was used to assess the significance of differential expression among tissues and between normal and <pagenumber numbering="arabic" start="69"/>cancer tissues. A gene was defined as differentially expressed at a p- value of &lt; 0.05.<link ref="_Ref60546223">Fig. 47</link>summarizes this in silico approach. </p>
      <p>
         <mm entity="Grafik49" label="521#246">
            <caption>
               <link id="_Ref60546223"/>Fig. 47 Schematic drawing of the gene assembly program and the in silico expression profiling in cancers taken from [<link ref="_bib8">Schmitt, 99e</link>].</caption>
         </mm>
      </p></subsection></section><section><head>gene chip analysis</head><subsection><head>Tissue Collection </head>
      <p>Prostate cancer and normal tissue specimens were obtained from 52 patients undergoing radical prostatectomy for clinically localized prostate carcinoma at the Department of Urology at the University Hospital Charité from 1998 to 2001. Patients aged 47 - 73 had a Gleason score 4 -9 and a tumor stage T2a - T4. Preoperative PSA levels were between 2-30 ng/ml. The prostatectomy specimens were sectioned by a pathologist immediately after surgical removal. Slices of tissue were flash frozen in liquid nitrogen and stored at -80°C. </p></subsection><subsection><head>Microdissection </head>
      <p>Thirty serial frozen whole-mount sections of prostate tissue (10 µm) were air dried, briefly stained with hematoxylin and refrozen on dry ice. Every 10th slide (5 µm) was stained with hematoxylin, and eosin for documentation, and areas for microdissection were marked. The tumor was separated from stoma cells by microdissection with a needle (22G) under an inverted microscope (40 x magnifications). Tissues were collected in GTC buffer containing 2% b-Mercaptoethanol for further RNA preparation. All samples contained at least 90% tumor cells. </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="70"/>RNA preparation and amplification</head>
      <p>Poly-A+-RNA was isolated by magnetic separation using the Poly-A-tract 1000 kit (Promega, Heidelberg, Germany) according to the manufacturer&#8217;s protocol. cDNA synthesis and repetitive linear amplification (3 rounds) was performed with minor modifications as described [<link ref="_bib143">Luo, 99</link>]. Briefly, cDNA was synthesized by priming the RNA with the Affymetrix T7-oligo-dT promoter-primer combination (5`-GGCCAGTGAATTGTATACGACTCACTATAGGGAGGCGGT24-3` at 100 mM) and the reaction was incubated at 37°C for 1h. From the resulting cDNA the second strand was synthesized by first digesting the RNA partially. The RNA remnants thus functioned subsequently as primers for second strand synthesis. In vitro transcription was performed using the Megascript kit from Ambion (Huntington, UK). From the generated aRNA a new first strand synthesis was initiated using 0.025 mM random hexamer as primer. The second strand was synthesized using the Affymetrix T7-oligo-dT promotor-primer at a concentration of 0.1 mM. Again in vitro transcription was performed. The cDNA of each round of amplification was tested by Real Time PCR for its integrity. cDNAs of low quality were excluded from further analysis. A third round of amplification was performed as described above with the difference that biotin labeled nucleotides (Bio-11CTP and Bio-16-UTP, ENZO, NY, USA) were incorporated into the RNA within the in vitro transcription reaction. After RNA fragmentation to 50&#8211;200 nucleotides, 15 µg of biotinolated RNAs were hybridized to the metg001A Cancer-Chip. The arrays were then processed on the Affymetrix fluidics station and hybridization signals were visualized using phycoerithrin-conjugated streptavidin (Molecular Probes, Eugene, OR). GeneChips were scanned at 570 nm using an Agilent GeneArray Scanner. </p></subsection><subsection><head>Data processing </head>
      <p>Data processing was performed by the bioinformatics group within metaGen. Raw intensity values were extracted from .cel- files. For background correction the chip was partitioned into 16 tiles. Each tile the mean of the 2% probes with the lowest intensities was determined and subtracted from each probe value respectively. The background corrected probe intensity values were normalized by dividing them by the median value of all probes. A representative expression value for each probe set (PMQ-value) was generated by using the 75th percentile of the PM-intensities. For each probe set a p-value for a &#8216;present call&#8217; was calculated by comparing the intensities of the PM and MM probes using the Wilcoxon rank sum test for paired data [<link ref="_bib170">Wilcoxon, 45</link>]. To minimize technically caused data perturbation a model fitting algorithm was applied to the PMQ data. For this purpose an ideal expression profile was constructed by determining the median PMQ- value of all analyzed chips, thus representing a theoretical reference chip. </p>
      <p>Expression data of each individual chip was compared to the reference chip by applying the data to a xy scatter plot, in which x is represented by the reference chip data and y by the individual chip data. A linear regression using &#8216;Robust Statistics&#8217; rules [<link ref="_bib144">Hudson, 81</link>] was performed, resulting in a linear equation <pagenumber numbering="arabic" start="71"/>described by their parameters slope m and intercept n. Using these parameters the data was linear transformed, so that in the xy plot a slope m=1 and an intercept n=0 was reached. Since after application of this fitting approach non linear effects (&#8216;banana shape&#8217; distribution) were still visible a segmented algorithm was created. For that purpose the probe sets were separated into two groups by means of their predominant call (absence or presence, p-value &gt;, &lt; 0.05). Both groups were then fitted individually as described above. Finally resulting PMQ-values were normalized again by dividing them by the chip median PMQ. </p></subsection><subsection><head>Prostate Cancer Gene Expression Analysis</head>
      <p>From the 6117 probe sets present on the meta001A chip 3023 were used to identify differentially expressed genes. The reasons why 50% of the probe sets were sorted out are multiple: first, 688 were sorted out because they represented positive and negative controls; second, some sequences represented not only one gene, but represented whole groups of genes; third, most of the probe sets had to be excluded because they represented the same gene, i.e. not one probe set represented one gene, but 2-4 probe sets. This was due to the chip design. The in silico search for differentially expressed genes compared expressed sequence tags (EST) from tumor libraries with ESTs from normal libraries. The information gained from these ESTs was usually restricted to approximately 500 base pairs of sequence information which usually did not cover one whole gene. As many ESTs overlapped it was possible to use the AUTEX program to elongate the sequence information of each gene. But for many genes it was not possible to find enough ESTs to cover the gene from the 5&#8217; end to the 3&#8217; end resulting in &#8220;EST gaps&#8221;. Not knowing that these ESTs belong to the same gene one probe set per EST-consensus sequence had to be designed and added to the chip, which led in some cases to more than one probe set per gene. As more and more information from the human genome project became available these probe sets could be identified as belonging to the same gene. Another reason for double or triple represented genes is that some ESTs could not be assigned in the right orientation (5&#8217;-3&#8217;) and therefore had to be added to the chip in both directions. From the remaining 3023 probe sets each represented a different gene which was proved by using the Unigene annotation tool blastN <footnote start="10">
            <p>http://www.ncbi.nlm.nih.gov/UniGene/</p>
         </footnote>. </p>
      <p>For prostate data analysis the quotient of the normalized PMQ value of each patient and probe sets (tumor/normal) was calculated when the gene was expressed in both tumor and normal samples (p- value &lt; 0.05). For genes present only in either normal or tumor tissue (p- value &gt;0.05) no fold change was calculated but marked as differentially expressed. </p></subsection><subsection><head>probeset comparison of metg001A and U113B</head>
      <p>Normal and tumor tissues of prostate, pancreas, mammary gland, ovary and bladder were analyzed exclusively on the metg001A chip whereas samples of <pagenumber numbering="arabic" start="72"/>tumor and normal tissues form lung and colon were at least partially run on the Affymetrix U133 GeneChips (HG-U133 Set). This Human Genome Set, consisting of two GeneChip arrays (U133A and U133B) representing almost 45,000 probe sets representing more than 39,000 transcripts derived from approximately 33,000 well-substantiated human genes<footnote start="11">
            <p>www.Affymetrix.com</p>
         </footnote>. In order to ensure that expression data gained from both chips were comparable, probesets for TRPM8 on the metg001A (FFF991_at) and U133B (243483_at) were examined more closely (<link ref="_Ref58394054">Fig. 48</link>, <link ref="_Ref58394092">Tab.5</link>)</p>
      <p>
         <mm entity="Grafik50" label="521#241">
            <caption>
               <link id="_Ref58394048"/>
               <link id="_Ref58394054"/>Fig. 48 Probeset distribution of TRPM8 on metg001A and U133B.</caption>
         </mm>
      </p>
      <p>In general the metg001A chip shows 20 probesets per gene whereas the U133B chip represent a gene by a set of 11 probesets. The reduction of the number of probesets (the 25base pair/oligo remained the same) was due to results gained from first chip experiments showing that 11 probesets are sufficicent to represent a gene.</p>
      <p>In both chips the probesets are located at 3&#8217; end of the TRPM8 gene. Most of the probesets from U133B and metg001A are overlapping as shown in red letters in <link ref="_Ref58394092">Tab.5</link>. Thus it can be concluded that the expression values gained from both chips are comparable. Looking more closely at the oligoprobesets of the metg001A chip it revealed that the probesets 6-10 alter 1-2 false bases, which makes them unusable for gene chip evaluation. But as the PMQ was taken from the 75th percentile the false probesets did not influence the results gained from the gene chip analysis. </p>
      <p>
         <table orient="port" frame="none" tocentry="1">
            <caption>
               <link id="_Ref58394092"/>Tab.5 Comparison of probesets for TRPM8 on the metg001A chip and the U133B chip. Blue bases indicate incorrect base pairs, red bases show the overlapping sequences in both chips. The grey shaded part points out the false probesets. </caption>
            <tgroup cols="1" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>
                           <pagenumber numbering="arabic" start="73"/>
                           <mm entity="Grafik51" label="521#255"/>
                        </p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p></subsection></section><section><head>Real-Time PCR </head>
      <p>a) Expression of splice variants of TRPM8</p>
      <p>First strand synthesis was done either from two times amplified aRNA or from freshly prepared mRNA. The cDNA was synthesized as described in the Affymetrix sample preparation. The cDNA generated from 1 ng RNA was used for the Taqman assay (Applied Biosystems, Weiterstadt, Germany). For quantitative PCR 1ng of cDNA was used in each reaction. The reaction was carried out in a 25 µl reaction volume containing 2.5 µl 10x SYBRGreen PCR Buffer (Applied Biosystems), 25 mM Mgcl2, 12.5 mM dNTP&#8217;s (with dUTP) and 0.625 U Ampli Taq Gold (Applied Biosystems). The reaction was carried out on the &#8220;GeneAmp 5700 Sequence Detection System&#8221; (Applied Biosystems, Weiterstadt) according to the manufacturer&#8217;s instructions. The primer sequences were designed with Primer Express software (Applied Biosystems) using the special Design program for TaqMan specific primers. Thus all PCR reactions could be carried out at the same conditions: Samples were denatured for 10 min at 95°C, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The analysis for each sample was done using the DDct-Method according to the manufacturer (Applied Biosystems). </p>
      <p>
         <pagenumber numbering="arabic" start="74"/>b) Expression of TRPM8, NKX3-1, KLK3 and MYC in R1881 treated LNCaP cells. </p>
      <p>RT-PCR reaction was carried out using the QuantiTect SYBR Green (Qiagen, Hilden, Germany) following the manufacture&#8217;s instructions. Briefly, RT and PCR reactions were carried out in the same reaction tube at the following conditions: 50°C for 30 min (RT), 95°C for 15 min, followed by 45 cycles of 95°C for 40 s, 60°C for 40 s and 72°C for 40 s on a Perkin-Elmer GeneAmp5700 Cycler. Primer design and data analysis were carried out as described above. Primer sequences are listed in <link ref="_Ref58675578">Tab. 6</link>.</p>
      <p>
         <table orient="port" frame="all" tocentry="1">
            <caption>
               <link id="_Ref58675578"/>Tab. 6 Oligonucleotid sequences for RealTime PCR</caption>
            <tgroup cols="3" align="left" charoff="50" char="">
               <colspec colnum="1" colname="1"/>
               <colspec colnum="2" colname="2"/>
               <colspec colnum="3" colname="3"/>
               <tbody valign="top">
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Splice Variante</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sequence (5 &#8594; 3&#8217;)</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Primer</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>TRPM8</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TATCTTACTGAACACCTGTAGTCCCAG-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TGAGTTTATAGTGTATTCAAAGCTGAGAAA-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>16b</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CTGGAAGATTATCCTGTGTCTGTTTATT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-GTGCCTTGGTTTGTACCTAAATGA-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>20b</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TTGGCTCAGATGGAAACAGCTT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CGCGCGTGCTTCTGAAGT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>4a4b</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CATCGTGCTTATCAGGGAGAATG-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TCTGGGTGCCTTCCATGTG -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>6b</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TGCTAGGTCACATGGAAGAAAGAC-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TGGCTGGCTCCATCACAGA-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>Gegenstrang</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CACGAAGCTCTCCTGGGTTATT -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CCTTGTTGGAAATGGATCAGACA-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>Avant13</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TCAGGTTTTCTTAATTGCAGAGCTT -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;- GGAGCATGCAGCTATTTGTTTG-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>Avant25</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CCATTGTTTTTCAACTCTCTTTT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-GAAAGAGCCTTGTATTTGTTAAT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>beta actin</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TGCATTGTTACAGGAAGTCCCTT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-GGGAGAGGACTGGGCCAT-3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>NKX3-1</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-ATTACTTGGTTTGTGAATCCATCTTG -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-AGCTCTTCAGATGTTTTTCTACCAGTT -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>MYC</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CGTCTCCACACATCAGCACAA- 3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-TCTTGGCAGCAGGATAGTCCTT -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="1" rotate="0" valign="top">
                        <p>KLK3</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-GGCACTGGGAAGCCTAGAGA -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>Sense</p>
                     </entry>
                  </row>
                  <row>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>5&#8217;-CCATCCCATGCCAAAGGA -3&#8217;</p>
