[Seite 116↓]

5  Material

5.1 Laborgeräte

Autoklav

Varioklav, Oberschleißheim

Blot-Apparatur (Semidry-Blot)

LMS, Dossenheim

CO2-Inkubationsschrank

Heraeus Christ, Zürich

Flureszensmikroskop

Zeiss, Oberkochen

Gelelektrophorese-Apparatur

AGS, Heidelberg

Minigelapparatur, Midget

Pharmacia Biotech, Freiburg

PCR-Gerät, PTC-200

MJ Research; Waltham

Plattenphotometer, MRX

Dynatech, Denkendorf

Sequenzier-Apparatur

Pharmacia, Freiburg

Spektralphotometer

Eppendorf, Hamburg

Szintillationsspektrometer, 1450 MicroBetaTrilux

Wallac, Finnland

Umkehrmikroskop, Labovert

Leica, Wetzlar

Videodokumentationsgerät

Herolab, Wiesloch

Zellernter

Wallac, Finnland

5.2 Verbrauchsmaterialien

Dialysemembranen

Serva, Heidelberg

 

Einmal-Sterilfilter (0,2 µm), Gel-Blotting-Papier

Schleicher & Schüll, Dassel

 

ELISA-Platten, MaxiSorp

Nunc, Wiesbaden

 

Glasperlen (0,5 mm)

Braun Biotech, Melsungen

 

Nitrocellulosemembran (0,2 µm)

Pharmacia Biotech, Freiburg

 

Zellkultur- und Mikrotiterplatten

Costar, Bodenheim

 

Glasfaserfilter, Filtermat A; Szintillationswachs MeltiLex A

Wallac, Finnland

 

Dynabeads® Oligo (dT)25

Dynal, Norwegen

 

Ni-NTA-Matrix

Qiagen, Hilden

5.3 Chemikalien, Sonstiges


[Seite 117↓]

Ampicillin, Tetracyclin, Kanamycin, BSA (Fraktion V)

AppliChem, Darmstadt

Bacto-Agar, -Trypton, Hefeextrakt, Taurodexycholat

DIFCO, Hamburg

Magermilchpulver

Fluka, Deisenhofen

Dulbeccos MEM, L-Glutamin, Hank's Medium, Penecillin/Streptomycin, RPMI-1640 mit HEPES, FCS, Glycerin, Trypsin/EDTA (0,25/0,02%),

GIBCO/BRL, Karlsruhe

Na-Heparin, Liquemin

Hofman La Roche, Grenzach

3H-Thymindin

ICN, Eschwege

Organische Lösungsmittel, DMF, DMSO, Glaswolle

Merck, Darmstadt

ConA, Ficoll-Hypaque, Proteingewichtsmarker

Pharmacia Biotech, Freiburg

Acrylamid-Bisacrylamid-Lsg. (30 %), Ammonium-peroxidisulfat (APS), Agarose, Dextrose, Glaswolle, Natriumhypochlorid, Nylonwolle, Puffersalze (p.A.), Raffinose, TEMED, Triton X-100, Tween-20,

Roth, Karlsruhe

Antimycin A, BCIP, Coomassie-Blau R 250, DE-52 Zellulose, Dithiothreitol (DTT), FCA, FIA, Iscove's MDM, IPTG, LPS, Naphthylethylen, NBT, PNPP, Ponceau S, Sulfanilamid, TRIS, Trypan-Blau, Tryptophan dropout-Pulver, YNB

Sigma, München

5.4 Kommerzielle Kits und Enzyme

BCA-Proteinbestimmungs-Kit

Pierce, USA

Dynabeads-mRNA-DIRECT-Kit

Dynal, Norwegen

Geltrockner-Kit, pGEM-T-Vektorsystem, RT (M-MLV), Taq-Polymerase, DNase

Promega, Heidelberg

Nucleobond-Maxi-Kit, Nucleospin-Plasmid-Kit, NucleoTrap-Gel-Extraktion-Kit

BD Clontech, Heidelberg

PegGOLD-RNApure

pegLab, Erlangen

Sequenase-Sequenzier-Kit

Amersham, USA

SuperScript-cDNA-Synthesis-Kit (E. coli DNA Ligase, E. coli DNA Polymerase I, E. coli RNase H, RT-Superscript II, T4- Polynukleotidkinase, T4 DNA-Polymerase)

Life Technologies

Lysozym

Roth, Karlsruhe

Restriktionsenzyme, T4-DNA-Ligase

NEB, Frankfurt

FuGENE

Roche, Mannheim

5.5 Antikörperkonjugate, Immunchemikalien


[Seite 118↓]

