| ↓15 |
| ↓16 |
Oligonucleotides were obtained as lyophilized stocks from MWG Biotech or TIB MOLBIOL.
Oligonucleotides for insertion of a myc-tag into different positions of a TCR
|
TCR |
Position |
Primer |
Sequence |
|
P14 α |
fwd |
tttgcggccgcagtctaggaggaatggacaag |
|
|
rev |
GCCCTGTACATCAACTGGACCACAGCCTCAG |
||
|
AN |
myc1 |
TCCTCCTCGCTGATCAACTTCTGCTCGCCATTCACCCCGGCTAGATGTAGG |
|
|
myc2 |
AGAAGTTGATCAGCGAGGAGGACCTGCAGCAGAAGGAGAAACATGACCAGC |
||
|
CS |
myc1 |
ATCTTCTTCAGAAATAAGCTTTTGCTCGGAGTCAAAGTCGGTGAACAGGCAGAG GGT |
|
|
myc2 |
CAAAAGCTTATTTCTGAAGAAGATCTGGGAACGTTCATCACTGACAAAACTGTG |
||
|
P14 β |
fwd |
tttgcggccgcctgagaggaagcatgtctaac |
|
|
rev |
GGGCcGtgtacatcaggaattttttttcttgacC |
||
|
BN |
myc1 |
ATCCTCCTCAGAGATCAGTTTTTGCTCAGCCTCCATGTGTTTTGTTCCCAG |
|
|
myc2 |
caaaaaCTGatCtctgaggaggatctggcagtcacccaaagtccaagaagcaa |
||
|
L1 |
myc1 |
CTCCTCTGAAATCAGTTTTTGCTCAAGCCCATGGAACTGCACTTGGCAGCGG |
|
|
myc2 |
GAGCAAAAACTGATTTCAGAGGAGGATCTGCCCAAACCTGTCACACAGAACATC |
||
|
L2 |
myc1 |
CTCCTCGCTGATCAGCTTCTGCTCCTCTGACAGCCCATGGAACTGCACTTGG |
|
|
myc2 |
CAGAAGCTGATCAGCGAGGAGGACCTGCCTGTCACACAGAACATTAGTGCCGAG |
||
|
L3 |
myc1 |
TCCTCCTCGCTGATCAGCTTCTGCTCGTCCTCCTCTGACAGCCCATGGAACT |
|
|
myc2 |
GAAGCTGATCAGCGAGGAGGACCTGACACAGAACATTAGTGCAGAGGC |
||
|
XL |
myc1 |
TCCTCCTCGCTAATCAGCTTCTGCTCTGGCCACTTGTCCTCCTCTGACAGCCCA |
|
|
myc2 |
AGAAGCTGATTAGCGAGGAGGACCTGgaaggctcacccaaacctgtcACACA |
||
|
OT-I α |
fwd |
tttgcggccgcagtctaggaggaatggacaag |
|
|
rev |
GCCCTGTACATCAACTGGACCACAGCCTCAG |
||
|
AN |
myc1 |
TCCTCCTCGCTGATCAACTTCTGCTCGCCATTCACCCCGGCTAGATGTAGG |
|
|
myc2 |
AGAAGTTGATCAGCGAGGAGGACTTGCAGCAGCAGGAGAAACGTGACCAGC |
||
|
gp100 α |
fwd |
CTGCGGCCGCCATGGTGAAGATCCGG |
|
|
rev |
CCTGTACATCAGCTGGACCACAGCCGCA |
||
|
AN |
myc1 |
CTCCTCGCTGATCAGCTTCTGCTCGGCACTTACACAGCTTAACTGGAGCCAC |
|
|
myc2 |
AAGCTGATCAGCGAGGAGGACCTGGCCAAAAATGAAGTGGAGCAGAGT |
Oligonucleotides for insertion of a second myc-tag
|
Primer |
Sequence |
|
M1 |
GATCAGCGAGGAGGACCTGGAGCAGAAGTT |
|
M2 |
GATCAACTTCTGCTCCAGGTCCTCCTCGCT |
Oligonucleotides for cloning of P2A-linked TCR chains
| ↓17 |
|
TCR |
Primer |
Sequence |
|
P14 |
fwd |
tttgcggccgcagtctaggaggaatggacaag |
|
P2Arev |
GGGACCGGGGTTTTCTTCCACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCGCCGCTTCCACTGGACCACAGCCTCAGCGTCATG |
|
|
P2Afwd |
GGCAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCCATGTCTAACACTGCCTTCCCTGAC |
|
|
rev |
ccggaattctcaggaattttttttcttgacc |
|
|
OT-I |
fwd |
tttgcggccgcagtctaggaggaatggacaag |
|
P2Arev |
GGGACCGGGGTTTTCTTCCACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCGCCGCTTCCACTGGACCACAGCCTCAGCGTCATG |
|
|
P2Afwd |
AACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCCATGTCTAACACTGTCCTCGCTGATTCT |
|
|
rev |
Gggccgtgtacatcaggaattttttttcttgacc |
Oligonucleotides for sequencing of genes in the MP71 vector
|
Primer |
Sequence |
|
fwd |
CAGCATCGTTCTGTGTTGTCT |
|
rev |
CACCTGAACTAGTAATTACATATCC |
|
Name |
Description |
|
pcDNA3.1gag/pol |
Eukaryotic expression vector encoding murine leukemia virus (MLV) gag and pol genes; a gift from C. Baum (Hannover, Germany) |
|
pALF-10A1GaV |
Eukaryotic expression vector encoding murine leukemia virus (MLV) env gene 10A1; [129 ] |
|
MP71-P14α (X) |
Retroviral vector MP71 [56 ] expressing the P14 TCRα-chain (with a myc-tag in position X) |