                     </entry>
                     <entry morerows="0" rotate="0" valign="top">
                        <p>antisense</p>
                     </entry>
                  </row>
               </tbody>
            </tgroup>
         </table>
      </p>
      <p>Relative expression analysis for Real Time PCR experiments was carried out using &#916;&#916;Ct-Method according to the manufacturer (Applied Biosystems). The Ct-value of beta actin and all other genes were measured at a threshold of 0.1. For normalization the Ct-value of beta actin was subtracted from the Ct -value of <pagenumber numbering="arabic" start="75"/>the gene of interest. This &#916;Ct- value is the normalized expression value for each gene in each sample. In order to define the expression ratio between normal and tumor samples (&#916;&#916;Ct) the &#916;Ct-value of the tumor sample was subtracted from the &#916;Ct-value from the matched normal. Finally, the &#916;&#916;Ct was taken as the exponent of 2 in order to obtain the relative expression between the normal and the tumor sample. Statistic results were analyzed by 2-tailed Student&#8217;s t-test. A p&lt; 0.05 was accepted as the level of significance.</p></section><section><head>Northern Blot and Dot Blot analysis</head>
      <p>Multiple Tissue Northern Blots and Matched Tumor/Normal Expression arrays were obtained from Clontech (Heidelberg, Germany). Hybridizations with a-32P labeled DNA probe were performed according to the manufacturer&#8217;s recommendations. Briefly, filters were prehybridized in ExpressHyb solution (Clontech, Heidelberg, Germany) for 30 min at 65°C. Gene specific probes were labeled with a-32P dCTP by random hexamer priming and hybridized over night at 65°C with agitation. The filters were washed twice in 2x SSC, 1%SDS for 5 min and twice for 30min at 65°C and once at 0.1x SSC and if signal were too strong again for 30 min in 0.5% SDS at 65°C. Filters were exposed to a FUJI imaging plate and scanned in a FUJIfilm BAS-1800 II scanner. The 5&#8217; TRPM8 specific probe was obtained by digesting the TRPM8-pcDNA3.1/His clone (described above) with BamH1, which resulted in a 2713 bp fragment covering exons 1-20 from TRPM8. The 16b specific probe was derived by PCR using the primer pair (5&#8217;-ATTTAGGTACAAACCAAGGCACA-3&#8217; / 5&#8217;-aatttccaggctttttaatcattt-3&#8217;). The 3&#8217; &#8220;unspecific&#8221; probe for TRPM8 was derived from the clone AI420227 which covers the TRPM8 sequence from base pairs 5258-5641 cloned into pT7T3D-Pac. This construct was digested with NOT1 and EcoR1 receiving the 384 bp probe. </p></section><section><head>In situ Hybridization </head>
      <p>The tissues used for hybridization were obtained from the Department of Urology at the University Hospital Charité and from a commercial distributor (Ambion, Huntington, UK). Sections were deparaffinized and rehydrated before fixation in 4% paraformaldehyde. After washing twice with PBS tissues were digested with proteinase K and hybridized over night with the sense and antisense probe at 65°C. The TRPM8 specific probe (and the control [sense] probe) was synthesized by in vitro transcription from a linearized TRPM8-pcDNA3.1/His plasmid (exons 1-20) and the RNA was transcribed from the T7 site using digoxigenin-labeled riboprobes according to the manufacturer&#8217;s directions (Roche Applied Siences, Mannheim, Germany). After 3 h of transcription the probe was analyzed for purity and size on a 1% denaturing agarose gel. Hybridized probes were detected by using the alkaline phosphatase conjugate anti-DIG antibodies and signals were visualized using the NBT/BCIP <pagenumber numbering="arabic" start="76"/>substrates. The sections were counterstained, mounted, and examined by a pathologist. </p></section><section><head>Cell culture</head>
      <p>The cell lines were obtained either from ATCC (American Type Culture Collection, Manassas, VA, USA) or the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany). Cells were routinely maintained according to the manufacturer&#8217;s conditions, supplemented with 10% fetal bovine serum (FBS) and cultured at 37°C and 5% CO2. All cells were cultured free of antibiotics. </p><subsection><head>Culture of LNCaP cells for androgen activation </head>
      <p>The human prostate cancer cell line LNCaP was obtained from ATCC and grown on RPMI 1640 medium supplemented with 10% charcoal-stripped fetal bovine serum (CCS) (HyClone, Utha,USA) at 37°C and 5% CO2. The cells were plated in 6-well culture (Primaria, BD Biosciences, Heidelberg, Germany). For androgen induction LNCaP cells were grown for 24h in serum free RPMI 1640 to deplete undesired steroids for 24h prior experiment. Cells were then treated with 5% CCS FBS and the non-metabolizable synthetic androgen R1881 (Dupont-NEN, Life Science Products Inc., Boston, MA, USA) was added at concentrations of 1 µM, 10 µM and 100 µM. Equivalent amount of solvent (ETOH) was added to control cells. Cells were treated for 24h and harvested in GTC buffer and stored at -80°C before mRNA preparation. </p></subsection></section><section><head>Plasmid construction </head><subsection><head>TRPM8 </head>
      <p>The TRPM8 ORF was cloned into the pcDNA3.1-V5-His-TOPO (Invitrogen, Karlsruhe, Germany) for transfection experiments in HEK293 cells by PCR using the primer pair 5&#8217;-GGCCGCCATGTCCTTTCGGGCAGCCAGGCT-3&#8217; and 5&#8217;-AAAGAGATTGCTAATAAAATCAAA-3&#8217;. Reaction was performed using the Elongase Amplification system (Invitrogen, Karlsruhe, Germany), at the following conditions: 95°C for 2 min, followed by 32 cycles of 95°C for 30 s, 62°C for 30 s and 68°C for 6 min. Subsequently PCR products were digested with the appropriate digestion enzyme, purified and cloned into BAMHI / XBAI restriction sites of the pcDNA6-myc-his vector (Invitrogen, Karlsruhe, Germany). For in situ hybridization experiments the TRPM8 gene was cloned into the pcDNA3.1 and digested with BAMHI, resulting in a 2.7 kb probe starting from the 5`end of TRPM8 gene. </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="77"/>16b</head>
      <p>16b was cloned into the pcDNA6-myc-his vector (Invitrogen, Karlsruhe, Germany) 16b was amplified from a prostate adenocarcinoma <url href="http://www.google.de/url?sa=U&amp;start=1&amp;q=http://www.bdbiosciences.com/clontech/products/cat/HTML/1159.shtml&amp;e=7629" type="URL">Marathon-Ready&#8482; cDNA</url>(BD Biosciences, Heidelberg, Germany) by PCR using the primer pair 5&#8217;-catgtttacggctctcataaagga-3&#8217; / 5&#8217;- AGGATCTAGATCATGAGAGCACACCATATGGTG-3&#8217; (3&#8217; BSTXI and XbaI restriction site at the 3&#8217; end). Reaction was performed using the Elongase Amplification system (Invitrogen, Karlsruhe, Germany), at the following conditions: 95°C for 2 min, followed by 32 cycles of 95°C for 30 s, 62°C for 30 s and 68°C for 3 min. Subsequently PCR products were digested with the appropriate digestion enzyme, purified and cloned into BAMHI / XBAI restriction sites of the pcDNA6-myc-his vector (Invitrogen, Karlsruhe, Germany). </p></subsection><subsection><head>Promoter constructs</head>
      <p>The 1.9 kb DNA fragment, which contains the 5&#8217; upstream region of TRPM8 was amplified by PCR using the primer pair 5&#8217;-TCT<u>ACGCGT</u>GCCTGGCCCAATACTGCAT-&#8216;3 / 5&#8217;-TTC<u>CTCGAG</u>GCTTGACAATAACACCATAGTATGAAATC-&#8216;3 from the BAC AC005538, which was used as a template (restriction sites MLUI and XHOI for directional cloning are underlined). The 200 bp construct was derived also by PCR using the primers 5&#8217;-TCT<u>ACGCGT</u>CCCATTTCATGAGGATGCTTACT-&#8216;3 / 5&#8217;-TTC<u>CTCGAG</u>ACCCTAAGTGACGGTTTTTGTCAA-3&#8217; from the same template. Both fragments were digested with the restriction enzymes MLUI and XHOI, purified and isolated by elution from an agarose gel electrophoresis. The fragment was ligated into the MLUI and XHOI of the luciferase reporter vector pGL3-Basic vector (Promega, Wisconsin, USA), that had been digested previously with MLUI and XHOI.</p></subsection></section><section><head>Luciferase Reporter Assay</head>
      <p>LNCaP, PC3, DU-145 and HEK293 cells were cultured as recommended by the supplier. For luciferase reporter assay cells were grown to 80% confluence in 96-well plates and in transiently transfected with 0.2 µg of the appropriate (200bp-pGL3, 2kb-pGL3, 2kb-pGL3-SD, pGL3-empty) reporter constructs. The phRL-null vector (Promega, Madison, Wi, USA) was used for transfection normalization. Each promoter-construct was at least transfected in <url href="http://dict.leo.org/?p=/37m..&amp;search=quadruplicate" type="URL">quadruplicate</url>s. Transfections were carried out according to the manufacturer&#8217;s description. Briefly, the DNA was mixed with 25 µl transfection medium (Opti-MEM, Invitrogen) and incubated for 20 min with 0.5 µl of lipofectamine diluted in 25 µl of Opti-MEM. The mixture was then applied to the cells in a total volume of 100 µl according to the manufacturer&#8217;s directions. After 24 hours of incubation, cells were washed in PBS and lysed with 25 µl of Passive Lysis Buffer (Promega, Madison, Wi, USA). Promoter activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, Wi, USA) <pagenumber numbering="arabic" start="78"/>according to the manufacturer&#8217;s recommendations by using the Luminometer Mithras LB940 (Berthold Technologies, Bad Wildbad, Germany). In transfection experiments for androgen induction cells were grown on RPMI 1640 medium supplemented with 10% charcoal-stripped fetal bovine serum (CCS) (HyClone, Utha, USA). Treatment of R1881 and transfection of cells were carried out in parallel for 24h. All other conditions remained the same. The median of all experiments normalized to transfection efficiency was calculated and standard deviations were calculated.</p><subsection><head>Site-directed mutations </head>
      <p>Site-directed mutations of the 1.9kb-TRPM8-pGL3 construct were done following the instructions of the manufacturer using the primer pairs indicated in <link ref="_Ref59277174">Fig. 50</link>. The schematic view of altered transcription factor binding sites is described in (<link ref="_Ref59277218">Fig.  49</link>).</p>
      <p>
         <mm entity="Grafik52" label="505#273">
            <caption>
               <link id="_Ref59277218"/>Fig. 49 Schematic view of site-directed-mutations of the 1.9-TRPM8-pGL3 vector. Red letter in blue boxes indicate the base pairs deleted in Site-directed-mutations (SdM)-pGL3-construct. Light green boxes show the sequence of each transcription factor binding site. Capital letters demonstrate the core binding nucleotides of each transcription factor binding site. </caption>
         </mm>
      </p>
      <p>
         <pagenumber numbering="arabic" start="79"/>
         <mm entity="Grafik53" label="499#722">
            <caption>
               <link id="_Ref59277174"/>Fig. 50 Primer for the TRPM8 promoter site-directed mutations. Red letters indicate deleted base-pairs of the 1.9kb-TRPM8-pGL3 contruct.</caption>
         </mm>
      </p></subsection></section><section><head>
         <pagenumber numbering="arabic" start="80"/>Intracellular Ca2+ measurements </head><subsection><head>Fura-2 assay</head>
      <p>Changes of intracellular Ca2+ ([Ca2+]i) were monitored by measuring fura&#8209;2 fluorescence. Cells were incubated with culture medium containing 1 µM fura&#8209;2&#8209;AM for 45 min. Thereafter, cells were washed with the extracellular bath solution described above. Fluorescence measurements in single cells were performed at room temperature with a digital imaging system (T.I.L.L. Photonics, München, Germany). Fura&#8209;2 fluorescence was excited at 340 nm and 380 nm wavelength and changes in [Ca2+]i were monitored based on the ratio of the fluorescences obtained. The concentration of free [Ca2+]i was calculated according to [<link ref="_bib171">Grynkiewicz, 85</link>]. For calibration of free [Ca2+]i, fluorescence in the presence of EGTA (1 mM) or ionomycin (1 µM) was obtained. If drugs were added from dimethyl sulfoxide (DMSO) containing stock solutions, the solvent concentration did not exceed 0.1% which did not change Fura-2 fluorescence in control experiments. To avoid influence of DMSO on [Ca2+]i, we used DMSO in the bath solution at a concentration lower than 0.1%. </p></subsection><subsection><head>FLIPR assay</head>
      <p>The Fluorometric Imaging Plate Reader (FLIPR) (Molecular Devices, München, Germany) provides a rapid, high-throughput screening system for reading intracellular fluorescence assays such as [Ca2+]i flux and membrane potential. The effects of drugs, agonist or antagonist on calcium channels or cell surface receptors like GPCRs can be quantified in cell based assays with the FLIPR system.</p>
      <p>The Calcium Flex Station Kit offers an easy and fast fluorescence-based assay for detecting changes in intracellular calcium without washing steps. Assays were performed according to protocol of supplier. In brief, cells were seeded in 96 black well clear bottom plates and grown to 100% confluency at the day of measurement. Medium was changed before assay started. 100 µl medium per well were supplemented with 50 µl of freshly prepared calcium-assay reagent including the calcium specific fluorochrome and incubated for 30 min at 37°C. Another 96 well plate containing all stimulating reagents was prepared and placed next to the cells plate in the FLIPR device. All substances were tested in dilutions series at least in sextuplets. The pore forming agent ionomycin (1-10 µM) and/or ATP (10 µM) were used to compare shape, status and calcium flux of different clones (positive control for high [Ca2+]i influx signal). HBSS buffer without substances were as negative controls and DMSO or ethanol in appropriate dilutions were used as solvent controls. After the baseline detection for 30 sec the FLIPR pipettor added 50 µl of substances to each well. Alterations of fluorescence signal which indicates calcium influx was detected with a laser at 488 nm. Signals from all 96 wells were monitored in parallel for up to 5 min with points from every 1-10 sec. Results were calculated using the FLIPR software. </p></subsection></section><section><head>
         <pagenumber numbering="arabic" start="81"/>Flow Cytometry Analysis</head>
      <p>For flow Cytometry assays, HEK293 cells were stable transfected for TRPM8-pcDNA3.1-V5-his and 16b-pcDNA6-myc-his were grown on 6 well plates. Cells were washed once with PBS and centrifuged at 300 g in PBS for 5 min. Cell pellets were resuspended in washbuffer (WB) (PBS with 0.2% BSA and 0.1% sodium azide) and centrifuged again at the same conditions. Cells were fixed with 300 µl CellFIX (BD Biosciences, Heidelberg, Germany) and incubated for 10 min, washed with PBS and centrifuged at 300g for 5 min. Cells were permeabilized with 300 µl Permeabilizing Solution 2 (BD Biosciences, Heidelberg, Germany) for 10 min and washing procedure was repeated as above. Staining was done with primary anti-V5 antibody (rabbit) (Invitrogen, Karsruhe, Germany) and anti-myc (mouse) (Invitrogen, Karsruhe, Germany) antibody for TRPM8 and 16b, respectively. The antibodies were diluted 1:100 in WB and cells were incubated for 10 min at RT. Cells were washed once in WB and centrifuged. Labelling was done with secondary fluorescence labeled antibody in 60 µl antibody solution at a concentration of 1:300 for 10 min in the dark. Anti-rabbit-phycoerithrin (PE) labeled and anti-mouse Fuoresceine Isothiocyanate (FITC) labeled antibody (Dianova, Hamburg, Germany) were used for V5 (TRPM8) and myc (16b) detection, respectively. The wash step was repeated and the cells were resuspended in 300 µl WB. Then cells were then analyzed by a FACSCalibur (BD Biosciences, Heidelberg, Germany) with the CELLQUEST program (BD Bioscience).</p></section><section><head>FISH Analysis </head>
      <p>These experiments were performed at the Charité, AG Tumorgenetik und Molekulare Zytogenetik at the Institut für Medizinische Genetik of Prof. Dr. Evelin Schröck.</p><subsection><head>Metaphase preparation</head>