Kaninchen-anti-Ziege-IgG-AP(ELISA, 1:1500)

Dianova, Hamburg

Kaninchen-anti-E. tenella (OAg)-Serum (Blot, 1:200)

Charles River, Kisslegg

Maus-anti-EGFP-Serum (Blot, 1:200)

G. Meusel, im Haus

Maus-anti-myc-Ak (Blot, 1:5000)

Invitrogen, Karlsruhe

Maus-anti-Poly 6xHis-Ak (Blot, 1:1000)

Quiagen, Hilden

Ziege-anti-Huhn-IgA-Fc (ELISA, 1:1000)

Bethyl, USA

Ziege-anti-Huhn-IgG-Fc (ELISA, 1:1000)

Bethyl, USA

Ziege-anti-Kaninchen-IgG-AP(Blot, 1:1500)

Dianova, Hamburg

Ziege-anti-Maus-IgG-AP (Blot, 1:1500)

Dianova, Hamburg

5.6 Tiermaterial und permanente Zelllinien

"Weiße Leghorn" Hühner

Versuchsstation Tierzucht, Blumberg

Eimeria tenella (Houghton-Stamm)

Frau Dr. Giesela Greif, Abteilung Parasitologie, Bayer AG, Monheim

Hühnermonozytenzelllinie (HD11)

Dr. Phi Van, BFA für Landwirtschaft, Zelle

Affennierenzelllinie (COS-7)

S. Hartmann, im Haus

5.7 Bakterienstämme, Hefestämme und Plasmide

Escherichia coli XL1- Blue

Stratagene,Heidelberg

pCDNA3

Invitrogen, Karlsruhe

pGEM-T

Promega, USA

pQE30

Qiagen, Hilden

pQE30-Etmic1,-SO7,-TA4

Dr. T. Pogonka, im Haus

pSUC2T7M13ORI (pSUC2)

Genetics Institute, USA

pVR1012

Vical, USA

Saccharomyces cereviciea YTK12 (suc2 - , trp -)

Genetics Institute, USA

pCDNA3-chIL-18

K. Schneider, Institut für Medizin, Universität Freiburg

5.8 Oligonukleotide, Adaptoren


[Seite 119↓]

H01_F2 (HindIII)

CAAGCTTATGTCACCTGAGCCCCCTCCT

H01_R1 (XhoI)

TCGCTCGAGTCAGTCTTCGCGCTCGG

H03_F2 (HindIII)

GCAAGCTTATGGTTAAGTTGGGCAGCTCT

H03_R1 (XhoI)

CGCTCGAGCTAGTCCGCCTGGGCCTCG

H04_F2 (HindIII)

CAAGCTTGATGGATGTTGGCGTTTACTCTC

H04_R1 (XhoI)

CGCTCGAGTTAATTTCTCTTCGAGGC

H07_F2 (HindIII)

CAAGCTTGATGCAGGAAGAAGAAGGGTCC

H07_R1 (XhoI)

CGCTCGAGTCATACTGCAGCCATCCCAAG

H09_F2 (BamHI)

CGGGATCCATGGCTGCAGTCCGGGAAGG

H09_R1 (XhoI)

CCCTCGAGTCACCGGAGAGCAATGAAG

H11_F2 (BamHI)

CGGGATCCCATGAACTCACAAGAAACTGA

H11_R1 (XhoI)

CCTCGAGTCATAGAGTCATAATGCCGAACG

H13_F2 (BamHI)

CGGGATCCCATGGAGCGTTCAACAATC

H13_R1 (XhoI)

CGCTCGAGTCAAGATCGACTTTGTTGTC

H14_F2 (HindIII)

CCAAGCTTATGTTAACTGCCTTTTATCT

H14_R1 (XhoI)

CGCTCGAGTTATTGCTTTACAGTGATA

H15_F2 (HindIII)

CCAAGCTTATGAACTGTGGAACGCAAGGA

H15_R1 (NotI)

CGCGGCCGCCTACCTCTGTAACGCAACG

H24_F2 (HindIII)

CAAAGCTTATGCTCACCGGCACAGCGACA

H24_R1 (XhoI)

CGCTCGAGTCAATCCCTCAAATCGATG

H28_F2 (HindIII)

CCAAGCTTATGGGGCAGACCATTGATGTC

H28_R1 (XhoI)

GGCTCGAGCTACAGACTCCAAAGTACAG

H35_F2 (HindIII)