|
MP71-P14β (X) |
Retroviral vector MP71 expressing the P14 TCRβ-chain (with a myc-tag in position X) |
|
MP71-OT-Iα (X) |
Retroviral vector MP71 expressing the OT-I TCRα-chain (with a myc-tag in position X) |
|
MP71-OT-Iβ |
Retroviral vector MP71 expressing the OT-I TCRβ-chain |
|
MP71-gp100α (X) |
Retroviral vector MP71 expressing the gp100 TCRα-chain (with a myc-tag in pos i tion X) |
|
MP71-gp100β (X) |
Retroviral vector MP71 expressing the gp100 TCRβ-chain (with a myc-tag in pos i tion X) |
|
MP71-P14α (X)-P2A-P14β |
Retroviral vector MP71 expressing the P14 TCRα- (with a myc-tag in pos i tion X) and TCRβ-chain linked by a P2A peptide |
|
MP71-OT-Iα (X)-P2A-OT-Iβ |
Retroviral vector MP71 expressing the P14 TCRα- (with a myc-tag in pos i tion X) and TCRβ-chain linked by a P2A peptide |
| ↓18 |
Ova-peptide (SIINFEKL), gp33-peptide (KAVYNFATM) and gp100-peptide (IMDQVPFSV) were purchased as HPLC-purified products from Biosyntan. PE- or APC-labeled tetramers were used to stain gp100 TCR (Immunomics), P14 TCR (Immunotech) and OT-I TCR (D. Busch, Munich, Germany).
C57BL/6J mice were purchased from Charles River. B and T cell-deficient Rag-1-/- (B6.129S7-Rag1tm1Mom) mice were obtained from The Jackson Laboratory. RIP-mOVA mice (a gift from T. Brocker, Munich, Germany) express chicken ovalbumin under control of the rat insulin promoter in the β-islet cells of the pancreas [130 ]. All mice were housed and bred at the animal facility of the Max Delbrück Center for Molecular Medicine, Berlin, Germany. Animal experiments were approved by the responsible institution and performed according to national and regional regulations.
|
Cell type |
Source |
Description |
Medium |
|
293T |
American Type Culture Collection (ATCC) CRL-11268 |
Human embryonic epithelial cells |
DMEM + GlutaMAX I (GIBCO), 10% active fetal calf serum (FCS, Biochrom), 100 IU/ml Pen/Strep (GIBCO) |
|
Plat-E |
[131 ] |
Ecotropic packaging cell line based on 293T, stable expression of MLV gag-pol and env genes |
DMEM + GlutaMAX I, 10% heat-inactivated FCS, 100 IU/ml Pen/Strep, |
|
58 |
[132 ] |
TCRα- and TCRβ-negative variant of BW5147 cell line (murine T cell lymphoma) |
T cell medium (RPMI 1640 + GlutaMAX I, 10% heat-inactivated FCS, 1 mM HEPES pH 7.25 (Sigma), 100 IU/ml Pen/Strep) |
|
B3Z |
[133 ] |
Hybridoma of a lacZ-inducible derivative of BW5147 and ova-specific T cell clone B3 |
T cell medium |
|
Jurkat76 |
[134 ] |
TCR-deficient derivative of J.RT3-T3.5 Jurkat cells |
T cell medium |
|
RPMI 8866 |
G. Trinchieri, Philadelphia, USA |
Human lymphoblastoid cell line |
T cell medium |
|
T2 |
ATCC CRL-1992, P. Cresswell, New Haven, USA |
Human TAP-deficient hybridoma |
T cell medium, 50 µM mercaptoethanol (Sigma) |
|
T2-Kb |
H. Schreiber, Chicago, USA |
T2 transfected with H2- Kb |
DMEM + GlutaMAX I, 5% heat-inactivated FCS, 100 IU/ml Pen/Strep, |
|
Murine splenocytes |
Spleens of C57BL/6J mice |
CMM medium (RPMI 1640 + GlutaMAX I, 10% heat-inactivated PAN-FCS (PAN Biotech), 1 mM HEPES, 1% Na-Pyruvat (GIBCO), 100 IU/ml Pen/Strep, 50 µM mercaptoethanol) |
|
|
Human PBLs and NK cells |
Healthy donors |
PAN T cell medium (RPMI 1640 + GlutaMAX I, 10% heat-inactivated PAN-FCS, 1 mM HEPES pH 7.25, 100 IU/ml Pen/Strep, 10-100 IU/ml rhIL-2 (Chiron)) |