      <p>For preparation of metaphase chromosomes LNCaP cells were cultured in 6 well dishes for 72 h at standard conditions. Colcemid (KaryoMAX Colcemid Solution, Invitrogen, Karlsruhe, Germany) at a concentration of 10 µg/ml was added and cells were cultured for an hour at 37°C followed by standard metaphase preparation. Cells were harvested and centrifuged at 1200 g for 12 min. 0.4% potassium chloride was added to the cell pellet and incubated for 10 min. After hypotonic incubation, cell suspensions were washed several times in fresh fixative solution (methanol/acetic acid fixative vol/vol 3:1). Fixed cells were dropped onto clean slides at a volume of 20 µl and air dried for approximately 1 min. Before storage at -80°C slides were washed in increasing ethanol concentrations and dried for two days at 37°C. </p></subsection><subsection><head>
         <pagenumber numbering="arabic" start="82"/>Probe preparation and hybridization</head>
      <p>The BAC (Bacterial artificial chromosome) clone AC005538 which was used as a probe for hybridization, maps to 2q37.2 covering the complete genomic region of TRPM8 plus an additional 100 kb of the 5&#8217; site of TRPM8 gene. 2 µg of DNA was used for Nick-translation using biotinylated-dUTP at 15°C for 1.5 hours. The DNA was precipitated and added to the hybridization buffer. Before hybridization of the slides were equilibrated in 2 x SCC at RT and treated with RNase and pepsin. Hybridization was performed as described elsewhere in detail [<link ref="_bib153">Lichter, 95</link>]. Briefly, hybridization was performed overnight with the biotinylated AC005538 probe and the LSI C-MYC (8q24.12-q24.13) probe which was directly labeled with SpectrumOrange (1:200; Vysis Inc., Downers Grove; IL, USA). Staining was done with an avidin-FITC labeled antibody (Dianova, Hamburg, Germany) at a concentration of 1:200 for 45 min at 37°C. After repeated washings, slides were dehydrated, air dried and antifade treated.</p>
      <p>Images were acquired through a Leica DM RXA epifluorescence microscope (Leica Microsystems, Solms, Germany) which was connected to a CCD camera). Image processing and data analysis was performed with QFISH software (Leica Microsystems).</p></subsection></section><section><head>FRET Analysis </head>
      <p>Fluorescence resonance engergy transfer analysis (FRET) was performed at the Freie Universität Berlin, Institut für Pharmakologie by Michael Schäfer and Daniel Sinnecker. FRET is used to measure the close proximity of fluorescence molecules (distance closer than about 12 nm), as for example the assembly of ion channels subunits in living cells. The method is describe in detail in [<link ref="_bib154">Schaefer, 02a</link>; <link ref="_bib155">Amiri, 03</link>]. Briefly, TRPM8 and 16b were C-terminaly fused to CFP (pcDNA3-YFP) and YFP (pcDNA3-CFP) (Invitrogen, Karlsruhe, Germany). The absence of mutations was confirmed by DNA sequencing. HEK293 cells were transiently cotransfected (either pcDNA3-TRPM8-YFP and pcDNA3-TRPM8-CFP, pcDNA3-TRPM8-YFP and pcDNA3-16b-CFP [and vice versa] or pcDNA3-16b-YFP and pcDNA3-16b-CFP [vice versa]) for 16 hours using the Fugene 6 transfection reagent (Roche Molecular Biochemicals, Mannheim, Germany) following the maufacturer&#8217;s protocol. All experiments were performed in living cells using HEPES-buffered saline, containing 138 mM NaCl, 6 mM KCl, 1mMCaCl2, 1mM MgCl2,5,5 mM glucose, 10 mM HEPES (pH 7,4), and 0.2% (w/v) bovine serum albumine. Cells were grown on coverslips and mounted in custom-made chambers. An inverted microscope (Axivert 100, Carl-Zeiss, Göttingen, Germany) connected to a monochromatic light source was used for digital fluorescence videoimaging (Polychrome II, TILL-Photonics, Martinsried, Germany). For fluorometric data analysis, regions of interest were defined over single cells. Cells exhibiting large intracellular aggregates of fluorescence were excluded from the analysis. A dual reflectivity dichroic mirrow (Chroma, Brattleboro, VT, USA) in combination with the Plan-Apochomat 63x/1.4 objective (Carl Zeiss) was used to excite fluorescent CFP at <pagenumber numbering="arabic" start="83"/>415 nm and YFP at 515 nm. Fluorescence emission was filtered using a Lambda 10/2 motorized filter wheel (Sutter Instruments, Novato, CA) and recorded with a 12-bit CCD camera (IMAGO, TILL-Photonics). Emitted light of CFP was measured through a 460-500 nm emission band and YFP trough 535 -580 nm band pass filter. </p>
      <p>The acceptor bleach protocol consisted of 30 cycles with 10 - 20 ms of exposure to detect the CFP and YFP fluorescence without YFP bleach and 80 -120 additional cycles with an additional 2 s of illumination at 510 nm to bleach YFP.</p></section><section><head>Sequencing</head>
      <p>All cloning products were verified by sequencing using either gene specific primers or vector specific primers following the method developed by Sanger [<link ref="_bib151">Sanger, 77</link>]. Approximately 500 ng of plasmid DNA were used for each sequencing PCR using the BigDyeTM Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Weiterstadt) at the following conditions: 95°C for 4min; 30 cycles of 95°C for 30 s, 50°C for 10 s; 4 60°C 4 min. Samples were purified from unincorporated dNTPs through Sephadex-G50 columns (Amersham Biosciences, Freiburg, Germany), dried, denatured and mixed with 3 µl of formamide loading buffer. Fragments were separated on a 5.25% polyacrylamid gel (PAGE plus, Ameresco, Solon, USA) in a ABI 377A DNA Sequencer (Applied Biosystems, Weiterstadt). Sequence assembling, editing and alignment was done using the GAP4.4-program [<link ref="_bib152">Bonfield, 95</link>]. </p></section><section><head>Construction of stable cell lines</head>
      <p>Stable transfections of the appropriate contructs were carried out using the Lipofectamine 2000 system (Invitrogen, Karlsruhe, Germany) according to the manufacturer&#8217;s description. Briefly, HEK293 cells were seeded in dishes of 6 cm diameter and vector-DNA was mixed with 250 µl transfection medium (Opti-MEM, Invitrogen) and incubated for 20 min with 10 µl of Lipofectamine 2000 diluted in 250 µl of Opti-MEM. The mixture was then applied to the cells in a total volume of 2 ml according to the manufacturer&#8217;s directions. About 16 h post transfection, medium was changed and supplemented with 5 µg/ml blasticidin (pcDNA6-myc-his or 1mg/ml neomycin (pcDNA3.1-V5-his-TOPO). At this point of time cells were transferred to a 96-well dish, plating approximately 1 cell per well. After 10-20 days cell growth was checked and wells with single clones were further incubated in 24-well dishes and analysed in Western Blot experiments for expression of constructs. </p></section><section><head>Western immunoblotting</head>
      <p>Protein samples were washed twice with ice-cold PBS and lysed with ice-cold NP-40 buffer (25 mM Tris-HCl, pH 7.6;1% NP-40 (IPEGAL); 150 mM NaCl; 1 mM EDTA; 1 mMDTT; 1 mM Na3VO4;1 mM Pefabloc SC (Biomol, <pagenumber numbering="arabic" start="84"/>Hamburg, Germany) and protease inhibitor-cocktail Complete (Roche, Lörrach, Germany). Cells were passed 3 times through a pipette and centrifuged at 14,000 x g for 10 min at 4°C. Protein content was measured using Bradford (Bio-Rad Laboratries, München, Germany). 12 µg of protein from cell lysates were denatured and in sample buffer, subjected to 3-8% Tris-Acetate gel (Novex/Invitrogen, Karsruhe, Germany), and thereafter transferred onto a nitrocellulose membrane. The blot was blocked in 5% milkpowder/TBST (0.05%) for an hour and probed with anti-myc-HRP antibody 1:5000 (Invitrogen). Signals were visualized using the enhanced luminescence ECL detection system (Amersham, Pharmacia Biotech, NY, USA).</p></section><section><head>Immunostaining</head>
      <p>Cells for immunostaining were grown on 24-well glass cover slips (12 mm, (Roth, Karsruhe, Germany) and washed twice with PBS. Fixation was done in 300 µl of (-20°C) methanol/ acetone (ratio 1:1) at RT for 5 min. Cells were washed 2x 5 min with PBS and permeabilized with 0.2% Triton-X100/PBS for 5 min. Blocking of cells was done in 0.2% fish gelantine (Sigma, Mannheim, Germany) for an hour. Staining for SV 16b was done with anti-myc (mouse) and anti-V5 (rabbit) at a 1:100 dilution in fish gelantine/PBS for one hour at RT. Secondary labeling was done at the same conditions with fluorescence labeled antibodies at a concentration 1:300 for 20 min in the dark. Alexa 594 donkey anti-Rabbit IgG and Alexa 488 donkey anti-Mouse IgG (both Molecular Probes, Leiden, Netherlands) were used for V5 (TRPM8) and myc (SV 16b) detection, respectively. Cells were washed once in 0.2% fish gelantine/PBS and nuclei (chromosomes) were stained with DAPI (4',6-diamidino-2-phenylindole) (Sigma) for 5 min at RT. Dishes were mounted with Mowiol containing 0.1% DABCO (Sigma) onto glass slides.</p>
      <p>Analysis was done on an inverted Laserscanning-Mikroscope Leica TCS SL (Leica, Solms, Germany); Laser: Ar 50mW 488nm, HeNe 1mW 543nm, HeNe 10mW 633nm. The application software Leica LCS (Version 2.585), LCS Multi-color software, objective PL APO 63x / 1.32-0.60 Oil was used for imaging analysis. </p>
     </section></chapter></body>
   <back>
   
   
<bibliography>
         
<head><pagenumber numbering="arabic" start="85"/>6. References</head>
<citation id="_bib172" workType="Journal" published="yes"> (<pubdate>2002</pubdate>): <articletitle>Breakthrough of the year. Scorecard 2002</articletitle>, <worktitle>Science</worktitle> <volume>298</volume> [<number>5602</number>], Page <pages>2299</pages>. URL: <url type="URL" href="PM:12493878">PM:12493878</url> </citation>
<citation id="_bib1" workType="Journal" published="yes"><workauthor>Abate-Shen, C. und Shen, M. M.</workauthor> (<pubdate>2000</pubdate>): <articletitle>Molecular genetics of prostate cancer</articletitle>, <worktitle>Genes Dev.</worktitle> <volume>14</volume> [<number>19</number>], Page <pages>2410</pages>-<pages>2434</pages>. URL: <url type="URL" href="PM:11018010">PM:11018010</url> </citation>
<citation id="_bib96" workType="Journal" published="yes"><workauthor>Abrahamsson, P. A.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Neuroendocrine differentiation and hormone-refractory prostate cancer</articletitle>, <worktitle>Prostate Suppl</worktitle> <volume>6</volume>, Page <pages>3</pages>-<pages>8</pages>. URL: <url type="URL" href="PM:8630226">PM:8630226</url> </citation>
<citation id="_bib113" workType="Journal" published="yes"><workauthor>Akusjarvi, G. und Stevenin, J.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Remodelling of the host cell RNA splicing machinery during an adenovirus infection</articletitle>, <worktitle>Curr.Top.Microbiol.Immunol.</worktitle> <volume>272</volume>, Page <pages>253</pages>-<pages>286</pages>. URL: <url type="URL" href="PM:12747553">PM:12747553</url> </citation>
<citation id="_bib155" workType="Journal" published="yes"><workauthor>Amiri, H.; Schultz, G. und Schaefer, M.</workauthor> (<pubdate>2003</pubdate>): <articletitle>FRET-based analysis of TRPC subunit stoichiometry</articletitle>, <worktitle>Cell Calcium</worktitle> <volume>33</volume> [<number>5-6</number>], Page <pages>463</pages>-<pages>470</pages>. URL: <url type="URL" href="PM:12765691">PM:12765691</url> </citation>
<citation id="_bib142" workType="Misc" published="yes"><workauthor>Augustus, M., Davis, L., Lawrence, T., Schroeck, E., Heselmeyer-Haddad, K., McLeod, D. G., Mostofi, F. K., Carter, K. C., Sesterhenn, I. A., Moul, J. W., Srivastava, S., and Ried, T.</workauthor> : <worktitle>Characterization of CPDR-1, a new primary prostate cell line: A comparison with metastatic prostate cancer cell lines LNCaP, PC3 and DU 145 by Spectral karyotyping (SKY)</worktitle>. URL: <url type="URL" href="http://www.cpdr.org/abstracts/meena/imageslegends.shtml">http://www.cpdr.org/abstracts/meena/imageslegends.shtml</url> </citation>
<citation id="_bib30" workType="Journal" published="yes"><workauthor>Bakowski, D. und Parekh, A. B.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Permeation through store-operated CRAC channels in divalent-free solution: potential problems and implications for putative CRAC channel genes</articletitle>, <worktitle>Cell Calcium</worktitle> <volume>32</volume> [<number>5-6</number>], Page <pages>379</pages>-<pages>391</pages>. URL: <url type="URL" href="PM:12543097">PM:12543097</url> </citation>
<citation id="_bib139" workType="Journal" published="yes"><workauthor>Bentel, J. M. und Tilley, W. D.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Androgen receptors in prostate cancer</articletitle>, <worktitle>J.Endocrinol.</worktitle> <volume>151</volume> [<number>1</number>], Page <pages>1</pages>-<pages>11</pages>. URL: <url type="URL" href="PM:8943763">PM:8943763</url> </citation>
<citation id="_bib99" workType="Journal" published="yes"><workauthor>Berget, S. M.; Moore, C. und Sharp, P. A.</workauthor> (<pubdate>1977</pubdate>): <articletitle>Spliced segments at the 5' terminus of adenovirus 2 late mRNA</articletitle>, <worktitle>Proc.Natl.Acad.Sci.U.S.A</worktitle> <volume>74</volume> [<number>8</number>], Page <pages>3171</pages>-<pages>3175</pages>. URL: <url type="URL" href="PM:269380">PM:269380</url> </citation>
<citation id="_bib114" workType="Journal" published="yes"><workauthor>Boise, L. H.; Gonzalez-Garcia, M.; Postema, C. E.; Ding, L.; Lindsten, T.; Turka, L. A.; Mao, X.; Nunez, G. und Thompson, C. B.</workauthor> (<pubdate>1993</pubdate>): <articletitle>bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death</articletitle>, <worktitle>Cell</worktitle> <volume>74</volume> [<number>4</number>], Page <pages>597</pages>-<pages>608</pages>. URL: <url type="URL" href="PM:8358789">PM:8358789</url> </citation>
<citation id="_bib152" workType="Journal" published="yes"><workauthor>Bonfield, J. K.; Smith, K. und Staden, R.</workauthor> (<pubdate>1995</pubdate>): <articletitle>A new DNA sequence assembly program</articletitle>, <worktitle>Nucleic Acids Res.</worktitle> <volume>23</volume> [<number>24</number>], Page <pages>4992</pages>-<pages>4999</pages>. URL: <url type="URL" href="PM:8559656">PM:8559656</url> </citation>
<citation id="_bib148" workType="Journal" published="yes"><workauthor>Bostwick, D. G.; Qian, J.; Pacelli, A.; Zincke, H.; Blute, M.; Bergstralh, E. J.; Slezak, J. M. und Cheng, L.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Neuroendocrine expression in node positive prostate cancer: correlation with systemic progression and patient survival</articletitle>, <worktitle>J.Urol.</worktitle> <volume>168</volume> [<number>3</number>], Page <pages>1204</pages>-<pages>1211</pages>. URL: <url type="URL" href="PM:12187268">PM:12187268</url> </citation>
<citation id="_bib126" workType="Journal" published="yes"><workauthor>Bova, G. S.; Carter, B. S.; Bussemakers, M. J.; Emi, M.; Fujiwara, Y.; Kyprianou, N.; Jacobs, S. C.; Robinson, J. C.; Epstein, J. I.; Walsh, P. C. und .</workauthor> (<pubdate>1993</pubdate>): <articletitle>Homozygous deletion and frequent allelic loss of chromosome 8p22 loci in human prostate cancer</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>53</volume> [<number>17</number>], Page <pages>3869</pages>-<pages>3873</pages>. URL: <url type="URL" href="PM:7689419">PM:7689419</url> </citation>
<citation id="_bib123" workType="Journal" published="yes"><workauthor>Bova, G. S. und Isaacs, W. B.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Review of allelic loss and gain in prostate cancer</articletitle>, <worktitle>World J.Urol.</worktitle> <volume>14</volume> [<number>5</number>], Page <pages>338</pages>-<pages>346</pages>. URL: <url type="URL" href="PM:8912474">PM:8912474</url> </citation>
<citation id="_bib75" workType="Journal" published="yes"><workauthor>Caplan, A. und Kratz, A.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Prostate-specific antigen and the early diagnosis of prostate cancer</articletitle>, <worktitle>Am.J.Clin.Pathol.</worktitle> <volume>117 Suppl</volume>, Page <pages>S104</pages>-<pages>S108</pages>. URL: <url type="URL" href="PM:14569806">PM:14569806</url> </citation>
<citation id="_bib161" workType="Journal" published="yes"><workauthor>Carter, B. S.; Beaty, T. H.; Steinberg, G. D.; Childs, B. und Walsh, P. C.</workauthor> (<pubdate>1992</pubdate>): <articletitle>Mendelian inheritance of familial prostate cancer</articletitle>, <worktitle>Proc.Natl.Acad.Sci.U.S.A</worktitle> <volume>89</volume> [<number>8</number>], Page <pages>3367</pages>-<pages>3371</pages>. URL: <url type="URL" href="PM:1565627">PM:1565627</url> </citation>
<citation id="_bib46" workType="Journal" published="yes"><workauthor>Caterina, M. J.; Rosen, T. A.; Tominaga, M.; Brake, A. J. und Julius, D.</workauthor> (<pubdate>1999</pubdate>): <articletitle>A capsaicin-receptor homologue with a high threshold for noxious heat</articletitle>, <worktitle>Nature</worktitle> <volume>398</volume> [<number>6726</number>], Page <pages>436</pages>-<pages>441</pages>. URL: <url type="URL" href="PM:10201375">PM:10201375</url> </citation>
