4 Methoden

4.1  Klonierungen / Konstrukte

4.1.1  Bereitgestellte Vektoren zur Expression von GFP-GLI3-Fusionsproteinen in eukaryotischen Zelllinien

↓27

Tab.1.1: Vektoren zur Expression von GFP-GLI3-Fusionsproteinen

Plasmidbezeichnung

Vektor und Insert

Referenz

fpn1-396

GLI3-cDNA codierend für Aminosäure 1-396 in pEGFP-N2- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn1-422

GLI3-cDNA codierend für Aminosäure 1-422 in pEGFP-N3- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn1-667

GLI3-cDNA codierend für Aminosäure 1-667 in pEGFP-N2- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn1-828

GLI3-cDNA codierend für Aminosäure 1-828 in pEGFP-N3- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn1-1100

GLI3-cDNA codierend für Aminosäure 1-1100 in pEGFP-N3- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn1-1522

GLI3-cDNA codierend für Aminosäure 1-1522 in pEGFP-N1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpn824-1100

GLI3-cDNA codierend für Aminosäure 824-1100 in pEGFP-N3- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpc18-828

GLI3-cDNA codierend für Aminosäure 18-828 in pEGFP-C1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpc18-667

GLI3-cDNA codierend für Aminosäure 18-667 in pEGFP-C1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpc18-1100

GLI3-cDNA codierend für Aminosäure 18-1100 in pEGFP-C1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpc18-1549

GLI3-cDNA codierend für Aminosäure 18-1549 in pEGFP-C1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

fpc586-1549

GLI3-cDNA codierend für Aminosäure 586-1549 in pEGFP-C1- (BD Biosciences Clontech).

Dissertation M. Wessling (Freundlichst überlassen von K.-H. Grzeschik).

pBS-GLI3

vollständige GLI3-cDNA in pBluescript- (Stratagene).

Freundlichst überlassen von A. Vortkamp.

4.1.2 Herstellung der Vektoren zur eukaryotischen Expression von myc-GLI3- bzw. flag-GLI3-Fusionsproteinen

Die GLI3-cDNA kodierend für Aminosäure 18-1580 wurde aus dem Plasmid pBS-GLI3 (siehe Tab.1.1) mit dem Restriktionsenzym EcoRI (NEB) ausgeschnitten und in die Vektoren pCMVTag2A (Stratagene) bzw. pCMVTag3A (Stratagene) ligiert.

4.1.3 Herstellung der Vektoren zur eukaryotischen Expression von myc-MID1-Fusionsproteinen

Zu Beginn der Klonierung lag die gesamte MID1-cDNA (Quaderi et al., 1997) im pBluescript-Vektor (Stratagene) vor. Die komplette MID1-cDNA wurde mittels PCR mit den Primern 5MID1-Eco und 3MID1-Hind amplifiziert (Tab.1.7.1). Das PCR-Produkt wurde mittels PCR Purifikation Kit (Qiagen) aufgereinigt, mit den Restriktionsenzymen HindIII (NEB) und EcoRI (NEB) geschnitten und in den Vektor pCMVTag3A (Stratagene) ligiert.

↓28

Die MID1-cDNA-Sequenz codierend für die B-Box1-Domäne (Aminosäure 105-167) wurde mit den Primern 5BBox1-Eco und 3BBox1-Hind (Tab.1.7.1) mittels PCR amplifiziert und aufgereinigt. Das aufgereinigte PCR-Produkt wurde mit den Restriktionsenzymen HindIII (NEB) und EcoRI (NEB) geschnitten und sowohl in den Vektor pCMVTag2A (Stratagene) als auch in den Vektor pCMVTag3A (Stratagene) ligiert.