CCAAGCTTATGTCAGATGATGGCAGCAAC

H35_R1 (XhoI)

CGCTCGAGCTACTGCTCGCCGTTGCCAGC

H36_F2 (HindIII)

CCAAGCTTATGCTGTCAAGGAAGGCCTTA

H36_R1 (XhoI)

CGCTCGAGTCACGAATAGATCAGGACGC

Zufallsprimer (XhoI)

CGATTGAATTCTAGACCTGCCTCGAGNNNNNNNNN

EcoRI-Adaptor

AATTCGCGGCCGCGTCGAC

pGTCGACGCGGCCGCG

Sequenzierprimer für cDNA in pSUC2

Cy5-CCTCGTCATTGTTCTCGTTCCCTT

cDNA-F (für pSUC2)

CCTCGTCATTGTTCTCGTTCCCTT

cDNA-R (für pSUC2)

GGTGTGAAGTGGACCAAAGGTCTA

myc-Oligo1

AGCTATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAAGCTTGGTAC

myc-Oligo2

CAAGCTTCAAGTCCTCTTCAGAAATGAGCTTTTGCTCCAT

EtMIC-F10 (BamHI)

GCGGATCCATGAGCCTCTTGGATGTCAT

EtMIC-R10 (XbaI)

CCTCTAGATTAGGATGCCCACATCTCTGA

EtMIC-F11 (HindIII)

CGCAAGCTTATGAGCCTCTTGGATGTCAT

EtMIC-R11 (BamHI)

GTGGATCCCTGGATGCCCACATCTCTGA

SO7-F10 (BamHI)

GCGGATCCATGGCTGTTGCTGCAGCAGATTT

SO7-R10 (XbaI)

CCTCTAGACTACCAGAAGAAGCCGGAGGG

SO7-F11 (HindIII)

CGCAAGCTTATGGCTGTTGCTGCAGCAGATTT

SO7-R11 (BamHI)

CTGGATCCTGCCAGAAGAAGCCGGAGGG

TA4-F10 (BamHI)

GCGGATCCATGCAGGATTACCCAACAG

TA4-R10 (XbaI)

GATCTAGACTAAAAGAGCGAAAGCGGAGA

TA4-F11 (HindIII)

CGCAAGCTTATGCAGGATTACCCAACAGT

TA4-R11 (BamHI)

GTGGATCCCTAAAGAGCGAAAGCGGAGA

IFN-γ-F3 (EcoRI)

CGGAATTCATGACTTGCCAGACTTAC

IFN-γ-F4 (SalI)

CGGTCGACATGACTTGCCAGACTTAC

IFN-γ-R3 (XbaI)

CGTCTAGATTAGCAATTGCATCTCT


[Seite 120↓]

5.9  Puffer, Medien und Stammlösungen

Allgemein

Griess-Reagenz

0,1 % (w/v) Naphthylethylen

1,0 % (w/v) Sulfanilamid

in 2,5 % Phosphorsäure (H3PO4)

H2O

deionisiertes Wasser (Millipore) mit einer Leitfähigkeit kleiner 15 mSi

PBS

136,9 mM NaCl

2,7 mM KCl

8,1 mM Na2HPO4
1,5 mM KH2PO4
pH 7,4

TE-Puffer

1 mM EDTA

10 mM Tris-HCl, pH 7,4-8,0

Bakterienlösungen

LB-Medium

10 g/l Bacto-Trypton

5 g/l Hefeextrakt

10 g/l NaCl

pH 7,0

SOB-Medium

20 g/l Trypton

5 g/l Hefeextrakt

0,5 g/l NaCl

2,5 ml/l 1 M KCl

0,2 ml/l 5 N NaOH

SOC-Medium

SOB + 20 mM Glukose

Agar-Platten

LB-Medium mit 1,5% Bacto-Agar

10x Hogness-Einfriermedium

36 mM K2HPO4
13 mM KH2PO4
20 mM Na-Citrat
10 mM MgSO4
40% Glyzerin

Na-Ampicillin

50 mg/ml

Tetracyclin-HCl

10 mg/ml in Ethanol

Kanamycin

25 mg/ml

Hefemedien


[Seite 121↓]

YPD-Medium

10 g/l Hefeextrakt

20 g/l Pepton

20 g/l Dextrose

YPRAA-Medium

10 g/l Hefeextrakt

20 g/l Pepton

20 g/l Raffinose

1 ml/l AntimycinA (50 mg/ml)