<citation id="_bib45" workType="Journal" published="yes"><workauthor>Caterina, M. J.; Schumacher, M. A.; Tominaga, M.; Rosen, T. A.; Levine, J. D. und Julius, D.</workauthor> (<pubdate>1997</pubdate>): <articletitle>The capsaicin receptor: a heat-activated ion channel in the pain pathway</articletitle>, <worktitle>Nature</worktitle> <volume>389</volume> [<number>6653</number>], Page <pages>816</pages>-<pages>824</pages>. URL: <url type="URL" href="PM:9349813">PM:9349813</url> </citation>
<citation id="_bib169" workType="Journal" published="yes"><workauthor>Chang, C. H.; Sharkey, R. M.; Rossi, E. A.; Karacay, H.; McBride, W.; Hansen, H. J.; Chatal, J. F.; Barbet, J. und Goldenberg, D. M.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Molecular advances in pretargeting radioimunotherapy with bispecific antibodies</articletitle>, <worktitle>Mol.Cancer Ther.</worktitle> <volume>1</volume> [<number>7</number>], Page <pages>553</pages>-<pages>563</pages>. URL: <url type="URL" href="PM:12479274">PM:12479274</url> </citation>
<citation id="_bib104" workType="Journal" published="yes"><workauthor>Charlet, B.; Logan, P.; Singh, G. und Cooper, T. A.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing</articletitle>, <worktitle>Mol.Cell</worktitle> <volume>9</volume> [<number>3</number>], Page <pages>649</pages>-<pages>658</pages>. URL: <url type="URL" href="PM:11931771">PM:11931771</url> </citation>
<citation id="_bib100" workType="Journal" published="yes"><workauthor>Chow, L. T.; Gelinas, R. E.; Broker, T. R. und Roberts, R. J.</workauthor> (<pubdate>1977</pubdate>): <articletitle>An amazing sequence arrangement at the 5' ends of adenovirus 2 messenger RNA</articletitle>, <worktitle>Cell</worktitle> <volume>12</volume> [<number>1</number>], Page <pages>1</pages>-<pages>8</pages>. URL: <url type="URL" href="PM:902310">PM:902310</url> </citation>
<citation id="_bib32" workType="Journal" published="yes"><workauthor>Chyb, S.; Raghu, P. und Hardie, R. C.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Polyunsaturated fatty acids activate the Drosophila light-sensitive channels TRP and TRPL</articletitle>, <worktitle>Nature</worktitle> <volume>397</volume> [<number>6716</number>], Page <pages>255</pages>-<pages>259</pages>. URL: <url type="URL" href="PM:9930700">PM:9930700</url> </citation>
<citation id="_bib39" workType="Journal" published="yes"><workauthor>Clapham, D. E.; Runnels, L. W. und Strubing, C.</workauthor> (<pubdate>2001</pubdate>): <articletitle>The TRP ion channel family</articletitle>, <worktitle>Nat.Rev.Neurosci.</worktitle> <volume>2</volume> [<number>6</number>], Page <pages>387</pages>-<pages>396</pages>. URL: <url type="URL" href="PM:11389472">PM:11389472</url> </citation>
<citation id="_bib86" workType="Journal" published="yes"><workauthor>Cleutjens, K. B.; van Eekelen, C. C.; van der Korput, H. A.; Brinkmann, A. O. und Trapman, J.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>271</volume> [<number>11</number>], Page <pages>6379</pages>-<pages>6388</pages>. URL: <url type="URL" href="PM:8626436">PM:8626436</url> </citation>
<citation id="_bib122" workType="Journal" published="yes"><workauthor>Debes, J. D. und Tindall, D. J.</workauthor> (<pubdate>2002</pubdate>): <articletitle>The role of androgens and the androgen receptor in prostate cancer</articletitle>, <worktitle>Cancer Lett.</worktitle> <volume>187</volume> [<number>1-2</number>], Page <pages>1</pages>-<pages>7</pages>. URL: <url type="URL" href="PM:12359344">PM:12359344</url> </citation>
<citation id="_bib40" workType="Journal" published="yes"><workauthor>den Dekker, E.; Hoenderop, J. G.; Nilius, B. und Bindels, R. J.</workauthor> (<pubdate>2003</pubdate>): <articletitle>The epithelial calcium channels, TRPV5 &amp; TRPV6: from identification towards regulation</articletitle>, <worktitle>Cell Calcium</worktitle> <volume>33</volume> [<number>5-6</number>], Page <pages>497</pages>-<pages>507</pages>. URL: <url type="URL" href="PM:12765695">PM:12765695</url> </citation>
<citation id="_bib63" workType="Journal" published="yes"><workauthor>Dhanasekaran, S. M.; Barrette, T. R.; Ghosh, D.; Shah, R.; Varambally, S.; Kurachi, K.; Pienta, K. J.; Rubin, M. A. und Chinnaiyan, A. M.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Delineation of prognostic biomarkers in prostate cancer</articletitle>, <worktitle>Nature</worktitle> <volume>412</volume> [<number>6849</number>], Page <pages>822</pages>-<pages>826</pages>. URL: <url type="URL" href="PM:11518967">PM:11518967</url> </citation>
<citation id="_bib22" workType="Journal" published="yes"><workauthor>Duncan, L. M.; Deeds, J.; Hunter, J.; Shao, J.; Holmgren, L. M.; Woolf, E. A.; Tepper, R. I. und Shyjan, A. W.</workauthor> (<pubdate>1998</pubdate>): <articletitle>Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>58</volume> [<number>7</number>], Page <pages>1515</pages>-<pages>1520</pages>. URL: <url type="URL" href="PM:9537257">PM:9537257</url> </citation>
<citation id="_bib12" workType="Journal" published="yes"><workauthor>Emerson, B. M.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Specificity of gene regulation</articletitle>, <worktitle>Cell</worktitle> <volume>109</volume> [<number>3</number>], Page <pages>267</pages>-<pages>270</pages>. URL: <url type="URL" href="PM:12015975">PM:12015975</url> </citation>
<citation id="_bib98" workType="Journal" published="yes"><workauthor>Faustino, N. A. und Cooper, T. A.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Pre-mRNA splicing and human disease</articletitle>, <worktitle>Genes Dev.</worktitle> <volume>17</volume> [<number>4</number>], Page <pages>419</pages>-<pages>437</pages>. URL: <url type="URL" href="PM:12600935">PM:12600935</url> </citation>
<citation id="_bib111" workType="Journal" published="yes"><workauthor>Fu, X. D.</workauthor> (<pubdate>1995</pubdate>): <articletitle>The superfamily of arginine/serine-rich splicing factors</articletitle>, <worktitle>RNA.</worktitle> <volume>1</volume> [<number>7</number>], Page <pages>663</pages>-<pages>680</pages>. URL: <url type="URL" href="PM:7585252">PM:7585252</url> </citation>
<citation id="_bib77" workType="Journal" published="yes"><workauthor>Gandini, O.; Luci, L.; Stigliano, A.; Lucera, R.; Di Silverio, F.; Toscano, V. und Cardillo, M. R.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Is DD3 a new prostate-specific gene?</articletitle>, <worktitle>Anticancer Res.</worktitle> <volume>23</volume> [<number>1A</number>], Page <pages>305</pages>-<pages>308</pages>. URL: <url type="URL" href="PM:12680228">PM:12680228</url> </citation>
<citation id="_bib60" workType="Journal" published="yes"><workauthor>Gleason, D. F. und Mellinger, G. T.</workauthor> (<pubdate>1974</pubdate>): <articletitle>Prediction of prognosis for prostatic adenocarcinoma by combined histological grading and clinical staging</articletitle>, <worktitle>J.Urol.</worktitle> <volume>111</volume> [<number>1</number>], Page <pages>58</pages>-<pages>64</pages>. URL: <url type="URL" href="PM:4813554">PM:4813554</url> </citation>
<citation id="_bib112" workType="Journal" published="yes"><workauthor>Graveley, B. R.</workauthor> (<pubdate>2000</pubdate>): <articletitle>Sorting out the complexity of SR protein functions</articletitle>, <worktitle>RNA.</worktitle> <volume>6</volume> [<number>9</number>], Page <pages>1197</pages>-<pages>1211</pages>. URL: <url type="URL" href="PM:10999598">PM:10999598</url> </citation>
<citation id="_bib147" workType="Journal" published="yes"><workauthor>Gregory, C. W.; Hamil, K. G.; Kim, D.; Hall, S. H.; Pretlow, T. G.; Mohler, J. L. und French, F. S.</workauthor> (<pubdate>1998</pubdate>): <articletitle>Androgen receptor expression in androgen-independent prostate cancer is associated with increased expression of androgen-regulated genes</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>58</volume> [<number>24</number>], Page <pages>5718</pages>-<pages>5724</pages>. URL: <url type="URL" href="PM:9865729">PM:9865729</url> </citation>
<citation id="_bib37" workType="Journal" published="yes"><workauthor>Grimm, C.; Kraft, R.; Sauerbruch, S.; Schultz, G. und Harteneck, C.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Molecular and functional characterization of the melastatin-related cation channel TRPM3</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>278</volume> [<number>24</number>], Page <pages>21493</pages>-<pages>21501</pages>. URL: <url type="URL" href="PM:12672799">PM:12672799</url> </citation>
<citation id="_bib171" workType="Journal" published="yes"><workauthor>Grynkiewicz, G.; Poenie, M. und Tsien, R. Y.</workauthor> (<pubdate>1985</pubdate>): <articletitle>A new generation of Ca2+ indicators with greatly improved fluorescence properties</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>260</volume> [<number>6</number>], Page <pages>3440</pages>-<pages>3450</pages>. URL: <url type="URL" href="PM:3838314">PM:3838314</url> </citation>
<citation id="_bib49" workType="Journal" published="yes"><workauthor>Guler, A. D.; Lee, H.; Iida, T.; Shimizu, I.; Tominaga, M. und Caterina, M.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Heat-evoked activation of the ion channel, TRPV4</articletitle>, <worktitle>J.Neurosci.</worktitle> <volume>22</volume> [<number>15</number>], Page <pages>6408</pages>-<pages>6414</pages>. URL: <url type="URL" href="PM:12151520">PM:12151520</url> </citation>
<citation id="_bib52" workType="Journal" published="yes"><workauthor>Hardie, R. C. und Minke, B.</workauthor> (<pubdate>1992</pubdate>): <articletitle>The trp gene is essential for a light-activated Ca2+ channel in Drosophila photoreceptors</articletitle>, <worktitle>Neuron</worktitle> <volume>8</volume> [<number>4</number>], Page <pages>643</pages>-<pages>651</pages>. URL: <url type="URL" href="PM:1314617">PM:1314617</url> </citation>
<citation id="_bib124" workType="Journal" published="yes"><workauthor>He, W. W.; Sciavolino, P. J.; Wing, J.; Augustus, M.; Hudson, P.; Meissner, P. S.; Curtis, R. T.; Shell, B. K.; Bostwick, D. G.; Tindall, D. J.; Gelmann, E. P.; Abate-Shen, C. und Carter, K. C.</workauthor> (<pubdate>1997</pubdate>): <articletitle>A novel human prostate-specific, androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer</articletitle>, <worktitle>Genomics</worktitle> <volume>43</volume> [<number>1</number>], Page <pages>69</pages>-<pages>77</pages>. URL: <url type="URL" href="PM:9226374">PM:9226374</url> </citation>
<citation id="_bib73" workType="Journal" published="yes"><workauthor>Henshall, S. M.; Afar, D. E.; Hiller, J.; Horvath, L. G.; Quinn, D. I.; Rasiah, K. K.; Gish, K.; Willhite, D.; Kench, J. G.; Gardiner-Garden, M.; Stricker, P. D.; Scher, H. I.; Grygiel, J. J.; Agus, D. B.; Mack, D. H. und Sutherland, R. L.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Survival analysis of genome-wide gene expression profiles of prostate cancers identifies new prognostic targets of disease relapse</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>63</volume> [<number>14</number>], Page <pages>4196</pages>-<pages>4203</pages>. URL: <url type="URL" href="PM:12874026">PM:12874026</url> </citation>
<citation id="_bib31" workType="Journal" published="yes"><workauthor>Hofmann, T.; Obukhov, A. G.; Schaefer, M.; Harteneck, C.; Gudermann, T. und Schultz, G.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol</articletitle>, <worktitle>Nature</worktitle> <volume>397</volume> [<number>6716</number>], Page <pages>259</pages>-<pages>263</pages>. URL: <url type="URL" href="PM:9930701">PM:9930701</url> </citation>
<citation id="_bib146" workType="Journal" published="yes"><workauthor>Howe, H. L.; Wingo, P. A.; Thun, M. J.; Ries, L. A.; Rosenberg, H. M.; Feigal, E. G. und Edwards, B. K.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Annual report to the nation on the status of cancer (1973 through 1998), featuring cancers with recent increasing trends</articletitle>, <worktitle>J.Natl.Cancer Inst.</worktitle> <volume>93</volume> [<number>11</number>], Page <pages>824</pages>-<pages>842</pages>. URL: <url type="URL" href="PM:11390532">PM:11390532</url> </citation>
<citation id="_bib121" workType="Journal" published="yes"><workauthor>Huang, H. und Tindall, D. J.</workauthor> (<pubdate>2002</pubdate>): <articletitle>The role of the androgen receptor in prostate cancer</articletitle>, <worktitle>Crit Rev.Eukaryot.Gene Expr.</worktitle> <volume>12</volume> [<number>3</number>], Page <pages>193</pages>-<pages>207</pages>. URL: <url type="URL" href="PM:12449343">PM:12449343</url> </citation>
<citation id="_bib144" workType="Book" published="yes"><workauthor>Hudson, P.</workauthor> (<pubdate>1981</pubdate>): <worktitle>Robust Statistics</worktitle>. </citation>
<citation id="_bib137" workType="Journal" published="yes"><workauthor>Huggins, C. und Hodges, C. V.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Studies on prostatic cancer. I. The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. 1941</articletitle>, <worktitle>J.Urol.</worktitle> <volume>167</volume> [<number>2 Pt 2</number>], Page <pages>948</pages>-<pages>951</pages>. URL: <url type="URL" href="PM:11905923">PM:11905923</url> </citation>
<citation id="_bib145" workType="Journal" published="yes"><workauthor>Jemal, A.; Murray, T.; Samuels, A.; Ghafoor, A.; Ward, E. und Thun, M. J.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Cancer statistics, 2003</articletitle>, <worktitle>CA Cancer J.Clin.</worktitle> <volume>53</volume> [<number>1</number>], Page <pages>5</pages>-<pages>26</pages>. URL: <url type="URL" href="PM:12568441">PM:12568441</url> </citation>
<citation id="_bib3" workType="Book" published="yes"><workauthor>Kieschke, J.; Lehnert, M.; Oberhausen, R.; Schmidtmann, I. und Schneider, D.</workauthor> (<pubdate>2002</pubdate>): <worktitle>Krebs in Deutschland- Häufigkeiten und Trends</worktitle>. URL: <url type="URL" href="http://www.rki.de/KREBS">http://www.rki.de/KREBS</url> </citation>
<citation id="_bib157" workType="Journal" published="yes"><workauthor>Kraft, R.; Grimm, C.; Grosse, K.; Hoffmann, A.; Sauerbruch, S.; Kettenmann, H.; Schultz, G. und Harteneck, C.</workauthor> (<pubdate>2004</pubdate>): <articletitle>Hydrogen peroxide and ADP-ribose induce TRPM2-mediated calcium influx and cation currents in microglia</articletitle>, <worktitle>Am.J.Physiol Cell Physiol</worktitle> <volume>286</volume> [<number>1</number>], Page <pages>C129</pages>-<pages>C137</pages>. URL: <url type="URL" href="PM:14512294">PM:14512294</url> </citation>
<citation id="_bib164" workType="Journal" published="yes"><workauthor>Kristal, A. R.; Cohen, J. H.; Qu, P. und Stanford, J. L.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Associations of energy, fat, calcium, and vitamin D with prostate cancer risk</articletitle>, <worktitle>Cancer Epidemiol.Biomarkers Prev.</worktitle> <volume>11</volume> [<number>8</number>], Page <pages>719</pages>-<pages>725</pages>. URL: <url type="URL" href="PM:12163324">PM:12163324</url> </citation>