| ↓19 |
|
Specificity |
C onjug a te |
C lone |
Isotype |
Host |
Application |
Source |
|
Human CD28 |
CD28.2 |
IgG1 |
Mouse |
PBL stimulation |
BD |
|
|
Human CD3 |
OKT3 |
IgG2a |
Mouse |
PBL stimulation |
CILAG |
|
|
Human CD3ε |
Fluorescein isothiocyanat (FITC) |
SK7 |
IgG1 |
Mouse |
Flow cytometry (FC) |
BD |
|
Human CD56 |
Allophycocyanin (APC) |
B159 |
IgG1 |
Mouse |
FC |
BD |
|
Human TCR vβ8 |
Phycoerythrin (PE) |
56C5.2 |
IgG2a |
Mouse |
FC |
Immunotech |
|
Mouse CD16/32 |
2.4G2 |
IgG2b |
Rat |
Fc receptor block |
BD |
|
|
Mouse CD28 |
37.51 |
IgG2 |
Syrian hamster |
Splenocyte stimulation |
BD |
|
|
Mouse CD3 |
145-2C11 |
IgG1 |
Armenian hamster |
Splenocyte stimulation |
BD |
|
|
Mouse CD3e |
FITC |
145-2C11 |
IgG1 |
Armenian hamster |
FC |
BD |
|
Mouse CD3ε |
APC |
145-2C11 |
IgG1 |
Armenian hamster |
FC |
BD |
|
Mouse CD8α |
53-6.7 |
IgG2a |
Rat |
IHC |
BD |
|
|
Mouse CD8α |
APC |
53-6.7 |
IgG2a |
Rat |
FC |
BD |
|
Mouse TCR vα2 |
APC |
B20.1 |
IgG2a |
Rat |
FC |
Caltag |
|
Mouse TCR vβ5.1, 5.2 |
PE |
MR9-4 |
IgG1 |
Mouse |
FC |
BD |
|
Mouse TCR vβ8.1, 8.2 |
PE |
MR5-2 |
IgG2a |
Mouse |
FC |
BD |
|
Myc-tag |
9E10 |
IgG1 |
Mouse |
In vivo depletion |
Hybridoma supernatant (ATCC CRL-1729) |
|
|
Myc-tag |
3A7 |
IgG2a |
Mouse |
In vitro depletion |
US Biological |
|
|
Myc-tag |
Polyclonal |
Rabbit |
FC |
Santa Cruz |
||
|
Ovalbumin |
Polyclonal |
Rabbit |
IHC |
Acris |
||
|
Rabbit IgG |
PE |
Polyclonal |
Goat |
FC |
Santa Cruz |
|
|
Mouse IgG Fc |
Polyclonal |
Rabbit |
In vitro depletion |
Jackson ImmunoResearch |
Polymerase chain reaction (PCR)
Site-directed mutagenesis PCR using overlapping primers was performed to insert a myc-tag sequence into the TCR or to generate vectors in which the TCRα and TCRβ chains were linked by a P2A element. For this, two separate PCRs (PCR1 and PCR2) were carried out yielding partially overlapping fragments which at the 5’ or 3’ end contain the newly introduced sequence. In a third reaction (PCR3), the two products were combined in an annealing step resulting in a complete gene carrying the modification, which was then amplified by addition of primers. Figure 4 shows a schematic layout of the procedure.
| Figure 4 : Design of site-directed mutagenesis PCR using pairs of overlapping primers. Green: Primers specific for the TCR sequence. Red: Myc-tag or P2A sequence. | ||
| ↓20 |
|
Reaction mix PCR1/2: |
100 |
ng |
plasmid DNA |
|
|
1.5 |
µl |
primer 1 (20 µM) |
||
|
1.5 |
µl |
primer 2 (20 µM) |
||
|
2 |
µl |
dNTPS (10 mM) (NEBiolabs) |
||
|
10 |
µl |
10x Thermo Pol buffer (NEBiolabs) |
||
|
2 |
U |
Deep Vent DNA Polymerase (NEBiolabs) |
||
|
ad |
100 |
µl |
H2O |
The following primer pairs were used (for sequences see Material section):
|
Insertion of the myc tag: |
PCR1 (fwd / myc1) |
PCR2 (rev / myc2) |
|
Cloning of P2A vectors: |
PCR1 (fwd / P2Arev) |
PCR2 (rev / P2Afwd) |
| ↓21 |
|
PCR1/2 cycle: |
1) |
95°C |
180 s |
|
2) |
95°C |
60 s |
|
|
3) |
56-68°C |
60 s |
|
|
4) |
72°C |
60 s / 1 kb product length |
|
|
(steps 2 to 4 repeated 30 times) |
|||
|
5) |
95°C |
60 s |
|
|
6) |
72°C |
600 s |
|
DNA products of PCR1 and PCR2 were purified using MinElute PCR Purification Kit (Qiagen) and used for an annealing reaction.