CMD-W-Medium

1,7 g/l YNB

5 g/l Ammoniumsulfat

20 g/l Dextrose

1,9 g/l Tryptophan dropout-Pulver

Agarplatten

Medium mit 2 % Bacto-Agar

2 x Einfriermedium

Medium mit 30 % Glyzerin

Saccharoselösung, gepuffert

(Invertasetest)

5 % Saccharoselösung

10 mM Acetatpuffer, pH 4,7

Entwicklungslösung

(Invertasetest)

0,1 % 2,3,5,-Triphenylterazoliumchlorid (TTC) in 1 N NaOH

Zellkulturmedien für eukaryotische Zellen

RPMI 1640-Vollmedium

(für PBL und Milzzellen)

457,5 ml RPMI 1640

12,5 ml L-Glutamin (2,5%)

5 ml Penicillin/Streptomycin(100 U/ml und 100 µg/ml)

25 ml FCS (5%) (Hitze-inaktiviert)

Trypan-Blau-Lösung

160 mg Trypan-Blau in 100 ml PBS

Iscove's Vollmedium

(für HD11-Zellen)

425 ml Iscove's MDM

50 ml FCS (Hitze-inaktiviert)

20 ml L-Glutamin

5 ml Penicillin/Streptomycin(100 U/ml und 100 µg/ml)

Dulbeccos-Vollmedium

(für COS-7-Zellen)

425 ml Dulbeccos-MDM

50 ml FCS (Hitze-inaktiviert)

20 ml L-Glutamin

5 ml Penicillin/Streptomycin(100 U/ml und 100 µg/ml)

Einfriermedium

9 Teile Vollmedium

1 Teil DMSO

DEAE-Dextran-Transfektionsreagenz

10 mg/ml DEAE-Detran, in PBS

2,5 mg/ml Chloroquine, in PBS

Aufreinigung von E. tenella-Sporozoiten


[Seite 122↓]

Exzystierungsmedium

5 g Taurodeoxycholat

10 ml Trypsinlösung (Aktivität 1:250)

in 125 ml Hank's-Medium

2 x Phosphatpuffer

190 mM Na2HPO4
13 mM NaH2PO4
0,85 % NaCl
pH 8,0

Phosphatpuffer/Glukose

1 x Phosphatpuffer

1 % Glukose

Aufreinigung von pQE-30-Expressionsprodukten

Puffer A

6 M Guanidiumhydrochlorid
120 mM NaH2PO4
10 mM Tris-HCl, pH 8,0

Puffer B

8 M Harnstoff

100 mM Na H2PO4

10 mM Tris-HCl, pH 8,0

Puffer C

wie Puffer B, pH 6,3

Puffer E

wie Puffer B, pH 4,0

Herstellung kompetenter Bakterien und Hefen

Transformationspuffer (für E. coli)

10 mM Pipes
55 mM MnCl2
15 mM CaCl2
250 mM KCl

Lithiumacetatlösung (für Hefe)

1 Vol 10 x TE-Puffer, pH 7,5

1 Vol 10 x Lithiumacetat (1 M, pH 7,5)

8 Vol MilliQ-H2O

PEG-Lösung (für Hefe)

1 Vol 10 x TE-Puffer, pH 7,5

1 Vol 10 x Lithiumacetat (1 M, pH 7,5)

8 Vol 50 % (w/v) PEG 4000

Plasmidisolation aus Bakterien und Hefen

Lysepuffer I (für Hefe)

1% Triton X-100
2 mM EDTA
20 mM Tris-HCl, pH 8,9

Lysepuffer II (für Hefe)

100 mM NaCl

1 mM EDTA

0,1 % SDS

10 mM Tris-HCl, pH 8,0

STET-Puffer (für E. coli)

8 % Sacharose

0,1 % Triton X-100

50 mM EDTA

50 mM Tris-HCl, pH 8,0

CTAB-Lösung (für E. coli)

10 % in H2O

Agarosegelelektrophorese


[Seite 123↓]

10 x TBE

900 mM Tris-HCl

900 mM Borsäure

20 mM EDTA, pH 8,0

10 x Ladepuffer

25 % Ficoll

0,1 % Bromphenolblau

0,1 % Xylencyanol FF

SDS-PAGE

Acrylamidlösung (30%)

30% Acrylamid (w/v)

0,8% Bisacrylamid (w/v)