<citation id="_bib101" workType="Journal" published="yes"><workauthor>Lander, E. S.; Linton, L. M.; Birren, B.; Nusbaum, C.; Zody, M. C.; Baldwin, J.; Devon, K.; Dewar, K.; Doyle, M.; FitzHugh, W.; Funke, R.; Gage, D.; Harris, K.; Heaford, A.; Howland, J.; Kann, L.; Lehoczky, J.; LeVine, R.; McEwan, P.; McKernan, K.; Meldrim, J.; Mesirov, J. P.; Miranda, C.; Morris, W.; Naylor, J.; Raymond, C.; Rosetti, M.; Santos, R.; Sheridan, A.; Sougnez, C.; Stange-Thomann, N.; Stojanovic, N.; Subramanian, A.; Wyman, D.; Rogers, J.; Sulston, J.; Ainscough, R.; Beck, S.; Bentley, D.; Burton, J.; Clee, C.; Carter, N.; Coulson, A.; Deadman, R.; Deloukas, P.; Dunham, A.; Dunham, I.; Durbin, R.; French, L.; Grafham, D.; Gregory, S.; Hubbard, T.; Humphray, S.; Hunt, A.; Jones, M.; Lloyd, C.; McMurray, A.; Matthews, L.; Mercer, S.; Milne, S.; Mullikin, J. C.; Mungall, A.; Plumb, R.; Ross, M.; Shownkeen, R.; Sims, S.; Waterston, R. H.; Wilson, R. K.; Hillier, L. W.; McPherson, J. D.; Marra, M. A.; Mardis, E. R.; Fulton, L. A.; Chinwalla, A. T.; Pepin, K. H.; Gish, W. R.; Chissoe, S. L.; Wendl, M. C.; Delehaunty, K. D.; Miner, T. L.; Delehaunty, A.; Kramer, J. B.; Cook, L. L.; Fulton, R. S.; Johnson, D. L.; Minx, P. J.; Clifton, S. W.; Hawkins, T.; Branscomb, E.; Predki, P.; Richardson, P.; Wenning, S.; Slezak, T.; Doggett, N.; Cheng, J. F.; Olsen, A.; Lucas, S.; Elkin, C.; Uberbacher, E.; Frazier, M.; Gibbs, R. A.; Muzny, D. M.; Scherer, S. E.; Bouck, J. B.; Sodergren, E. J.; Worley, K. C.; Rives, C. M.; Gorrell, J. H.; Metzker, M. L.; Naylor, S. L.; Kucherlapati, R. S.; Nelson, D. L.; Weinstock, G. M.; Sakaki, Y.; Fujiyama, A.; Hattori, M.; Yada, T.; Toyoda, A.; Itoh, T.; Kawagoe, C.; Watanabe, H.; Totoki, Y.; Taylor, T.; Weissenbach, J.; Heilig, R.; Saurin, W.; Artiguenave, F.; Brottier, P.; Bruls, T.; Pelletier, E.; Robert, C.; Wincker, P.; Smith, D. R.; Doucette-Stamm, L.; Rubenfield, M.; Weinstock, K.; Lee, H. M.; Dubois, J.; Rosenthal, A.; Platzer, M.; Nyakatura, G.; Taudien, S.; Rump, A.; Yang, H.; Yu, J.; Wang, J.; Huang, G.; Gu, J.; Hood, L.; Rowen, L.; Madan, A.; Qin, S.; Davis, R. W.; Federspiel, N. A.; Abola, A. P.; Proctor, M. J.; Myers, R. M.; Schmutz, J.; Dickson, M.; Grimwood, J.; Cox, D. R.; Olson, M. V.; Kaul, R.; Raymond, C.; Shimizu, N.; Kawasaki, K.; Minoshima, S.; Evans, G. A.; Athanasiou, M.; Schultz, R.; Roe, B. A.; Chen, F.; Pan, H.; Ramser, J.; Lehrach, H.; Reinhardt, R.; McCombie, W. R.; de la, Bastide M.; Dedhia, N.; Blocker, H.; Hornischer, K.; Nordsiek, G.; Agarwala, R.; Aravind, L.; Bailey, J. A.; Bateman, A.; Batzoglou, S.; Birney, E.; Bork, P.; Brown, D. G.; Burge, C. B.; Cerutti, L.; Chen, H. C.; Church, D.; Clamp, M.; Copley, R. R.; Doerks, T.; Eddy, S. R.; Eichler, E. E.; Furey, T. S.; Galagan, J.; Gilbert, J. G.; Harmon, C.; Hayashizaki, Y.; Haussler, D.; Hermjakob, H.; Hokamp, K.; Jang, W.; Johnson, L. S.; Jones, T. A.; Kasif, S.; Kaspryzk, A.; Kennedy, S.; Kent, W. J.; Kitts, P.; Koonin, E. V.; Korf, I.; Kulp, D.; Lancet, D.; Lowe, T. M.; McLysaght, A.; Mikkelsen, T.; Moran, J. V.; Mulder, N.; Pollara, V. J.; Ponting, C. P.; Schuler, G.; Schultz, J.; Slater, G.; Smit, A. F.; Stupka, E.; Szustakowski, J.; Thierry-Mieg, D.; Thierry-Mieg, J.; Wagner, L.; Wallis, J.; Wheeler, R.; Williams, A.; Wolf, Y. I.; Wolfe, K. H.; Yang, S. P.; Yeh, R. F.; Collins, F.; Guyer, M. S.; Peterson, J.; Felsenfeld, A.; Wetterstrand, K. A.; Patrinos, A.; Morgan, M. J.; Szustakowki, J.; de Jong, P.; Catanese, J. J.; Osoegawa, K.; Shizuya, H. und Choi, S.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Initial sequencing and analysis of the human genome</articletitle>, <worktitle>Nature</worktitle> <volume>409</volume> [<number>6822</number>], Page <pages>860</pages>-<pages>921</pages>. URL: <url type="URL" href="PM:11237011">PM:11237011</url> </citation>
<citation id="_bib138" workType="Journal" published="yes"><workauthor>Laufer, M.; Denmeade, S. R.; Sinibaldi, V. J.; Carducci, M. A. und Eisenberger, M. A.</workauthor> (<pubdate>2000</pubdate>): <articletitle>Complete androgen blockade for prostate cancer: what went wrong?</articletitle>, <worktitle>J.Urol.</worktitle> <volume>164</volume> [<number>1</number>], Page <pages>3</pages>-<pages>9</pages>. URL: <url type="URL" href="PM:10840412">PM:10840412</url> </citation>
<citation id="_bib25" workType="Journal" published="yes"><workauthor>Launay, P.; Fleig, A.; Perraud, A. L.; Scharenberg, A. M.; Penner, R. und Kinet, J. P.</workauthor> (<pubdate>2002</pubdate>): <articletitle>TRPM4 is a Ca2+-activated nonselective cation channel mediating cell membrane depolarization</articletitle>, <worktitle>Cell</worktitle> <volume>109</volume> [<number>3</number>], Page <pages>397</pages>-<pages>407</pages>. URL: <url type="URL" href="PM:12015988">PM:12015988</url> </citation>
<citation id="_bib119" workType="Journal" published="yes"><workauthor>Lee, H. J. und Chang, C.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Recent advances in androgen receptor action</articletitle>, <worktitle>Cell Mol.Life Sci.</worktitle> <volume>60</volume> [<number>8</number>], Page <pages>1613</pages>-<pages>1622</pages>. URL: <url type="URL" href="PM:14504652">PM:14504652</url> </citation>
<citation id="_bib153" workType="Journal" published="yes"><workauthor>Lichter, P.; Bentz, M. und Joos, S.</workauthor> (<pubdate>1995</pubdate>): <articletitle>Detection of chromosomal aberrations by means of molecular cytogenetics: painting of chromosomes and chromosomal subregions and comparative genomic hybridization</articletitle>, <worktitle>Methods Enzymol.</worktitle> <volume>254</volume>, Page <pages>334</pages>-<pages>359</pages>. URL: <url type="URL" href="PM:8531697">PM:8531697</url> </citation>
<citation id="_bib41" workType="Journal" published="yes"><workauthor>Lo, M. V. und Pak, W. L.</workauthor> (<pubdate>1981</pubdate>): <articletitle>Light-induced pigment granule migration in the retinular cells of Drosophila melanogaster. Comparison of wild type with ERG-defective mutants</articletitle>, <worktitle>J.Gen.Physiol</worktitle> <volume>77</volume> [<number>2</number>], Page <pages>155</pages>-<pages>175</pages>. URL: <url type="URL" href="PM:6790662">PM:6790662</url> </citation>
<citation id="_bib64" workType="Journal" published="yes"><workauthor>Luo, J.; Duggan, D. J.; Chen, Y.; Sauvageot, J.; Ewing, C. M.; Bittner, M. L.; Trent, J. M. und Isaacs, W. B.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>61</volume> [<number>12</number>], Page <pages>4683</pages>-<pages>4688</pages>. URL: <url type="URL" href="PM:11406537">PM:11406537</url> </citation>
<citation id="_bib143" workType="Journal" published="yes"><workauthor>Luo, L.; Salunga, R. C.; Guo, H.; Bittner, A.; Joy, K. C.; Galindo, J. E.; Xiao, H.; Rogers, K. E.; Wan, J. S.; Jackson, M. R. und Erlander, M. G.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Gene expression profiles of laser-captured adjacent neuronal subtypes</articletitle>, <worktitle>Nat.Med.</worktitle> <volume>5</volume> [<number>1</number>], Page <pages>117</pages>-<pages>122</pages>. URL: <url type="URL" href="PM:9883850">PM:9883850</url> </citation>
<citation id="_bib160" workType="Journal" published="yes"><workauthor>Macintosh, C. A.; Stower, M.; Reid, N. und Maitland, N. J.</workauthor> (<pubdate>1998</pubdate>): <articletitle>Precise microdissection of human prostate cancers reveals genotypic heterogeneity</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>58</volume> [<number>1</number>], Page <pages>23</pages>-<pages>28</pages>. URL: <url type="URL" href="PM:9426051">PM:9426051</url> </citation>
<citation id="_bib127" workType="Journal" published="yes"><workauthor>Macoska, J. A.; Trybus, T. M.; Benson, P. D.; Sakr, W. A.; Grignon, D. J.; Wojno, K. D.; Pietruk, T. und Powell, I. J.</workauthor> (<pubdate>1995</pubdate>): <articletitle>Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>55</volume> [<number>22</number>], Page <pages>5390</pages>-<pages>5395</pages>. URL: <url type="URL" href="PM:7585607">PM:7585607</url> </citation>
<citation id="_bib65" workType="Journal" published="yes"><workauthor>Magee, J. A.; Araki, T.; Patil, S.; Ehrig, T.; True, L.; Humphrey, P. A.; Catalona, W. J.; Watson, M. A. und Milbrandt, J.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Expression profiling reveals hepsin overexpression in prostate cancer</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>61</volume> [<number>15</number>], Page <pages>5692</pages>-<pages>5696</pages>. URL: <url type="URL" href="PM:11479199">PM:11479199</url> </citation>
<citation id="_bib9" workType="Journal" published="yes"><workauthor>McKemy, D. D.; Neuhausser, W. M. und Julius, D.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Identification of a cold receptor reveals a general role for TRP channels in thermosensation</articletitle>, <worktitle>Nature</worktitle> <volume>416</volume> [<number>6876</number>], Page <pages>52</pages>-<pages>58</pages>. URL: <url type="URL" href="PM:11882888">PM:11882888</url> </citation>
<citation id="_bib102" workType="Journal" published="yes"><workauthor>Mercatante, D. R. und Kole, R.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Control of alternative splicing by antisense oligonucleotides as a potential chemotherapy: effects on gene expression</articletitle>, <worktitle>Biochim.Biophys.Acta</worktitle> <volume>1587</volume> [<number>2-3</number>], Page <pages>126</pages>-<pages>132</pages>. URL: <url type="URL" href="PM:12084454">PM:12084454</url> </citation>
<citation id="_bib103" workType="Journal" published="yes"><workauthor>Modrek, B. und Lee, C.</workauthor> (<pubdate>2002</pubdate>): <articletitle>A genomic view of alternative splicing</articletitle>, <worktitle>Nat.Genet.</worktitle> <volume>30</volume> [<number>1</number>], Page <pages>13</pages>-<pages>19</pages>. URL: <url type="URL" href="PM:11753382">PM:11753382</url> </citation>
<citation id="_bib53" workType="Journal" published="yes"><workauthor>Montell, C.</workauthor> (<pubdate>1997</pubdate>): <articletitle>New light on TRP and TRPL</articletitle>, <worktitle>Mol.Pharmacol.</worktitle> <volume>52</volume> [<number>5</number>], Page <pages>755</pages>-<pages>763</pages>. URL: <url type="URL" href="PM:9351965">PM:9351965</url> </citation>
<citation id="_bib33" workType="Journal" published="yes"><workauthor>Montell, C.; Birnbaumer, L. und Flockerzi, V.</workauthor> (<pubdate>2002</pubdate>): <articletitle>The TRP channels, a remarkably functional family</articletitle>, <worktitle>Cell</worktitle> <volume>108</volume> [<number>5</number>], Page <pages>595</pages>-<pages>598</pages>. URL: <url type="URL" href="PM:11893331">PM:11893331</url> </citation>
<citation id="_bib149" workType="Journal" published="yes"><workauthor>Nakada, S. Y.; di Sant'Agnese, P. A.; Moynes, R. A.; Hiipakka, R. A.; Liao, S.; Cockett, A. T. und Abrahamsson, P. A.</workauthor> (<pubdate>1993</pubdate>): <articletitle>The androgen receptor status of neuroendocrine cells in human benign and malignant prostatic tissue</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>53</volume> [<number>9</number>], Page <pages>1967</pages>-<pages>1970</pages>. URL: <url type="URL" href="PM:8481896">PM:8481896</url> </citation>
<citation id="_bib11" workType="Journal" published="yes"><workauthor>Nilius, B.</workauthor> (<pubdate>2003</pubdate>): <articletitle>From TRPs to SOCs, CCEs, and CRACs: consensus and controversies</articletitle>, <worktitle>Cell Calcium</worktitle> <volume>33</volume> [<number>5-6</number>], Page <pages>293</pages>-<pages>298</pages>. URL: <url type="URL" href="PM:12765675">PM:12765675</url> </citation>
<citation id="_bib38" workType="Journal" published="yes"><workauthor>Nilius, B.; Prenen, J.; Droogmans, G.; Voets, T.; Vennekens, R.; Freichel, M.; Wissenbach, U. und Flockerzi, V.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Voltage dependence of the Ca2+-activated cation channel TRPM4</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>278</volume> [<number>33</number>], Page <pages>30813</pages>-<pages>30820</pages>. URL: <url type="URL" href="PM:12799367">PM:12799367</url> </citation>
<citation id="_bib106" workType="Journal" published="yes"><workauthor>Nissim-Rafinia, M. und Kerem, B.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Splicing regulation as a potential genetic modifier</articletitle>, <worktitle>Trends Genet.</worktitle> <volume>18</volume> [<number>3</number>], Page <pages>123</pages>-<pages>127</pages>. URL: <url type="URL" href="PM:11858835">PM:11858835</url> </citation>
<citation id="_bib168" workType="Journal" published="yes"><workauthor>Nowell, P. C.</workauthor> (<pubdate>1997</pubdate>): <articletitle>Genetic alterations in leukemias and lymphomas: impressive progress and continuing complexity</articletitle>, <worktitle>Cancer Genet.Cytogenet.</worktitle> <volume>94</volume> [<number>1</number>], Page <pages>13</pages>-<pages>19</pages>. URL: <url type="URL" href="PM:9078286">PM:9078286</url> </citation>
<citation id="_bib133" workType="Journal" published="yes"><workauthor>Nunes, F. D.; de Almeida, F. C.; Tucci, R. und de Sousa, S. C.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Homeobox genes: a molecular link between development and cancer</articletitle>, <worktitle>Pesqui.Odontol.Bras.</worktitle> <volume>17</volume> [<number>1</number>], Page <pages>94</pages>-<pages>98</pages>. URL: <url type="URL" href="PM:12908068">PM:12908068</url> </citation>
<citation id="_bib10" workType="Journal" published="yes"><workauthor>Peier, A. M.; Moqrich, A.; Hergarden, A. C.; Reeve, A. J.; Andersson, D. A.; Story, G. M.; Earley, T. J.; Dragoni, I.; McIntyre, P.; Bevan, S. und Patapoutian, A.</workauthor> (<pubdate>2002</pubdate>): <articletitle>A TRP channel that senses cold stimuli and menthol</articletitle>, <worktitle>Cell</worktitle> <volume>108</volume> [<number>5</number>], Page <pages>705</pages>-<pages>715</pages>. URL: <url type="URL" href="PM:11893340">PM:11893340</url> </citation>
<citation id="_bib159" workType="Journal" published="yes"><workauthor>Perez, C. A.; Huang, L.; Rong, M.; Kozak, J. A.; Preuss, A. K.; Zhang, H.; Max, M. und Margolskee, R. F.</workauthor> (<pubdate>2002</pubdate>): <articletitle>A transient receptor potential channel expressed in taste receptor cells</articletitle>, <worktitle>Nat.Neurosci.</worktitle> <volume>5</volume> [<number>11</number>], Page <pages>1169</pages>-<pages>1176</pages>. URL: <url type="URL" href="PM:12368808">PM:12368808</url> </citation>
<citation id="_bib24" workType="Journal" published="yes"><workauthor>Perraud, A. L.; Fleig, A.; Dunn, C. A.; Bagley, L. A.; Launay, P.; Schmitz, C.; Stokes, A. J.; Zhu, Q.; Bessman, M. J.; Penner, R.; Kinet, J. P. und Scharenberg, A. M.</workauthor> (<pubdate>2001</pubdate>): <articletitle>ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology</articletitle>, <worktitle>Nature</worktitle> <volume>411</volume> [<number>6837</number>], Page <pages>595</pages>-<pages>599</pages>. URL: <url type="URL" href="PM:11385575">PM:11385575</url> </citation>
<citation id="_bib117" workType="Journal" published="yes"><workauthor>Philips, A. V. und Cooper, T. A.</workauthor> (<pubdate>2000</pubdate>): <articletitle>RNA processing and human disease</articletitle>, <worktitle>Cell Mol.Life Sci.</worktitle> <volume>57</volume> [<number>2</number>], Page <pages>235</pages>-<pages>249</pages>. URL: <url type="URL" href="PM:10766020">PM:10766020</url> </citation>
<citation id="_bib71" workType="Misc" published="yes"><workauthor>Pilarsky, C., Kristiansen, G., Wissmann, C., Kaiser, S., Bruemmendorf, T., Roepke, S., Hoffmann, P., Staub, E., Dahl, E., Hinzmann, B., Specht, T., Stephan, C., Jung, K., Loening, S., Bellach, J., Dietel, M., and Rosenthal, A.</workauthor> (<pubdate>2003</pubdate>): <worktitle>	Expression Profiling of Microdissected matched Prostate Cancer Samples Reveals New Prognostic Markers for Patient Survival</worktitle></citation>
<citation id="_bib23" workType="Journal" published="yes"><workauthor>Prawitt, D.; Enklaar, T.; Klemm, G.; Gartner, B.; Spangenberg, C.; Winterpacht, A.; Higgins, M.; Pelletier, J. und Zabel, B.</workauthor> (<pubdate>2000</pubdate>): <articletitle>Identification and characterization of MTR1, a novel gene with homology to melastatin (MLSN1) and the trp gene family located in the BWS-WT2 critical region on chromosome 11p15.5 and showing allele-specific expression</articletitle>, <worktitle>Hum.Mol.Genet.</worktitle> <volume>9</volume> [<number>2</number>], Page <pages>203</pages>-<pages>216</pages>. URL: <url type="URL" href="PM:10607831">PM:10607831</url> </citation>
<citation id="_bib29" workType="Journal" published="yes"><workauthor>Putney, J. W., Jr.</workauthor> (<pubdate>1997</pubdate>): <articletitle>Type 3 inositol 1,4,5-trisphosphate receptor and capacitative calcium entry</articletitle>, <worktitle>Cell Calcium</worktitle> <volume>21</volume> [<number>3</number>], Page <pages>257</pages>-<pages>261</pages>. URL: <url type="URL" href="PM:9105735">PM:9105735</url> </citation>
<citation id="_bib28" workType="Journal" published="yes"><workauthor>Putney, J. W., Jr. und McKay, R. R.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Capacitative calcium entry channels</articletitle>, <worktitle>Bioessays</worktitle> <volume>21</volume> [<number>1</number>], Page <pages>38</pages>-<pages>46</pages>. URL: <url type="URL" href="PM:10070252">PM:10070252</url> </citation>
<citation id="_bib58" workType="Journal" published="yes"><workauthor>Quandt, K.; Frech, K.; Karas, H.; Wingender, E. und Werner, T.</workauthor> (<pubdate>1995</pubdate>): <articletitle>MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data</articletitle>, <worktitle>Nucleic Acids Res.</worktitle> <volume>23</volume> [<number>23</number>], Page <pages>4878</pages>-<pages>4884</pages>. URL: <url type="URL" href="PM:8532532">PM:8532532</url> </citation>