|
Annealing reaction mix: |
100 |
ng |
product PCR1 |
|
|
100 |
ng |
product PCR2 |
||
|
2 |
µl |
dNTPS (10 mM) (NEBiolabs) |
||
|
10 |
µl |
10x Thermo Pol buffer (NEBiolabs) |
||
|
2 |
U |
Deep Vent DNA Polymerase (NEBiolabs) |
||
|
ad |
100 |
µl |
H2O |
| ↓22 |
|
Annealing cycle: |
1) |
95°C |
180 s |
|
2) |
95°C |
60 s |
|
|
3) |
cool down from 95°C to 45°C with 5°C / 30 s |
||
|
4) |
72°C |
60 s / 1 kb product length |
|
|
(steps 2 to 4 repeated 5 times) |
|||
After the annealing reaction, 1.5 µl primer 1 (fwd, 20 µM) and 1.5 µl primer 2 (rev, 20 µM) were added and PCR3 cycle was performed similar to PCR1/2. The product was purified with MinElute PCR Purification Kit. Correct length of all PCR products was confirmed by agarose gel electrophoresis using DNA1-kb-marker (Sigma) as a control.
Enzymatic restriction and dephosphorylation of DNA
DNA restriction was performed either in analytical scale to confirm correct insert orientation after ligation or in a preparative scale to prepare fragments for cloning. Enzymes were purchased from NEBiolabs and Fermentas; buffers and reaction conditions were applied according to the manufacturer. Digestion was usually performed for 1 h. If different buffer conditions needed to be used for two enzymes in one restriction, DNA was first digested with one enzyme, then precipitated with ethanol and centrifugation, and finally taken up in a buffer appropriate for the second enzyme.
| ↓23 |
|
Analytical scale reaction mix: |
0.5 |
µg |
plasmid DNA |
|
|
2 |
µl |
10x reaction buffer |
||
|
5 |
U |
restriction enzyme |
||
|
0.2 |
µl |
100x BSA (NEBiolabs) if required |
||
|
ad |
20 |
µl |
H2O |
|
Preparative scale reaction mix: |
6 |
µg |
plasmid DNA |
|
|
5 |
µl |
10x reaction buffer |
||
|
20 |
U |
restriction enzyme |
||
|
0.5 |
µl |
100x BSA (NEBiolabs) if required |
||
|
ad |
50 |
µl |
H2O |
Before subsequent ligation, 5’ phosphate residues of vector fragments were enzymatically removed to avoid re-ligation of cohesive vector ends.
| ↓24 |
|
Dephosphorylation mix: |
50 |
µl |
preparative restriction mix |
|
|
5 |
µl |
10x dephosphorylation buffer (Roche) |
||
|
2 |
U |
Alkaline Phosphatase (Roche) |
||
|
ad |
100 |
µl |
H2O |
Dephosphorylation was performed at 37°C for 30 min.
DNA extraction from agarose
To isolate specific DNA fragments after enzymatic restriction, the whole reaction mix was loaded onto 0.6 to 2% agarose gels containing 0.5 µg/ml ethidium bromide (Serva) and run at 120 V for 15 to 45 min. DNA bands were visualized with ultraviolet (UV) light and fragments of the right size were cut out of the gel. DNA was extracted from gel slices using EasyPure DNA purification kit (Biozym).
Ligation of DNA fragments
| ↓25 |
DNA concentration and length of digested vector and insert were determined. The fragments were combined in a molar vector : insert ratio of 1:3 using 100 ng vector DNA. Ligation was performed with Rapid Ligation Kit (Roche) according to the manufacturer’s instructions. Finally, CaCl2-treated, chemo-competent bacteria were transformed with the ligated product.
Phosphorylation and annealing of oligonucleotides for insertion of a second tag
First, oligonucleotides M1 and M2 were separately phosphorylated using T4 kinase for 1 h at 37°C.
|
Phosphorylation mix: |
10 |
µl |
primer M1 (100 µM) |
|
10 |
µl |
primer M2 (100 µM) |
|
|
20 |
U |
T4 polynucleotide kinase (Fermentas) |
|
|
4 |
µl |
10x T4 ligase buffer (Fermentas) |
|
|
14 |
µl |
H2O |
| ↓26 |
Phosphorylated oligonucleotides were annealed by incubation at 95°C for 5 min and subsequently decreasing temperature slowly to 4°C.