4.1.4 Herstellung der Vektoren zur eukaryotischen Expression von α4-V5-, myc-α4- bzw. flag-α4-Fusionsproteinen

Zu Beginn der Klonierung lag uns die gesamte α4-cDNA (RZPD, Deutsches Ressourcenzentrum für Genomforschung GmbH) in der multiple cloning site unter dem EF-1α-Promotor des pBUDCE4-Vektors (Invitrogen) vor. Die komplette α4-cDNA wurde mit den Primern alpha4-f1 und alpha4-r1 (Tab.1.7.1) mittels PCR amplifiziert. Das PCR-Produkt wurde mittels PCR Purifikation-Kit aufgereinigt (Qiagen), mit den Restriktionsenzymen HindIII (NEB) und SalI (NEB) geschnitten und sowohl in den Vektor pCMVTag2A (Stratagene) als auch in den Vektor pCMVTag3A (Stratagene) ligiert.

4.1.5 Vektoren zur eukaryotischen Expression von myc-GLI1- bzw. myc-mGli2-Fusionsproteinen

Ausgehend von den GLI1 bzw. mGli2 c-DNAs, die in pBluescript kloniert vorlagen (freundlichst von K.-H. Grzeschik zur Verfügung gestellt), wurde die GLI1-cDNA mittels PCR mit den Primern Gli-f1 und Gli-r2 (Tab.1.7.1) amplifiziert und aufgereinigt. Das aufgereinigte PCR-Produkt wurde mit den Restriktionsenzymen HindIII (NEB) und SalI (NEB) geschnitten und in den Vektor pCMVTag3A (Stratagene) ligiert. Die mGli2-cDNA wurde mit den Primern Gli2-f1 und Gli2-r2 (Tab.1.7.1) mittels PCR amplifiziert und aufgereinigt. Das aufgereinigte PCR-Produkt wurde mit den Restriktionsenzymen BamHI (NEB) und SalI (NEB) geschnitten und in den Vektor pCMVTag3A (Stratagene) ligiert.

4.1.6  Vektoren zur eukaryotischen Expression von V5-hFu-Fusionsproteinen

↓29

Die komplette Fu-cDNA im Vektor pBluescript wurde vom RZPD (Deutsches Ressourcenzentrum für Genomforschung GmbH, clone ID IRAKp961P0834Q2) bezogen. Mittels PCR mit den Primern Fu-f1 und Fu-r1 (Tab.1.7.1) wurde die Fu-cDNA amplifiziert, aufgereinigt und mit den Restriktionsenzymen NotI (NEB) und BglII (NEB) geschnitten. Anschließend erfolgte die Ligation in die EF-1α- gesteuerte multiple cloning site des pBUDCE4-Vektors (Invitrogen).

4.1.7 Primer

Tab1.7.1: verwendete Klonierungsprimer

Primername

Sequenz (5’-3’)

TA (°C)

5MID1-Eco

AGGAATTCGGAAACACTGGAGTCAGAA

53

3MID1-Hind

TAAGCTTGCTCACGGCAGCTGCTCTGT

58

5BBox-Eco

AGGAATTCGACCATGACCTCCGCCGAGAAG

59

3BBox-Hind

TAAGCTTGCAATTGGCTCAATCAGACG

53

alpha4-f1

ATATCAAGCTTAATGGCTGCTGAGGACGAGTTAC

62

alpha4-r1

CGAGGTCGACGGTCAGCCCATGTTCTGTCGGTTC

62

gli-f1

TCAAGCTTAATGACCCCACCACCAATCAG

59

gli-r2

GGTCGACGGGGCACTAGAGTTGAGGAATTC

57

gli2-f1

GCGGATCCCATGGAGACTTCTGCCCCAG

58

gli2-r2

GGTCGACGGGGGCCTTTAGGTCATCATG

56

fu-f1

CGCGGCCGCTTCATGGAAAAGTACCACGTGTTGG

58

fu-r1

CAGATCTCTCGACATGCTATGGGCTGGCCTC

63

4.1.8  Polymerase Chain Reaction (PCR)

Bei der PCR wird ein DNA-Abschnitt enzymatisch zwischen zwei Oligonucleotid-Primern, die gegenläufig an komplementäre DNA-Stränge gebunden sind, exponentiell vermehrt.