<citation id="_bib70" workType="Journal" published="yes"><workauthor>Rhodes, D. R.; Barrette, T. R.; Rubin, M. A.; Ghosh, D. und Chinnaiyan, A. M.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Meta-analysis of microarrays: interstudy validation of gene expression profiles reveals pathway dysregulation in prostate cancer</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>62</volume> [<number>15</number>], Page <pages>4427</pages>-<pages>4433</pages>. URL: <url type="URL" href="PM:12154050">PM:12154050</url> </citation>
<citation id="_bib85" workType="Journal" published="yes"><workauthor>Riegman, P. H.; Vlietstra, R. J.; van der Korput, J. A.; Brinkmann, A. O. und Trapman, J.</workauthor> (<pubdate>1991</pubdate>): <articletitle>The promoter of the prostate-specific antigen gene contains a functional androgen responsive element</articletitle>, <worktitle>Mol.Endocrinol.</worktitle> <volume>5</volume> [<number>12</number>], Page <pages>1921</pages>-<pages>1930</pages>. URL: <url type="URL" href="PM:1724287">PM:1724287</url> </citation>
<citation id="_bib26" workType="Journal" published="yes"><workauthor>Runnels, L. W.; Yue, L. und Clapham, D. E.</workauthor> (<pubdate>2001</pubdate>): <articletitle>TRP-PLIK, a bifunctional protein with kinase and ion channel activities</articletitle>, <worktitle>Science</worktitle> <volume>291</volume> [<number>5506</number>], Page <pages>1043</pages>-<pages>1047</pages>. URL: <url type="URL" href="PM:11161216">PM:11161216</url> </citation>
<citation id="_bib141" workType="Journal" published="yes"><workauthor>Sadar, M. D.; Hussain, M. und Bruchovsky, N.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Prostate cancer: molecular biology of early progression to androgen independence</articletitle>, <worktitle>Endocr.Relat Cancer</worktitle> <volume>6</volume> [<number>4</number>], Page <pages>487</pages>-<pages>502</pages>. URL: <url type="URL" href="PM:10730903">PM:10730903</url> </citation>
<citation id="_bib151" workType="Journal" published="yes"><workauthor>Sanger, F.; Nicklen, S. und Coulson, A. R.</workauthor> (<pubdate>1977</pubdate>): <articletitle>DNA sequencing with chain-terminating inhibitors</articletitle>, <worktitle>Proc.Natl.Acad.Sci.U.S.A</worktitle> <volume>74</volume> [<number>12</number>], Page <pages>5463</pages>-<pages>5467</pages>. URL: <url type="URL" href="PM:271968">PM:271968</url> </citation>
<citation id="_bib88" workType="Journal" published="yes"><workauthor>Sauvageot, J. und Epstein, J. I.</workauthor> (<pubdate>1998</pubdate>): <articletitle>Immunoreactivity for prostate-specific antigen and prostatic acid phosphatase in adenocarcinoma of the prostate: relation to progression following radical prostatectomy</articletitle>, <worktitle>Prostate</worktitle> <volume>34</volume> [<number>1</number>], Page <pages>29</pages>-<pages>33</pages>. URL: <url type="URL" href="PM:9428385">PM:9428385</url> </citation>
<citation id="_bib154" workType="Journal" published="yes"><workauthor>Schaefer, M.; Plant, T. D.; Stresow, N.; Albrecht, N. und Schultz, G.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Functional differences between TRPC4 splice variants</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>277</volume> [<number>5</number>], Page <pages>3752</pages>-<pages>3759</pages>. URL: <url type="URL" href="PM:11713258">PM:11713258</url> </citation>
<citation id="_bib61" workType="Journal" published="yes"><workauthor>Schena, M.; Shalon, D.; Davis, R. W. und Brown, P. O.</workauthor> (<pubdate>1995</pubdate>): <articletitle>Quantitative monitoring of gene expression patterns with a complementary DNA microarray</articletitle>, <worktitle>Science</worktitle> <volume>270</volume> [<number>5235</number>], Page <pages>467</pages>-<pages>470</pages>. URL: <url type="URL" href="PM:7569999">PM:7569999</url> </citation>
<citation id="_bib27" workType="Journal" published="yes"><workauthor>Schlingmann, K. P.; Weber, S.; Peters, M.; Niemann, Nejsum L.; Vitzthum, H.; Klingel, K.; Kratz, M.; Haddad, E.; Ristoff, E.; Dinour, D.; Syrrou, M.; Nielsen, S.; Sassen, M.; Waldegger, S.; Seyberth, H. W. und Konrad, M.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family</articletitle>, <worktitle>Nat.Genet.</worktitle> <volume>31</volume> [<number>2</number>], Page <pages>166</pages>-<pages>170</pages>. URL: <url type="URL" href="PM:12032568">PM:12032568</url> </citation>
<citation id="_bib8" workType="Journal" published="yes"><workauthor>Schmitt, A. O.; Specht, T.; Beckmann, G.; Dahl, E.; Pilarsky, C. P.; Hinzmann, B. und Rosenthal, A.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Exhaustive mining of EST libraries for genes differentially expressed in normal and tumour tissues</articletitle>, <worktitle>Nucleic Acids Res.</worktitle> <volume>27</volume> [<number>21</number>], Page <pages>4251</pages>-<pages>4260</pages>. URL: <url type="URL" href="PM:10518618">PM:10518618</url> </citation>
<citation id="_bib166" workType="Journal" published="yes"><workauthor>Seemann, G.; Bosslet, K. und Sedlacek, H. H.</workauthor> (<pubdate>1990</pubdate>): <articletitle>Recombinant monoclonal antibodies in tumor therapy</articletitle>, <worktitle>Behring Inst.Mitt.</worktitle> [<number>87</number>], Page <pages>33</pages>-<pages>47</pages>. URL: <url type="URL" href="PM:2096819">PM:2096819</url> </citation>
<citation id="_bib134" workType="Journal" published="yes"><workauthor>Silberstein, G. B.; Dressler, G. R. und Van Horn, K.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Expression of the PAX2 oncogene in human breast cancer and its role in progesterone-dependent mammary growth</articletitle>, <worktitle>Oncogene</worktitle> <volume>21</volume> [<number>7</number>], Page <pages>1009</pages>-<pages>1016</pages>. URL: <url type="URL" href="PM:11850818">PM:11850818</url> </citation>
<citation id="_bib150" workType="Journal" published="yes"><workauthor>Singh, D.; Febbo, P. G.; Ross, K.; Jackson, D. G.; Manola, J.; Ladd, C.; Tamayo, P.; Renshaw, A. A.; D'Amico, A. V.; Richie, J. P.; Lander, E. S.; Loda, M.; Kantoff, P. W.; Golub, T. R. und Sellers, W. R.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Gene expression correlates of clinical prostate cancer behavior</articletitle>, <worktitle>Cancer Cell</worktitle> <volume>1</volume> [<number>2</number>], Page <pages>203</pages>-<pages>209</pages>. URL: <url type="URL" href="PM:12086878">PM:12086878</url> </citation>
<citation id="_bib48" workType="Journal" published="yes"><workauthor>Smith, G. D.; Gunthorpe, M. J.; Kelsell, R. E.; Hayes, P. D.; Reilly, P.; Facer, P.; Wright, J. E.; Jerman, J. C.; Walhin, J. P.; Ooi, L.; Egerton, J.; Charles, K. J.; Smart, D.; Randall, A. D.; Anand, P. und Davis, J. B.</workauthor> (<pubdate>2002</pubdate>): <articletitle>TRPV3 is a temperature-sensitive vanilloid receptor-like protein</articletitle>, <worktitle>Nature</worktitle> <volume>418</volume> [<number>6894</number>], Page <pages>186</pages>-<pages>190</pages>. URL: <url type="URL" href="PM:12077606">PM:12077606</url> </citation>
<citation id="_bib162" workType="Journal" published="yes"><workauthor>Smith, J. R.; Freije, D.; Carpten, J. D.; Gronberg, H.; Xu, J.; Isaacs, S. D.; Brownstein, M. J.; Bova, G. S.; Guo, H.; Bujnovszky, P.; Nusskern, D. R.; Damber, J. E.; Bergh, A.; Emanuelsson, M.; Kallioniemi, O. P.; Walker-Daniels, J.; Bailey-Wilson, J. E.; Beaty, T. H.; Meyers, D. A.; Walsh, P. C.; Collins, F. S.; Trent, J. M. und Isaacs, W. B.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Major susceptibility locus for prostate cancer on chromosome 1 suggested by a genome-wide search</articletitle>, <worktitle>Science</worktitle> <volume>274</volume> [<number>5291</number>], Page <pages>1371</pages>-<pages>1374</pages>. URL: <url type="URL" href="PM:8910276">PM:8910276</url> </citation>
<citation id="_bib118" workType="Journal" published="yes"><workauthor>So, A. I.; Hurtado-Coll, A. und Gleave, M. E.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Androgens and prostate cancer</articletitle>, <worktitle>World J.Urol.</worktitle>. URL: <url type="URL" href="PM:14586548">PM:14586548</url> </citation>
<citation id="_bib131" workType="Journal" published="yes"><workauthor>Steadman, D. J.; Giuffrida, D. und Gelmann, E. P.</workauthor> (<pubdate>2000</pubdate>): <articletitle>DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1</articletitle>, <worktitle>Nucleic Acids Res.</worktitle> <volume>28</volume> [<number>12</number>], Page <pages>2389</pages>-<pages>2395</pages>. URL: <url type="URL" href="PM:10871372">PM:10871372</url> </citation>
<citation id="_bib109" workType="Journal" published="yes"><workauthor>Stickeler, E.; Kittrell, F.; Medina, D. und Berget, S. M.</workauthor> (<pubdate>1999</pubdate>): <articletitle>Stage-specific changes in SR splicing factors and alternative splicing in mammary tumorigenesis</articletitle>, <worktitle>Oncogene</worktitle> <volume>18</volume> [<number>24</number>], Page <pages>3574</pages>-<pages>3582</pages>. URL: <url type="URL" href="PM:10380879">PM:10380879</url> </citation>
<citation id="_bib167" workType="Journal" published="yes"><workauthor>Stockwin, L. und Holmes, S.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Antibodies as therapeutic agents: vive la renaissance!</articletitle>, <worktitle>Expert.Opin.Biol.Ther.</worktitle> <volume>3</volume> [<number>7</number>], Page <pages>1133</pages>-<pages>1152</pages>. URL: <url type="URL" href="PM:14519077">PM:14519077</url> </citation>
<citation id="_bib51" workType="Journal" published="yes"><workauthor>Story, G. M.; Peier, A. M.; Reeve, A. J.; Eid, S. R.; Mosbacher, J.; Hricik, T. R.; Earley, T. J.; Hergarden, A. C.; Andersson, D. A.; Hwang, S. W.; McIntyre, P.; Jegla, T.; Bevan, S. und Patapoutian, A.</workauthor> (<pubdate>2003</pubdate>): <articletitle>ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures</articletitle>, <worktitle>Cell</worktitle> <volume>112</volume> [<number>6</number>], Page <pages>819</pages>-<pages>829</pages>. URL: <url type="URL" href="PM:12654248">PM:12654248</url> </citation>
<citation id="_bib156" workType="Journal" published="yes"><workauthor>Strubing, C.; Krapivinsky, G.; Krapivinsky, L. und Clapham, D. E.</workauthor> (<pubdate>2001</pubdate>): <articletitle>TRPC1 and TRPC5 form a novel cation channel in mammalian brain</articletitle>, <worktitle>Neuron</worktitle> <volume>29</volume> [<number>3</number>], Page <pages>645</pages>-<pages>655</pages>. URL: <url type="URL" href="PM:11301024">PM:11301024</url> </citation>
<citation id="_bib120" workType="Journal" published="yes"><workauthor>Suzuki, H.; Ueda, T.; Ichikawa, T. und Ito, H.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Androgen receptor involvement in the progression of prostate cancer</articletitle>, <worktitle>Endocr.Relat Cancer</worktitle> <volume>10</volume> [<number>2</number>], Page <pages>209</pages>-<pages>216</pages>. URL: <url type="URL" href="PM:12790784">PM:12790784</url> </citation>
<citation id="_bib44" workType="Journal" published="yes"><workauthor>Tsavaler, L.; Shapero, M. H.; Morkowski, S. und Laus, R.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Trp-p8, a novel prostate-specific gene, is up-regulated in prostate cancer and other malignancies and shares high homology with transient receptor potential calcium channel proteins</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>61</volume> [<number>9</number>], Page <pages>3760</pages>-<pages>3769</pages>. URL: <url type="URL" href="PM:11325849">PM:11325849</url> </citation>
<citation id="_bib128" workType="Journal" published="yes"><workauthor>Vocke, C. D.; Pozzatti, R. O.; Bostwick, D. G.; Florence, C. D.; Jennings, S. B.; Strup, S. E.; Duray, P. H.; Liotta, L. A.; Emmert-Buck, M. R. und Linehan, W. M.</workauthor> (<pubdate>1996</pubdate>): <articletitle>Analysis of 99 microdissected prostate carcinomas reveals a high frequency of allelic loss on chromosome 8p12-21</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>56</volume> [<number>10</number>], Page <pages>2411</pages>-<pages>2416</pages>. URL: <url type="URL" href="PM:8625320">PM:8625320</url> </citation>
<citation id="_bib165" workType="Journal" published="yes"><workauthor>von Bubnoff, N.; Veach, D. R.; Miller, W. T.; Li, W.; Sanger, J.; Peschel, C.; Bornmann, W. G.; Clarkson, B. und Duyster, J.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Inhibition of wild-type and mutant Bcr-Abl by pyrido-pyrimidine-type small molecule kinase inhibitors</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>63</volume> [<number>19</number>], Page <pages>6395</pages>-<pages>6404</pages>. URL: <url type="URL" href="PM:14559829">PM:14559829</url> </citation>
<citation id="_bib43" workType="Journal" published="yes"><workauthor>Walder, R. Y.; Landau, D.; Meyer, P.; Shalev, H.; Tsolia, M.; Borochowitz, Z.; Boettger, M. B.; Beck, G. E.; Englehardt, R. K.; Carmi, R. und Sheffield, V. C.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia</articletitle>, <worktitle>Nat.Genet.</worktitle> <volume>31</volume> [<number>2</number>], Page <pages>171</pages>-<pages>174</pages>. URL: <url type="URL" href="PM:12032570">PM:12032570</url> </citation>
<citation id="_bib136" workType="Misc" published="yes"><workauthor>Warren D.W. and Heston</workauthor> : <worktitle>PSMA Promoter/Enhancer: Tools for Potential Gene Therapy Approaches</worktitle>. URL: <url type="URL" href="http://www.clevelandclinic.org/urology/news/lab/vol8u.htm">http://www.clevelandclinic.org/urology/news/lab/vol8u.htm</url> </citation>
<citation id="_bib158" workType="Journal" published="yes"><workauthor>Wehage, E.; Eisfeld, J.; Heiner, I.; Jungling, E.; Zitt, C. und Luckhoff, A.</workauthor> (<pubdate>2002</pubdate>): <articletitle>Activation of the cation channel long transient receptor potential channel 2 (LTRPC2) by hydrogen peroxide. A splice variant reveals a mode of activation independent of ADP-ribose</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>277</volume> [<number>26</number>], Page <pages>23150</pages>-<pages>23156</pages>. URL: <url type="URL" href="PM:11960981">PM:11960981</url> </citation>
<citation id="_bib66" workType="Journal" published="yes"><workauthor>Welsh, J. B.; Sapinoso, L. M.; Su, A. I.; Kern, S. G.; Wang-Rodriguez, J.; Moskaluk, C. A.; Frierson, H. F., Jr. und Hampton, G. M.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Analysis of gene expression identifies candidate markers and pharmacological targets in prostate cancer</articletitle>, <worktitle>Cancer Res.</worktitle> <volume>61</volume> [<number>16</number>], Page <pages>5974</pages>-<pages>5978</pages>. URL: <url type="URL" href="PM:11507037">PM:11507037</url> </citation>
<citation id="_bib13" workType="Journal" published="yes"><workauthor>Werner, T.; Fessele, S.; Maier, H. und Nelson, P. J.</workauthor> (<pubdate>2003</pubdate>): <articletitle>Computer modeling of promoter organization as a tool to study transcriptional coregulation</articletitle>, <worktitle>FASEB J.</worktitle> <volume>17</volume> [<number>10</number>], Page <pages>1228</pages>-<pages>1237</pages>. URL: <url type="URL" href="PM:12832287">PM:12832287</url> </citation>
<citation id="_bib170" workType="Misc" published="yes"><workauthor>Wilcoxon, F </workauthor>(<pubdate>1945</pubdate>):</citation>
<citation id="_bib72" workType="Misc" published="yes"><workauthor>Wissmann, C.</workauthor> (<pubdate>2002</pubdate>): <worktitle>Identifizierung differentiell exprimierter Gene in Tumoren der Prostata und Harnblase</worktitle>, <publisher>metaGen</publisher>. </citation>
<citation id="_bib47" workType="Journal" published="yes"><workauthor>Xu, H.; Ramsey, I. S.; Kotecha, S. A.; Moran, M. M.; Chong, J. A.; Lawson, D.; Ge, P.; Lilly, J.; Silos-Santiago, I.; Xie, Y.; DiStefano, P. S.; Curtis, R. und Clapham, D. E.</workauthor> (<pubdate>2002</pubdate>): <articletitle>TRPV3 is a calcium-permeable temperature-sensitive cation channel</articletitle>, <worktitle>Nature</worktitle> <volume>418</volume> [<number>6894</number>], Page <pages>181</pages>-<pages>186</pages>. URL: <url type="URL" href="PM:12077604">PM:12077604</url> </citation>
<citation id="_bib163" workType="Journal" published="yes"><workauthor>Xu, J.; Meyers, D.; Freije, D.; Isaacs, S.; Wiley, K.; Nusskern, D.; Ewing, C.; Wilkens, E.; Bujnovszky, P.; Bova, G. S.; Walsh, P.; Isaacs, W.; Schleutker, J.; Matikainen, M.; Tammela, T.; Visakorpi, T.; Kallioniemi, O. P.; Berry, R.; Schaid, D.; French, A.; McDonnell, S.; Schroeder, J.; Blute, M.; Thibodeau, S.; Trent, J. und .</workauthor> (<pubdate>1998</pubdate>): <articletitle>Evidence for a prostate cancer susceptibility locus on the X chromosome</articletitle>, <worktitle>Nat.Genet.</worktitle> <volume>20</volume> [<number>2</number>], Page <pages>175</pages>-<pages>179</pages>. URL: <url type="URL" href="PM:9771711">PM:9771711</url> </citation>