Transformation of bacteria
CaCl2-treated, chemo-competent Escherichia coli (E. coli) strains XL-1 blue and SCS110 (dam-deficient) (both Invitrogen) were thawed on ice. 40 µl of bacterial suspension were mixed with 1 µg DNA for transformation of plasmid DNA or 10 µl of the ligation reaction mix for transformation of ligated DNA. The mix was incubated on ice for 20 min. Heat shock was performed by incubating the solution at 37°C for 1 min and afterwards on ice. Subsequently, 1 ml of SOC medium was added and bacteria were cultured at 37°C and 220 rpm in an incubator for 1 h. 100 to 1000 µl of the suspension was plated on LB-agar plates containing 100 µg/ml ampicillin (Roth). As all used plasmids expressed β-lactamase under control of a bacterial promoter, ampicillin resistance is conferred to transformed bacteria.
|
SOC medium: |
20 |
mM |
glucose (Roth) |
|
2 |
% |
tryptone (Roth) |
|
|
0.5 |
% |
yeast extract (Roth) |
|
|
10 |
mM |
NaCl (Roth) |
|
|
2.5 |
mM |
KCl (Roth) |
|
|
10 |
mM |
MgCl2 (Roth) |
|
|
10 |
mM |
MgSO4 (Roth) |
| ↓27 |
|
LB medium: |
1 |
% |
tryptone |
|
1 |
% |
NaCl |
|
|
0.5 |
% |
yeast extract |
|
LB agar: |
1.5 |
% |
agar (Roth) |
|
in LB medium |
|||
Plasmid DNA preparation from bacteria and sequencing
Isolation of plasmid DNA from E. coli was performed using Spin Plasmid Mini Kit (Invitek) for small scale preparations or DNA Maxi Kit (Qiagen) for large scale preparations; both were applied according to the manufacturer’s instructions. Amplification of the correct plasmid was verified by enzymatic restriction. Sequencing of plasmid DNA was performed at MWG Biotech using vector-specific primers.
Cultivation and cryo-preservation of cell lines and primary cells
| ↓28 |
If not stated otherwise, cells were cultured in exponential growth phase at 37°C, 5% CO2 and 95% humidity in a HERA cell 240 incubator (Kendro Laboratory Products). Suspension cells were passaged and supplied with fresh medium twice a week. For passaging of adherent cells, medium was removed; cells were washed with PBS and treated with 0.05% trypsin-EDTA in PBS (GIBCO) for 3 min. Medium was added and cells were seeded in tissue culture flasks at a lower density. For cryo-preservation, medium was removed; cells were taken up in FCS with 10% DMSO (Sigma) and transferred into cryo-tubes (Greiner). For 24 h, cryo-tubes were stored in cryo-containers (Nalgene) at -80°C, after which they were placed in liquid nitrogen. To thaw cells, cryo-tubes were incubated at 37°C. Immediately after thawing cells were taken up in 10 ml cold medium, centrifuged and supplied with pre-warmed medium.
Isolation and stimulation of human PBMCs
Human PBMCs were derived from the blood of healthy donors after informed consent. After donation, 50 ml blood were mixed with 50 ml T cell medium. 50-ml centrifugation tubes (Greiner) were filled with 12.5 ml Ficoll separating solution (Biochrom) on which 25 ml of the medium-diluted blood was layered. The tubes were centrifuged at 650 x g with reduced acceleration and deceleration for 20 min. Lymphocytes accumulated at the interphase from which they were removed with a pipette and transferred into a new tube. Cells were washed twice with 50 ml T cell medium and finally taken up in T cell medium containing PAN-FCS. For stimulation, 24-well non-tissue culture plates (Greiner) were coated with anti-hCD3 antibody and anti-hCD28 antibody (5 µg and 1 µg in 0.5 ml PBS per well, respectively) at 37°C for 2 h. Afterwards wells were incubated with 0.5 ml 2% BSA solution at 37°C for 30 min and washed with PBS. 1 x 106 PBLs were seeded in 1 ml medium per well and 100 IU/ml rhIL-2 were added.
Isolation and stimulation of human natural killer (NK) cells
NK cells were isolated from Ficoll gradient-separated PBMCs. For this, 2 x 107 PBMCs were taken up in 20 ml T cell medium, seeded in a T150 tissue culture flask (Techno Plastic Products) and incubated at 37°C in a horizontal position for exactly 30 min thus allowing monocytes and dendritic cells to adhere to the cell culture plastic. Subsequently, the non-attached lymphoid cells were carefully removed and counted. Per well of a 6-well plate 1.5 x 106 PBLs were seeded in a volume of 5 ml together with 3 x 105 interleukin-12-producing RPMI 8866 feeder cells which had been irradiated with 30 Gy. NK cells were cultured for 5 to 6 days and then stimulated by addition of 100 IU/ml rhIL-2 for another 24 h. This method reproducibly yielded a culture containing 50 to 60% CD3-negative/CD56-positive NK cells.