Sammelgelpuffer

1,0 M Tris-HCl, pH 6,8

Trenngelpuffer

1,5 M Tris-HCl, pH 8.8

2 x Probenpuffer

125 mM Tris-HCl, pH 6,8

4% SDS

20% Glyzerin

0,1% BPB

100 mM DDT

Elektrophoresepuffer

250 mM Glycine

25 mM Tris-HCl, pH 8,3

0,1% SDS

Färbelösung

0,1% Coomassie-Blau R-250

20 % Methanol

10 % Essigsäure

Entfärbelösung

30% Ethanol

10% Essigsäure

Gebrauchslösung

Trenngel 15% (10 ml)

Sammelgel 5 % (2ml)

H2O

2,3 ml

1,4 ml

Acrylamidlösung

5,0 ml

0,33 ml

Sammelgelpuffer

-

0,25 ml

Trenngelpuffer

1,3 ml

-

10 % SDS

0,1 ml

20 µl

10 % APS

0,1 ml

20 µl

TEMED

4 µl

2 µl

Immunblot


[Seite 124↓]

Blockierungspuffer

5 % Magermilchpulver in PBS

Transferpuffer

48 mM Tris-HCl

39 mM Glycin

0,037% SDS

20% Methanol

Ponceau-Stammlösung

2% PonceauS

30% Trichloressigsäure

30% Sulfobenzoesäure

Waschpuffer

0,2 % Triton X-100 in PBS

AP-Puffer

100 mM Tris-HCl, pH 9,5
100 mM NaCl

5 mM MgCL2

NBT-Stammlösung

75 mg/ml in 70% DMF

BCIP-Stammlösung

50 mg/ml in 100% DMF

AP-Substratlösung

66 µl NBT-Stamm-Lösung

33 µl BCIP-Stamm-Lösung

10 ml AP-Puffer

ELISA

Beschichtungspuffer (Puffer I)

0,2 M Na-Carbonat, pH 9,4-9,7

(aus 0,2 M NaHCO3 und 0,2 M Na2CO3 )

0,02 % NaN3

ELISA-Puffer II

0,1 % Tween 20
3 % BSA
in PBS, pH 7,2

ELISA-Puffer III

Puffer I

1 mM MgCl2

Waschpuffer

0,9 % NaCl

0,1 % Tween 20

PNPP-Substratlösung

unmittelbar vor Messung 1 x Substrattablette Sigma 104-105 in 5 ml ELISA-Puffer III lösen.

Kopplung von Peptiden an BSA

BSA

myc-Peptid

Glutaraldehyd

0,8 mg/ml

0,4 mg/ml

0,08 %

in 0,1 M NaHCO3

Sequenzierung

Polyacrylamid-Gel

9 ml Acrylamidlösung (40 %)

25,2 g Harnstoff

3,6 ml 10 x TBE
27 ml MilliQ-H 2 O
60 µl TEMED
250 µl APS (10%)

Puffer zur enzymatischen Modifizierung von DNA


[Seite 125↓]

10 x PCR-Puffer

500 mM KCl

100 mM Tris-HCl, pH 9,0

15 mM MgCl2

1 % Triton X-100

5 x RT-Puffer (für M-MLV)

250 mM Tris-HCl.pH 8,3

375 mM KCl

15 mM MgCl2
50 mM DTT

10 x Ligasepuffer

500 mMTris-HCl, pH 7,5

100 mM MgCl2

100 mM DTT

10 mM ATP

150 µg/ml BSA

10 x DNase-Puffer

400 mM Tris-HCl, pH 8,0

100 mM MgSO4
10 mM CaCl 2

5 x T4 Polynukleotidkinase-Puffer

300 mM tris-HCl, pH 7,6

50 mM MgCl2

5 mM ATP

5 x Zweitstrang-Puffer

100 mM Tris, pH 6,9

450 mM KCl

23 mM MgCl2

0,75 mM NAD+

50 mM (NH4)2SO4

Datenbanken und Web-Services

E. tenella-EST-Datenbank (Tigr)

http://www.tigr.org/tigrscripts/tgi/T_index.cgi?

species=e_tenella

Apikpmplexa-EST-Datenbank

http://www.cbil.upenn.edu/apidots/

E. tenella-Genom und EST-Datenbank (Sanger)

http://www.sanger.ac.uk/Projects/E_tenella/

blast-Service

http://www.ncbi.nlm.nih.gov/BLAST/

diverse Sequenzanalysen

http://www.ebi.ac.uk/services/

blast-Surver für Parasiten-EST

http://www.ebi.ac.uk/blast2/parasites.html

SignalP (Nielsen et al. 1997)

http://www.cbs.dtu.dk/services/SignalP/)


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
18.05.2005