↓30

Die Oligonucleotid-Primer hybridisieren an komplementäre Regionen des zu amplifizierenden DNA Fragments. Die hitzestabile Taq-DNA-Polymerase hängt Nucleotide an die 3´-OH-Primer-Enden und synthetisiert das zwischen den Primern liegende DNA-Fragment. Darauf folgt ein neuer Zyklus bestehend aus Denaturierung, Hybridisierung, DNA-Synthese. Der Zyklus wird 20-50 mal wiederholt. Es handelt sich um eine Kettenreaktion, bei der winzige Mengen einer gegebenen DNA-Sequenz exponentiell amplifiziert werden.

Als PCR-Standard-Programm wurde in dieser Arbeit das folgenden Temperatur-Zeit-Profil angewendet:

↓31

Die Annealing-Temperatur wurde in Anlehnung der für die verwendeten Primer errechneten Annealing-Temperaturen (siehe Tab.1.7.1) gewählt. Die PCR-Reaktionen wurden unter Verwendung des Advantage 2 Polymerase Mix (Clontech) im mitgelieferten Puffer durchgeführt.

4.1.9 Aufreinigung der PCR-Produkte

Die PCR-Produkte wurden mit Hilfe des QIAquick PCR Purification Kits (Qiagen) aufgereinigt. Die Durchführung erfolgte nach den Angaben des Herstellers. Die Elution erfolgte in 30µl 1:10 verdünntem Puffer EB (Qiagen).

4.1.10  Restriktion

Die Restriktionen wurden in den vom Hersteller mitgelieferten Puffern nach den Angaben des Herstellers durchgeführt. Die zu den Klonierungen verwendeten Restriktionsenzyme sind tabellarisch aufgelistet:

↓32

Tab1.10.1: Restriktionsenzyme

Restriktionsenzym

Hersteller

EcoRI

NEB (New England Biolabs)

HindIII

NEB (New England Biolabs)

SalI

NEB (New England Biolabs)

BamHI

NEB (New England Biolabs)

NotI

NEB (New England Biolabs)

BglII

NEB (New England Biolabs)

4.1.11 Agarosegel-Elektrophorese

Die Elektrophorese in Agarose-Gelen dient der Auftrennung verschieden grosser DNA-Fragmente. Die Geschwindigkeit, mit der die DNA-Stücke durch Agarose-Gele im elektrischen Feld wandern, hängt von verschiedenen Bedingungen (Größe der DNA, Stromstärke, Pufferbedingungen, Agarose-Konzentration, Konformation der DNA) ab. Am wichtigsten ist hierbei die Größe der DNA: lineare, doppelsträngige DNA-Moleküle bewegen sich durch die Agarose-Matrix mit einer Geschwindigkeit, die umgekehrt proportional zum Logarithmus ihrer Größe ist.

In dieser Arbeit wurden die jeweiligen DNA-Proben mit 10% Bromphenolblau- oder Xylencyanolblau-Ladepuffer versetzt und auf 1%igen Agarose-Gelen (1g Agarose in 100ml TAE-Puffer, 5µl Ethidiumbromid [10mg/ml]) aufgetrennt. Die Gel-Läufe erfolgten in TAE-Puffer bei 100V. Als DNA-Standards wurden der 1kb Marker (GibcoBRL) oder Hyperladder I (Bioline) eingesetzt. Nach dem Gellauf wurden die Banden auf einem UV-Transilluminator sichtbar gemacht und mit einem Geldokumentationssystem (Herolab) analysiert.

4.1.12  DNA-Isolierung aus Agarose

↓33

Die jeweiligen Banden wurden aus den Agarose-Gelen ausgeschnitten und mit Hilfe des QIAquick Gel Extraction Kits (Qiagen) aufgereinigt. Die Durchführung erfolgte nach den Angaben des Herstellers. Die Elution erfolgte in 30µl 1:10 verdünntem Puffer EB (Qiagen).

4.1.13 Ligation

Die Ligation in die jeweiligen Vektoren erfolgte mit T4 DNA Ligase (Promega). Das Mengen-Verhältnis von Vektor zu Insert wurde nach folgender Formel berechnet:

↓34

Es wurden jeweils 100ng Vektor eingesetzt. Zu der DNA wurden 1µl 10xLigase Puffer (Promega) und 1µl T4 DNA Ligase (Promega) zugefügt (Reaktionsvolumen 10µl). Die Ansätze wurden 16h bei 16°C inkubiert.