Isolation and stimulation of murine splenocytes
| ↓29 |
Mice were sacrificed, spleens removed and placed into a 3-cm dish containing RPMI 1640 medium. Organs were minced and the cell suspension centrifuged at 200 x g for 5 min. Cells were taken up in 2 ml ACK lysis buffer per spleen for 90 s to lyse red blood cells. The reaction was stopped by addition of 25 to 50 ml medium. After centrifugation cells were washed in 20 ml medium, filtered using a cell strainer (BD) and finally seeded in T150 tissue culture flasks at a density of 2 x 106 cells/ml. For stimulation, 1 µg/ml anti-mCD3 antibody, 0.1 µg/ml anti-mCD28 antibody and 10 IU/ml rhIL-2 were added.
|
ACK lysis buffer: |
150 |
mM |
NH4Cl (Merck) |
|
1 |
mM |
KHCO3 (Roth) |
|
|
0.1 |
mM |
Na2EDTA (Roth) |
|
|
pH 7.2 | |||
Transient transfection by calcium phosphate precipitation
For transient transfection of cells, calcium phosphate precipitation was used. Per well,
7 to 9 x 105 Plat-E or 293T cells were seeded in 3 ml medium into 6-well plates one day before transfection. This way, cells were about 60% confluent at the time point of transfection.
| ↓30 |
|
Precipitation mix per well: |
18 |
µg |
total DNA) |
|
|
15 |
µl |
CaCl2 2.5M (Sigma) |
||
|
ad |
150 |
µl |
H2O |
After mixing DNA, CaCl2 and H2O in 15-ml polystyrene tubes (Greiner), 150 µl transfection buffer were added dropwise while vortexing the mix. After 15 min at room temperature, when DNA had complexed with CaPO4 precipitates, 300 µl were added per 6-well. After 6 h incubation, medium was exchanged.
|
Transfection buffer: |
16 |
g |
NaCl |
|
|
740 |
mg |
KCl |
||
|
500 |
mg |
NaHCO3 (Roth) |
||
|
10 |
g |
HEPES |
||
|
ad |
1 |
l |
H2O |
|
|
pH 6.75 |
||||
Production of retrovirus supernatant and transduction of T cells
| ↓31 |
For transduction of murine cells, ecotropic retrovirus was produced by transient transfection of the packaging cell line Plat-E with 18 µg viral vector DNA per well of a 6-well plate. Human T cells were transduced with supernatant generated by transiently transfecting 293T cells with 6 µg pcDNA3.1gag/pol, 6 µg pALF-10A1GaV and 6 µg viral vector DNA per well of a 6-well plate. 48 h after transfection, virus supernatant was harvested, filtered using 0.45-µm pore-size filters (Whatman) and either used directly for transduction or stored at -80°C until use.
To increase transduction efficiency, 6-well or 24-well non-tissue culture plates were coated with 25 µg/ml RetroNectin CH-296 (RN, TaKaRa Biomedicals) by adding 400 µl to 24-wells or 1 ml to 6-wells and incubating for 2 h at room temperature. For blocking the same volume of a 2% BSA solution was added and plates were incubated at 37°C for 30 min. After rinsing the wells with 2.5% HEPES in PBS, cells and viral supernatant were added. To facilitate efficient fusion of the retrovirus envelope with the cell membrane, 4 µg/ml protamine sulphate was applied. Then, plates were spinoculated at 800 x g and 32°C for 90 min.
Depending on the cell type to transduce, different protocols were employed.
| ↓32 |
Expression of the virus-encoded transgene was usually analyzed 72 h after transduction by flow cytometry.
Flow cytometry
For staining of cell surface antigens, about 5 x 105 cells were incubated with 1 µg antibody in 100 µl PBS at 4°C for 20 to 40 min. Subsequently cells were washed twice in
1 ml PBS and, if necessary, the procedure was repeated with a secondary antibody. Finally cells were taken up in 200 µl PBS and fluorescence intensity was measured with a
FACSCalibur device and CellQuestPro software (BD). Data analysis was performed with FlowJo software (Tree Star). To discriminate between living and dead cells, staining with propidium iodide (PI, Sigma) or 7-amino-actinomycin D (7-AAD, BD) was accomplished by adding the substances to the cells 10 min before measurement without a washing step.
| ↓33 |
For the flow cytometric analysis of peripheral lymphocytes of mice, 50 µl blood were mixed with 50 µl PBS and 1 µg antibody and incubated at room temperature for 30 min. If blood was derived from Rag-1-/- mice, samples were pre-incubated with 1 µg anti-CD16/32 antibody for 5 min to block Fc receptors. Red blood cells were lysed using FACS Lyse/Wash Assistant (BD) and samples were measured as described.