<citation id="_bib21" workType="Journal" published="yes"><workauthor>Xu, X. Z.; Moebius, F.; Gill, D. L. und Montell, C.</workauthor> (<pubdate>2001</pubdate>): <articletitle>Regulation of melastatin, a TRP-related protein, through interaction with a cytoplasmic isoform</articletitle>, <worktitle>Proc.Natl.Acad.Sci.U.S.A</worktitle> <volume>98</volume> [<number>19</number>], Page <pages>10692</pages>-<pages>10697</pages>. URL: <url type="URL" href="PM:11535825">PM:11535825</url> </citation>
<citation id="_bib110" workType="Journal" published="yes"><workauthor>Zahler, A. M.; Lane, W. S.; Stolk, J. A. und Roth, M. B.</workauthor> (<pubdate>1992</pubdate>): <articletitle>SR proteins: a conserved family of pre-mRNA splicing factors</articletitle>, <worktitle>Genes Dev.</worktitle> <volume>6</volume> [<number>5</number>], Page <pages>837</pages>-<pages>847</pages>. URL: <url type="URL" href="PM:1577277">PM:1577277</url> </citation>
<citation id="_bib35" workType="Journal" published="yes"><workauthor>Zhang, W.; Chu, X.; Tong, Q.; Cheung, J. Y.; Conrad, K.; Masker, K. und Miller, B. A.</workauthor> (<pubdate>2003</pubdate>): <articletitle>A novel TRPM2 isoform inhibits calcium influx and susceptibility to cell death</articletitle>, <worktitle>J.Biol.Chem.</worktitle> <volume>278</volume> [<number>18</number>], Page <pages>16222</pages>-<pages>16229</pages>. URL: <url type="URL" href="PM:12594222">PM:12594222</url> </citation>


		</bibliography>
		
      <abbreviation>
         <head>
            <pagenumber numbering="lroman" start="4"/>Abbreviations</head>
         <p>
            <table orient="port" frame="none" tocentry="1">
               <tgroup cols="2" align="left" charoff="50" char="">
                  <colspec colnum="1" colname="1"/>
                  <colspec colnum="2" colname="2"/>
                  <tbody valign="top">
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>A</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ACCP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>acidic phosphatase prostate</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>AR</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>androgen receptor</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ARE element</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>androgen responsive </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>aRNA</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>amplified RNA</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ARNT</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>aryl hydrocarbon receptor nuclear translocator</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ATCC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>American Type Culture Collection</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>B</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>BAC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <url href="http://www.google.de/url?sa=U&amp;start=1&amp;q=http://www.ornl.gov/meetings/bacpac/&amp;e=7629" type="URL">bacteria artificial chromosomes </url>
                           </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>BLAST</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>basic local alignment search tool</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>BPH</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>benign prostate hyperplasia</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>C</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>[Ca2+]i</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>cytosolic Ca2+ concentration</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>cRNA</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>copy RNA</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CCD</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>cooled chargecoupled device</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CCE</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>capacitive calcium entry</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CCS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>charcoal (treated) serum</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CFP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>cyan fluorescent protein</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CGH</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>comparative genomic hybridization</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>CHO</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>chinese hamster ovarian cells </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>D</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DABCO</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>1.4-diazobicyclo-(2.2.2)-octane</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DAG</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Diacylglycerol</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DAPI</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>4'.6-diamidino-2-phenylindole</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>d NTPs</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>2&#8217;-deoxynucleotide-5&#8217;-triphosphate</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DRE</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Digital Rectal Examination</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DRG</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Dorsal root ganglia</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>D</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>DSMZ</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (German Collection of Mi­croorganisms and Cell Cultures)</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p/>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <pagenumber numbering="lroman" start="5"/>E</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ER</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>endoplasmic reticulum</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>EST</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>expressed sequence tag</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Ev</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>empty vector</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>F</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>F</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Fluorescence</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FACS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fluorescence activated cells sorter</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FBS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fetal bovine serum</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FISH</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fluorecence in situ hybridzation</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FITC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fuoresceine Isothiocyanate</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FLIPR</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fluorescent Imaging Plate Reader </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Fp</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Flavoprotein</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>FRET</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>fluorescence resonance energy transport</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>G</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>GG</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Gleason Grading</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>GPCR</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>G-protein coupled receptor</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>GTC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>guanidine thiocyanate </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>H</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>H</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Hour</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>HGNC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <url href="http://www.gene.ucl.ac.uk/nomenclature/" type="URL">HUGO Gene Nomenclature Committee </url>
                           </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>HRP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>horse radish peroxidase </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Hs</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>homo sapiens</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>HTGS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>high throughput genome sequences</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>HUGO</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <url href="http://www.gene.ucl.ac.uk/hugo/" type="URL">human genome organisation</url>
                           </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>K</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>kD</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>kilo Dalton</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>M</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>MB</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>mega bases </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Mm</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>mus musculus</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>MYC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>v-myc myelocytomatosis viral oncogene homolog </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>N</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>NE</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Neuroendocrine</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>NFE2L1</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>nuclear factor (erythroid-derived 2)-like</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>NKX3-1</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>NK3 transcription factor related, locus 1 (Droso­phila)</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <pagenumber numbering="lroman" start="6"/>
                           </p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>O</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>ORF</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>open reading frame</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>P</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PAP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>prostatic acid phosphatase</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PBS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>phosphate buffered saline</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PE</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Phycoerithrin</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PIN</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>prostatic intraepithelial neoplasia </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PLC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Phospholipase C</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PMQ</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>perfect match quintile </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>PRX2</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>paired related homeobox protein 2</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>R</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Rn</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>rattus norvegicus</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>RP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>radical prostatectomy</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>RT</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>reverse transcription</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>S</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>SDHA</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>succinate dehydrogenase complex, subunit A, </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>SKY</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>spectral karyotyping </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>SOC</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>store operated Ca2+ channels</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>SR</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>serine/arginine-rich</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>STS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>sequence-tagged site</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>SV</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Splice variant</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>T</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>TM</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Transmembrane</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>TNM</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>tumor node metastasis</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>TRP</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>transient receptor potential </p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>TRUS</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>transrectal ultrasonography</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>U</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>UTR</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>untranslated region</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>W</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>WT</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>wild type</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top"/>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>Y</p>
                        </entry>
                     </row>
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>YFP protein</p>
                        </entry>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>yellow fluorescent </p>
                        </entry>
                     </row>
                  </tbody>
               </tgroup>
            </table>
         </p>
      </abbreviation>
      <appendix>
	    <head>
            <pagenumber numbering="arabic" start="96"/>Attachment</head>
            <part>
													<head/>
												
         <freehead>Sequences of Splice Variants</freehead>
         <p>Explanations to attachments: letters underlined indicate sequences distinct from TRPM8. &#8220;Normal&#8221; letters are identical to the TRPM8 sequence.</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 1 (6b)</strong>
            </em>
         </freehead>
         <p>3&#8217;atccttgggtgaaagaaaatcctgcttgacaaaaaccgtcacttaggaaaagatgtcctttcgggcagccaggctcagcatgaggaacagaaggaatgacactctggacagcacccggaccctgtactccagcgcgtctcggagcacagacttgtcttacagtgaaagcgacttggtgaattttattcaagcaaattttaagaaacgagaatgtgtcttctttaccaaagattccaaggccacggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgag<u>gtaccggtgggacaggaggaggtctgctaggtcacatggaagaaagaccatggcatgggcctgtggcctgaaccctggggctctgtgatggagccagccagatcatggggaagtctgcctttcaaggagtgcctttgggaccttaaaggaattgaaaacaaggatgacgtacctaattaactgctgggaaagagttaacaatgaatgttttgttcattaaaatgtgttctcagcaatctcaaaaaaaaaaaaaaaa</u>-5&#8216;</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 3 (16b)</strong>
            </em>
         </freehead>