Fluorescence-activated cells sorting (FACS)
FACS was performed to enrich cells for a certain surface antigen using a specific antibody. For this, about 2 x 107 cells were centrifuged, taken up in 500 µl PBS and about 10 to 20 µg of antibody were added. Cells were incubated at 4°C for 30 min and subsequently washed twice in 10 ml FACS-PBS. If necessary, the labeling was repeated with a secondary antibody. Before sorting, cells were filtered using a cell strainer, centrifuged and finally taken up in 2 ml FACS-PBS. Sorting was performed with a FACSAria or FACSVantage device (both BD). Sorted cells were collected in FACS-RPMI, centrifuged and taken up in the appropriate medium additionally supplemented with 10 µg/ml gentamycin (Gibco) and 200 U/ml Pen/Strep to prevent bacterial contamination. Sorting results were analyzed by flow cytometry.
|
FACS-PBS: |
1 |
% |
inactivated FCS |
|
200 |
U/ml |
antibiotic / fungicide mix (Gibco) |
|
|
in PBS |
| ↓34 |
|
FACS-RPMI: |
15 |
% |
inactivated FCS |
|
200 |
U/ml |
Pen/Strep |
|
|
10 |
µg/ml |
gentamycin |
|
|
10 |
mM |
HEPES |
|
|
in |
RPMI + GlutaMAX I |
||
Magnetic-activated cell sorting (MACS)
MACS was applied for sorting of myc-positive PBLs as they appeared to be too sensitive to FACS. Cells (5 x 107 to 1 x 109) were centrifuged and taken up in running buffer (0.8 ml per 1 x 108 cells) and anti-myc microbeads (200 µl per 1 x 108 cells, µMACS c-myc tagged protein isolation kit human, Miltenyi Biotec). After 20 min incubation at 4°C, PBLs were washed twice in running buffer, filtered using a cells strainer and finally taken up in 500 µl running buffer. MACS LS separation columns (Miltenyi Biotech) were fixed in a magnet (Miltenyi Biotec), equilibrated with 3 ml running buffer and cells were applied. The columns were washed 3 times with 3 ml running buffer, before removing them from the magnet. Bead-labeled cells, that had bound to the column were eluted with 5 ml running buffer, centrifuged and taken up in the appropriate medium. After sorting, PBLs had to be restimulated.
|
Running buffer: |
2 |
% |
EDTA (Roth) |
|
1 |
% |
FCS |
|
|
in |
Mg2+ and Ca2+ free PBS (Gibco) |
||
Peptide-specific restimulation of PBLs
| ↓35 |
T2 cells were incubated with 10 µM peptide in serum-free medium for 2 h at 37°C, irradiated with 63 Gy and washed twice. Per well of a 24-well plate, 1 x 106 PBLs were seeded together 1 x 105 peptide-loaded T2 cells in 1.5 ml medium supplemented with 150 IU/ml rIL-2. Cells proliferated for 1 to 2 weeks; then IL-2 concentration was decreased to 10 IU/ml to allow PBLs to enter resting phase. Immunologic assays were performed 2 to 3 days thereafter.
Cytokine release assay
Target cells (T2, T2-Kb or splenocytes) were incubated with different amounts of peptide in serum-free medium at 37°C for 2 h and washed twice. Per well, 1 x 105 effector cells were co-cultured with peptide-loaded targets in a 1:1 ratio in 96-well round-bottom plates (Corning Costar, Munich, Germany) at 37°C for 24 h. The supernatant was harvested, frozen and later tested for human IFN-γ or murine IL-2 amount by enzyme-linked immuno-sorbent assay (ELISA; sensitivity 4 or 2 pg/ml, respectively; eBioscience) according to the manufacturer’s instructions.
Complement-mediated cytotoxicity (CDC) assay
Exponentially growing cell lines or Ficoll-purified PBLs were seeded in a 96-well plate (Corning Costar) with 1 x 105 cells/well in depletion medium (RPMI 1640 medium supplemented with 25 mM HEPES and 0.3% BSA). Cells were labeled with 1 µg myc-specific antibody/well (clone 3A7) at 4°C for 1 h, washed and incubated with rabbit complement (for murine T cell lines: LOW-TOX-M; for PBLs: Rabbit Complement MA, both Cedarlane) diluted 1:6 to 1:12 in depletion medium at 37°C for 2 h. For live and dead cell discrimination, cells were stained with 1 µg PI or 3 µl 7-AAD for 10 min and analyzed by flow cytometry. Cells incubated with either antibody or complement alone served as controls. Percent of specific depletion was calculated as [% cytotoxicity (antibody+complement) – % cytotoxicity (complement alone)] / [100% – % cytotoxicity (complement alone)] x 100.
Antibody-dependent cell-mediated cytotoxicity (ADCC) assay
| ↓36 |
TCR-transduced PBLs which had been enriched by MACS and subsequently restimulated were used as targets and autologous NK cells as effectors. Lysis was performed by incubating 5 x 103 51Cr-labeled target cells (100 µCi per sample) with effector cells in E:T ratios from 50:1 to 2:1 in the presence of 1 µg myc-specific antibody (clone 9E10) and 1 µg rabbit anti-mouse IgG1-Fc polyclonal antibody. After 4 h co-cultivation, 75 µl of supernatant was transferred onto LumaPlates-96 (Perkin Elmer) which were allowed to air-dry. Scintillation was analyzed using a TopCount device (Perkin Elmer). Spontaneous release was measured by incubating target cells alone, maximum release by directly counting labeled cells. Percent specific lysis was calculated as [cpm (experimental) – cpm (spontaneous)] / [cpm (maximal) – cpm (experimental)] x 100.
Adoptive T cell transfer
If not stated otherwise, RIP-mOVA mice were sub-lethally irradiated with 4 Gy one day before adoptive transfer. Age- and sex-matched recipient mice were injected in the tail vein with 2 x 107 (RIP-mOVA mice) or 5 x 106 (Rag-1-/- mice) TCR-positive splenocytes (as determined by FACS staining) one day after the second transduction. For depletion of adoptively transferred cells, 500 µg myc-specific antibody (clone 9E10) were injected intraperitoneally (i.p.) 2 d (RIP-mOVA) or 13 d (Rag-1-/-) after adoptive transfer. Expansion and depletion of cells was monitored by flow cytometry of blood samples. Diabetes development in RIP-mOVA mice was followed by measuring blood glucose levels with Ascensia ELITE SENSOR strips (Bayer, Leverkusen, Germany). Mice with blood glucose levels higher than 14 mM at two consecutive days were considered diabetic.
Immunohistochemical (IHC) staining
The pancreas of sacrificed mice was embedded in Tissue Tek (Sakura Finetek) and frozen in liquid nitrogen. Microsections of the organs were prepared, mounted on microscope slides and fixed with acetone. Slides were pre-incubated subsequently with Protein Block (Immunotech) and PBS/1% BSA/1% donkey serum. Ova antigen was stained with a polyclonal rabbit anti-ova antibody (Acris) and secondary donkey anti-rabbit coupled to Alexa594 (Molecular Probes). CD8-positive cells were detected with rat anti-CD8α antibody (BD) and secondary donkey anti-rat antibody coupled to Alexa488 (Molecular Probes). Nuclei were visualized with DAPI. Images were obtained with Axiovert 200 microscope and AxioVision Rel. 4.5 software (both Zeiss).
| ↓37 |
Acris (Hiddenhausen, Germany)
Amersham (Buckinghamshire, UK)
ATCC (Manassas, USA)
| ↓38 |
BD (Heidelberg, Germany)
Biochrom (Berlin, Germany)
Biosyntan (Berlin, Germany).
| ↓39 |
Biozym (Hess. Oldendorf, Germany)
Caltag Laboratories (Karlsruhe, Germany)
Cedarlane (Hornby, Canada)
| ↓40 |
Charles River (Sulzfeld, Germany)
Chiron (Marburg, Germany)
CILAG (Sulzbach, Germany)
| ↓41 |
eBioscience (San Diego, USA)
Fermentas (St. Leon-Rot, Germany)
Gibco (Karlsruhe, Germany)
| ↓42 |
Greiner Bio-One (Frickenhausen, Germany)
Immunomics (Fullerton, USA)
Immunotech (Marseille, France)
| ↓43 |
Invitek (Berlin, Germany)
Invitrogen (Karlsruhe, Germany
Jackson ImmunoResearch (West Grove, USA)
| ↓44 |
Merck (Darmstadt, Germany)
Miltenyi Biotec (Bergisch Gladbach, Germany)
Molecular Probes (Karlsruhe, Germany)
| ↓45 |
MP Biomedicals (Eschwege, Germany)
MWG Biotech (Ebersberg, Germany)
Nalgene (Rochester, USA)
| ↓46 |
NEBiolabs (Frankfurt a.M., Germany)
PAN Biotech (Aidenbach, Germany)
Perkin Elmer (Waltham, USA)
| ↓47 |
Qiagen (Hilden, Germany)
Roche (Grenzach-Whylen, Germany)
Roth (Karlsruhe, Germany)
| ↓48 |
Sakura Finetek (Zoeterwoude, Netherlands)
Santa Cruz (Santa Cruz, USA)
Sigma (Taufkirchen, Germany)
| ↓49 |
TaKaRa Biomedicals (Otsu, Japan)
Techno Plastic Products (Trasadingen, Switzerland)
The Jackson Laboratory (Bar Harbor, USA)
| ↓50 |
TIB MOLBIOL (Berlin, Germany)
Tree Star (Ashland, USA)
Whatman (Middlesex, UK)
| ↓51 |
Zeiss (Oberkochen, Germany)
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 4.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML-Version erstellt am: 23.08.2010 |