         <p>5'_atccttgggtgaaagaaaatcctgcttgacaaaaaccgtcacttaggaaaagatgtcctttcgggcagccaggctcagcatgaggaacagaaggaatgacactctggacagcacccggaccctgtactccagcgcgtctcggagcacagacttgtcttacagtgaaagcgacttggtgaattttattcaagcaaattttaagaaacgagaatgtgtcttctttaccaaagattccaaggccacggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgagggctattttttagcccagtaccttatggatgacttcacaagagatccactgtatatcctggacaacaaccacacacatttgctgctcgtggacaatggctgtcatggacatcccactgtcgaagcaaagctccggaatcagctagagaagtatatctctgagcgcactattcaagattccaactatggtggcaagatccccattgtgtgttttgcccaaggaggtggaaaagagactttgaaagccatcaatacctccatcaaaaataaaattccttgtgtggtggtggaaggctcgggccagatcgctgatgtgatcgctagcctggtggaggtggaggatgccctgacatcttctgccgtcaaggagaagctggtgcgctttttaccccgcacggtgtcccggctgcctgaggaggagactgagagttggatcaaatggctcaaagaaattctcgaatgttctcacctattaacagttattaaaatggaagaagctggggatgaaattgtgagcaatgccatctcctacgctctatacaaagccttcagcaccagtgagcaagacaaggataactggaatgggcagctgaagcttctgctggagtggaaccagctggacttagccaatgatgagattttcaccaatgaccgccgatgggagtctgctgaccttcaagaagtcatgtttacggctctcataaaggacagacccaagtttgtccgcctctttctggagaatggcttgaacctacggaagtttctcacccatgatgtcctcactgaactcttctccaaccacttcagcacgcttgtgtaccggaatctgcagatcgccaagaattcctataatgatgccctcctcacgtttgtctggaaactggttgcgaacttccgaagaggcttccggaaggaagacagaaatggccgggacgagat<pagenumber numbering="arabic" start="97"/>ggacatagaactccacgacgtgtctcctattactcggcaccccctgcaagctctcttcatctgggccattcttcagaataagaaggaactctccaaagtcatttgggagcagaccaggggctgcactctggcagccctgggagccagcaagcttctgaagactctggccaaagtgaagaacgacatcaatgctgctggggagtccgaggagctggctaatgagtacgagacccgggctgttgagctgttcactgagtgttacagcagcgatgaagacttggcagaacagctgctggtctattcctgtgaagcttggggtggaagcaactgtctggagctggcggtggaggccacagaccagcatttcatcgcccagcctggggtccagaattttctttctaagcaatggtatggagagatttcccgagacaccaagaactggaagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttag<u>gtacaaaccaaggcacataatcgtgtgtgagtgtgtgtgccagtgtgtgtacatgcatccacatatgtgtgctctcatgtaaatgattaaaaagcctggaacttaaaaaaaaaaa</u>- 3'</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 7 (16b-1)</strong>
            </em>
         </freehead>
         <p>5'_tggcttgaacctacggaagtttctcacccatgatgtcctcactgaactcttctccaaccacttcagcacgcttgtgtaccggaatctgcagatcgccaagaattcctataatgatgccctcctcacgtttgtctggaaactggttgcgaacttccgaagaggcttccggaaggaagacagaaatggccgggacgagatggacatagaactccacgacgtgtctcctattactcggcgtgtgtgagtgtgtgtgccagtgtgtgtacatgcatccacatatgtgtgctctcatgtaaatgattaaaaagcctggaacttaaaaaaaaaaa-3'</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 8 (16b-2)</strong>
            </em>
         </freehead>
         <p>5'_tctgcagatcgccaagaattcctataatgatgccctcctcacgtttgtctggaaactggttgcgacatcaatgctgctggggagtccgaggagctggctaatgagtacgagacccgggctgttgagctgttcactgagtgttacagcagcgatgaagacttggcagaacagctgctggtctattcctgtgaagcttggggtggaagcaactgtctggagctggcggtggaggccacagaccagcatttcatcgcccagcctggggtccagaattttctttctaagcaatggtatggagagatttcccgagacaccaagaactggaagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttaggtacaaaccaaggcacataatcgtgtgtgagtgtgtgtgccagtgtgtgtacatgcatccacatatgtgtgctctcatgtaaatgattaaaaagcctggaacttaaaaaaaaaaa-3'</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 9 (16b-3)</strong>
            </em>
         </freehead>
         <p>5'_ggaaggaagacagaaatggccgggacgagatggacatagaactccacgacgtgtctcctattactcggcaccccctgcaagctctcttcatctgggccattcttcagaataagaaggaactctccaaagtcatttgggagcagaccaggggctgcactctggcagccctgggagccagcaagcttctgaagactctggccaaagtgaagaacgacatcaatgctgctggggagtccgaggagctggctaatgagtacgagacccgggctgttgaattttctttctaagcaatggtatggagagatttcccgagacaccaagaactggaagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttaggtacaaaccaaggcacataatcgtgtgtgagtgtgtgtgccagtgtgtgtacatgcatccacatatgtgtgctctcatgtaaatgattaaaaagcctggaacttaaaaaaaaaaa-3'</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 10 (16b-4)</strong>
            </em>
         </freehead>
         <p>5'_ggaggagactgagagttggatcaaatggctcaaagaaattctcgaatgttgtcacctattaacagttattaaaatggaagaagctggggtccagaattttctttctaagcaatgtatggagagatttcccgagacaccaagaactggaagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttaggtacaaaccaaggcacataatcgtgtgtgagtgtgtgtgccagtgtgtgtacatgcatccacatatgtgtgctctcatgtaaatgattaaaaagcctggaacttaaaaaaaaaaa-3'</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 4 (20b)</strong>
            </em>
         </freehead>
         <p>3&#8216;atccttgggtgaaagaaaatcctgcttgacaaaaaccgtcacttaggaaaagatgtcctttcgggcagccaggctcagcatgaggaacagaaggaatgacactctggacagcacccggaccctgtactccagcgcgtctcggagcacagacttgtcttacagtgaaagcgacttggtgaattttattcaagcaaattttaagaaacgagaatgtgtcttctttaccaaagattccaaggccacggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgaccca<pagenumber numbering="arabic" start="98"/>gcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgagggctattttttagcccagtaccttatggatgacttcacaagagatccactgtatatcctggacaacaaccacacacatttgctgctcgtggacaatggctgtcatggacatcccactgtcgaagcaaagctccggaatcagctagagaagtatatctctgagcgcactattcaagattccaactatggtggcaagatccccattgtgtgttttgcccaaggaggtggaaaagagactttgaaagccatcaatacctccatcaaaaataaaattccttgtgtggtggtggaaggctcgggccagatcgctgatgtgatcgctagcctggtggaggtggaggatgccctgacatcttctgccgtcaaggagaagctggtgcgctttttaccccgcacggtgtcccggctgcctgaggaggagactgagagttggatcaaatggctcaaagaaattctcgaatgttctcacctattaacagttattaaaatggaagaagctggggatgaaattgtgagcaatgccatctcctacgctctatacaaagccttcagcaccagtgagcaagacaaggataactggaatgggcagctgaagcttctgctggagtggaaccagctggacttagccaatgatgagattttcaccaatgaccgccgatgggagtctgctgaccttcaagaagtcatgtttacggctctcataaaggacagacccaagtttgtccgcctctttctggagaatggcttgaacctacggaagtttctcacccatgatgtcctcactgaactcttctccaaccacttcagcacgcttgtgtaccggaatctgcagatcgccaagaattcctataatgatgccctcctcacgtttgtctggaaactggttgcgaacttccgaagaggcttccggaaggaagacagaaatggccgggacgagatggacatagaactccacgacgtgtctcctattactcggcaccccctgcaagctctcttcatctgggccattcttcagaataagaaggaactctccaaagtcatttgggagcagaccaggggctgcactctggcagccctgggagccagcaagcttctgaagactctggccaaagtgaagaacgacatcaatgctgctggggagtccgaggagctggctaatgagtacgagacccgggctgttgagctgttcactgagtgttacagcagcgatgaagacttggcagaacagctgctggtctattcctgtgaagcttggggtggaagcaactgtctggagctggcggtggaggccacagaccagcatttcatcgcccagcctggggtccagaattttctttctaagcaatggtatggagagatttcccgagacaccaagaactggaagattatcctgtgtctgtttattatacccttggtgggctgtggctttgtatcatttaggaagaaacctgtcgacaagcacaagaagctgctttggtactatgtggcgttcttcacctcccccttcgtggtcttctcctggaatgtggtcttctacatcgccttcctcctgctgtttgcctacgtgctgctcatggatttccattcggtgccacacccccccgagctggtcctgtactcgctggtctttgtcctcttctgtgatgaagtgagacagtggtacgtaaatggggtgaattattttactgacctgtggaatgtgatggacacgctggggcttttttacttcatagcaggaattgtatttcggctccactcttctaataaaagctctttgtattctggacgagtcattttctgtctggactacattattttcactctaagattgatccacatttttactgtaagcagaaacttaggacccaagattataatgctgcagaggatgctgatcgatgtgttcttcttcctgttcctctttgcggtgtggatggtggcctttggcgtggccaggcaagggatccttaggcagaatgagcagcgctggaggtggatattccgttcggtcatctacgagccctacctggccatgttcggccaggtgcccagtgacgtggatgggtaagcctgacttggctcagatggaaacagcttggaggaggcatttgctccctgaaccaacccccagggctgccccggagaccgcacttcagaagcacgcgcgtgaaacggagtccaacataacagagtaccacgtatgactttgcccactgcaccttcactgggaatgagtccaagcctactgtgtgtggagctggatgagcacaacctgccccggttccccgagtggatcaccatccccctggtgtgcatctacatgttatccaccaacatcctgctggtcaacctgctggtcgccatgtttggctacacggtgggcaccgtccagagaacaatgaccaggtctggaagttccagaggtacttcctggtgcaggagtactgcagccgcctcaatatccccttccccttcatcgtcttcgcttacttctacatggtggtgaagaagtgcttcaagtgttgctgcaaggagaaaaacatggagtcttctgtctgctgtttcaaaaatgaagacaatgagactctggcatgggagggtgtcatgaaggaaaactaccttgtcaagatcaacacaaaagccaacgacacctcagaggaaatgaggcatcgatttagacaactggatacaaagcttaatgatctcaagggtcttctgaaagagattgctaataaaatcaaataaaactgtatgaactctaatggagaaaaatctaattatagcaagatcatattaaggaatgctgatgaacaattttgctatcgactactaaatgagagattttcagacccctgggtacatggtggatgattttaaatcaccctagtgtgctgagaccttgagaataaagtgtgtgattggtttcatacttgaagacggatataaaggaagaatatttcctttatgtgtttctccagaatggtgcctgtttctctctgtgtctcaatgcctgggactggaggttgatagtttaagtgtgttcttaccgcctcctttttcctttaatcttatttttgatgaacacatatataggagaacatctatcctatgaataagaacctggtcatgctttactcctgtattgttattttgttcatttccaattgattctctacttttcccttttttgtattatgtgactaattagttggcatattgttaaaagtctctcaaattaggccagattctaaaacatgctgcagcaagaggaccccgctctcttcaggaaaagtgttttcatttctcaggatgcttcttacctgtcagaggaggtgacaaggcagtctcttgctctcttggactcaccaggctcctattgaaggaacc<pagenumber numbering="arabic" start="99"/>acccccattcctaaatatgtgaaaagtcgcccaaaatgcaaccttgaaaggcactactgactttgttcttattggatactcctcttatttattatttttccattaaaaataatagctggctattatagaaatttagaccatacagagatgtagaaagaacataaattgtccccattaccttaaggtaatcactgctaacaatttctggatggtttttcaagtctattttttttctatgtatgtctcaattctctttcaaaattttacagaatgttatcatactacatatatactttttatgtaagctttttcacttagtattttatcaaatatgtttttattatattcatagccttcttaaacattatatcaataattgcataataggcaacctctagcgattaccataattttgctcattgaaggctatctccagttgatcattgggatgagcatctttgtgcatgaatcctattgctgtatttgggaaaattttccaaggttagattccaataaatatctatttattattcaatattaaaaaaaaaaaaaaa-5&#8216;</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 2 (4a_4b)</strong>
            </em>
         </freehead>
         <p>tgcctttctccaccagagactcttcctcagggaggacttggtgaattttattcaagcaaattttaagaaacgagaatgtgtcttctttaccaaagattccaaggccacgctcaatgaaatccttccttcctgtccacaccatcgtgcttatcagggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggccgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgaggtaccggtgggacaggaggaggtctgctaggtcacatggaagaaagaccatggcatgggcctgtggcctgaaccctggggctctgtgatggagccagccagatcatggggaagtctgcctttcaaggagtgcctttgggaccttaaaggaattgaaaacaaggatgacgtacctaattaactgctgggaaagagttaacaatgaatgttttgttcattaaaatgtgttctcagcaatctcaaaaaaaaaaaaaaaaaa</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 5 (avant13) </strong>
            </em>
         </freehead>
         <p>gacctggctaatttttgtatttttagtagacacggggtttcaccatgttggccaggctggtctcgaactcctgacctcaggtgatttgcctgcctcggcctcccaagtgttgggattacaggcgtgaaccaccgtgtccggcctcaggttttcttaattgcagagcttagtgtggtatactttctgaaggtatctaacagggaataggggcaaacaaatagctgcatgctcctgtcatagtccaccagctatgatctgcttaaaacagctgcctgctggtcgccatgtttggctacacggtgggcaccgtccaggagaacaatgaccaggtctggaagttccagaggtacttcctggtgcaggagtactgcagccgcctcaatatccccttccccttcatcgtcttcgcttacttctacatggtggtgaagaagtgcttcaagtgttgctgcaaggagaaaaacatggagtcttctgtctgctgtttcaaaaatgaagacaatgagactctggcatgggagggtgtcatgaaagaaaactaccttgtcaagatcaacacaaaaaccaacgacacctcagaggaaatgaggcatcgatttagacaactggatacaaagatcatattaaggaatgctgatgaacaattttgctatcgactactaaatgagagattttcagacccctgggtacatggtggatgattttaaatcaccctagtgtgctgagaccttgagaataaagtgtgtgattggtttcatacttgaagacggatataaaggaagaatatttcctttatgtgtttctccagaatggtgcctgtttctctctgtgtctcaatgcctgggactggaggttgatagtttaagtgtgttcttaccgcctcctttttcctttaatcttatttttgatgaacacatatataggagaacatctatcctatgaataagaacctggtcatgctttaaaaaaaaaaaaaaaaaaaaaaaa</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 6 (avant25)</strong>
            </em>
         </freehead>
         <p>gctagaatttaccagtaagccatctgatttcccagtaagccatcctgggcttttctttgttgaaagctttttgattgctgattttcattttcttcatttgttgtttgtctgttcaggctttgtatttcttcttgattcaggtctttgtaagttgtacatttctgggatatttccatttcttctaggttgtccaccttgtttgcatataattgttcatactagccccttctgatccctttcatttctatgccctctgttgtaaggttgtctttctcatttctgactgtatttatttgtatcttcttccttttcttaaaaggtttgttgattttgtttatcttttcaaaaaaccaactcttactttcaatgattttttttcccattgtttttcaactctcttttttaaaaatgtattttgctcttggagtttttgctctactttaaacagcttactaaagtcattttactattaacaaatacaaggctctttcaaaagctcctatagggaatacaaaatttccccatctccttataccagaaaacaaagttatttacaattcatcttaagtctcttaatgatctcaagggtcttctgaaagagattgctaataaaatcaaataaaactgtatgaactctaatggagaaaaatctaattatagcaagatcatattaaggaatgctgatgaacaattttgctatcgactactaaatgagagattttcagacccctgggtacatggtggatgattttaaatcacc<pagenumber numbering="arabic" start="100"/>ctagtgtgctgagaccttgagaataaagtgtgtgattggtttcatacttgaagacggatataaaggaagaatatttcctttatgtgtttctccagaatggtgcctgtttctctctgtgtctcaatgcctgggactggaggttgatagtttaagtgtgttcttaccgcctcctttttcctttaatcttatttttgatgaacacatatataggagaacatctatcctatgaataagaacctggtcatgctttactcctgtattgttattttgttcatttccaattgattctctacttttcccttttttgtattatgtgactaattagttggcatattgttaaaagtctctcaaattaggccagattctaaaacatgctgcagcaagaggaccccgctctcttcaggaaaagtgttttcatttctcaggatgcttcttacctgtcagaggaggtgacaaggcagtctcttgctctcttggactcaccaggctcctattgaaggaaccacccccattcctaaatatgtgaaaagtcgcccaaaatgcaaccttgaaaggcactactgactttgttcttattggatactcctcttatttattatttttccattaaaaataatagctggctattatagaaatttagaccatacagagatgtagaaagaacataaattgtccccattaccttaaggtaatcactgctaacaatttctggatggtttttcaagtctattttttttctatgtatgtctcaattctctttcaaaattttacagaatgttatcatactacatatatactttttatgtaagctttttcacttagtattttatcaaatatgtttttattatattcatagccttcttaaacattatatcaataattgcataataggcaacctctagcgattaccataattttgctcattgaaggctatctccagttgatcattgggatgagcatctttgtgcatgaatcctattgctgtatttgggaaaattttccaaggttagattccaataaatatctatttattattcaatattaaaaaaaaaa-3&#8217;</p>
         <freehead>
            <em>
               <strong>SEQ ID NO: 6 (TRPM8 Regulatory RNA)</strong>
            </em>
         </freehead>
         <p>5&#8216;ttggccttcagagcaaagaaggagatctgcatctctacacccagatggagaatcaccctcactttgcagctgaaggcaatgtggagttgatgttattttataccatttatttttattatctcttcacaacaaacctactaagtcaatgttatgattccatgctgcaaacaaggaaattaagcctcagcaatcctgatattctggaacagaacaatcctttaagagatttggtattgaagaccttgttggaaatggatcagacattgcccagaccactgtccagacccaacactggaataacccaggagagcttcgtgcttacctcccatcggcggtcattggtgaaaatctcatcattggctaagtccagctggttccactccagcagaagcttcagctgcccattccagttatccttgtcttgctcactggtgctgaaggctgtgagagggcaggaaaagactcaactcaccaaaggctcagaaataagagtgagaaccattcagtgtggccaattatcagagctgtttatcacagatcgtatttgttcttaaatggtatctaccagaagaagacagccagctttcgatactaacaaaccacaatggaagatggccgtatttatcattgcctttagcatgttaaagggtacataccacattgaccctggcagaagcattcctgatgtgttggaaaaattaagagaaataacagttctttggcaataaaaaaaaa-3&#8216;</p>
</part>
<part>
	<head/>
         <freehead>
            <link id="_Ref60663694"/>
            <pagenumber numbering="arabic" start="101"/>Data of Prostate cancer Patient</freehead>
         <p>
            <table orient="port" frame="none" tocentry="1">
               <caption>
                  <link id="_Ref60743649"/>Tab. 7 Prostate Cancer Patient histopathological and follow up data of samples hybridized to the metg001 Cancer-Chip. R = 1 &#8594; Relapse after S; S = Surgery (radical prostatectomy); R = x &#8594; patient dead; GG = Gleason Grading, </caption>
               <tgroup cols="1" align="left" charoff="50" char="">
                  <colspec colnum="1" colname="1"/>
                  <tbody valign="top">
                     <row>
                        <entry morerows="0" rotate="0" valign="top">
                           <p>
                              <mm entity="Grafik54" label="321#715"/>
                           </p>
                        </entry>
                     </row>
                  </tbody>
               </tgroup>
            </table>
         </p>
         <p/>
         </part>

      </appendix>
      <acknowledgement>
         <head>
            <pagenumber numbering="arabic" start="102"/>DANKSAGUNG</head>
         <p>Bedanken möchte ich mich bei Prof. Dr. André Rosenthal für die Möglichkeit, bei der metaGen Pharmaceuticals GmbH in Berlin meine Promotion anfertigen zu können und für die hervorragenden wissenschaftlichen Bedingungen. </p>
         <p>Ein besonderer Dank gilt meinen Betreuern Herrn Dr. Thomas Plath und Dr. Christian Pilarsky und für die umfassende Unterstützung, Betreuung und Diskussionsbereitschaft während dieser Arbeit. </p>
         <p>Prof. Dr. T. Börner von der Humboldt-Universität zu Berlin danke ich sehr herzlich für die Bereitschaft, die Betreuung der Arbeit von Pagen der Humboldt-Universität zu übernehmen sowie deren Begutachtung. </p>
         <p>Vielen herzlichen Dank an die Gutachter Dr. Matthias Dürst an der Friedrich Schiller Universität in Jena und Dr. Kemmner vom Max-Delbrück Zentrum in Berlin-Buch, die so freundlich waren, einen Teil ihrer kostbaren Zeit meiner Arbeit zu widmen. </p>
         <p>Dr. Holger Hesse, Dr. Haike Leibiger, Dr. Sandra Kluge und Mandy Magbagbeolu, meiner Schwester und nicht zuletzt meinem Vater danke ich ausgesprochen herzlich für die kritische Durchsicht und vielen guten Anmerkungen zu dieser Arbeit. </p>
         <p>Ganz besonders möchte ich mich bei allen Mitarbeitern der Firma metaGen Pharmaceuticals GmbH bedanken, die zu einer wunderschönen und produktiven Arbeitsatmosphäre beigetragen haben. Besonderer Dank geht dabei an Alexander Herr, Christoph Wissmann, Anke Ehlers, Gunda Herbert, Stefan Taudin und vielen anderen.</p>
         <p>Des Weiteren bedanke ich mich bei Dr. Michael Schäfer und Daniel Sinnecker vom Institut für Pharmakologie der Freien Universität für die Durchführung der FRET-Analysen, bei Sefan Mergler von der Charité Berlin für die funktionellen Kalzium Messungen und auch ganz herzlich bei Karen Stout für Ihre Zeit und Geduld mich ich in CG-FISH-Analyse einzuweisen.</p>
         <p>Schließlich danke ich meinen Eltern für das Vertrauen, mit dem sie mich - nicht nur während der Arbeit an dieser Promotion - immer unterstützt haben. </p>
         <p>Und zum Schluss noch ein ganz besonderer Dank an meinen Freund Jan für seine unendliche Unterstützung und außerordentliche Geduld besonders auch während der letzen Tage dieser Arbeit! </p>
      </acknowledgement>
      <declaration>
         <head>
            <pagenumber numbering="arabic" start="103"/>EIDESSTATTLICHE ERKLÄRUNG </head>
         <p>Hiermit versichere ich an Eides statt, dass die vorliegende Arbeit von mir selbst angefertigt wurde und keine anderen als die angegebenen Hilfsmittel verwendet wurden.</p>
         <p>Weiterhin erkläre ich hiermit, dass von mir weder diese noch andere Dissertationen zum Promotionsverfahren an einer anderen Fakultät als der Humboldt-Universität zu Berlin eingereicht wurden.</p>
         <date>Berlin, den 30.12.2003</date>
         <p>Simone Kaiser</p>
      </declaration>
   </back>
</etd>