4.1.14 Transformation

Die Ligationsansätze wurden jeweils mit 100µl einer Suspension von chemisch kompetenten E.coli Fusion Blue-Zellen (BD Biosciences) gemischt und 30min auf Eis inkubiert. Dann erfolgte ein Hitzeschock für 1,5min bei 42°C. Die Zellen wurden 2min auf Eis ausgekühlt und mit 1ml LB-Medium versetzt. Es erfolgte eine Inkubation bei 37°C für 1h. Anschließend wurde die Zellsuspension auf eine mit Antibiotikum supplementierte LB-Agar-Platte (nach Angabe des Vektorherstellers) ausplattiert und bei 37°C für 24h inkubiert.

4.1.15  Plasmid-DNA-Isolierung

Die DNA-Präparation aus 5ml-Flüssig-Übernachtkulturen wurde mit Hilfe des QIAprep Spin Miniprep Kits (Qiagen) nach dem mitgelieferten Protokoll durchgeführt. Um größere Mengen an DNA zu gewinnen, wurden 100ml-Flüssig-Übernachtkulturen angeimpft und die DNA mit Hilfe des QIAprep Spin Maxiprep Kits (Qiagen) nach den Angaben des Herstellers isoliert.

4.1.16 Sequenzierung

↓35

Zur Sequenzierung wurde der ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer Biosystems) benutzt. Die DNA (10ng pro 100bp) wurde in 7µl H2O aufgenommen und mit 1µl Primer (10pmol/µl) und 2µl Terminator Ready Reaction Mix (Perkin Elmer Biosystems) gemischt. Die Sequenzreaktion erfolgte nach den Angaben des Herstellers. Zum Abtrennen der nicht eingebauten Nucleotide und Primer wurde eine DNA-Präzipitation durchgeführt. Durch Zugabe von 30µl 100% Ethanol und eine anschließende Zentrifugation für 1h bei 2700xg und Raumtemperatur wurde die DNA präzipitiert. Das Pellet wurde zweimal mit 150µl 70% Ethanol gewaschen und in der Vakuumzentrifuge für 2min getrocknet.

Die Auftrennung der Fragmente im Kapillargel wurde von der Servicegruppe am Max-Planck-Institut übernommen. Zur Auftrennung und Detektion der DNA-Fragmente wurde der ABI PRISM 377 DNA Sequencer verwendet.

4.1.17  In-vitro Mutagenese

In das Plasmid pBUDCE4+hFU wurden mittels in-vitro Mutagenese folgende Mutation eingefügt: G13V. Die Mutagenese wurde mit Hilfe des QuikChange Site-Directed Mutagenesis Kit (Stratagene) nach den Angaben des Hersteller durchgeführt.

↓36

Tab.1.17.1: Primer für in-vitro Mutagenese

Primername

Sequenz (5’-3’)

TA (°C)

Fu-G13V

TGTTGGAGATGATTGGAGAAGTATCTTTTGGGAGGGTGTAC

78°C

Fu-antisense-G13V

GTACACCCTCCCAAAAGATACTTCTCCAATCATCTCCAACA

78°C

4.2 Zellkultur

4.2.1  Zelllinien

Tab.2.1: verwendete Zelllinien

Zelllinie

Beschreibung

Medium

HeLa

Human Negroid cervix epitheloid carcinoma

DMEM, 10% Fetal Bovine Serum

COS7

African green monkey kidney

DMEM, 10% Fetal Bovine Serum

U373MG

Human Glioblastoma Astrocytoma

EMEM, 2mM Glutamine, 1% non essential amino acids, 1mM Sodium Pyruvate, 10% Fetal Bovine Serum

4.3  Proteinbiochemische Methoden

4.3.1  Transfektion und Immunfluoreszenz

Einen Tag vor der Transfektion wurden 1x105 Zellen pro well in eine 6-well-Platte ausgesät. Die Zellen wurden mit Polyfect Transfection Reagent (Qiagen) nach den Angaben des Herstellers transfiziert. 24-48 Stunden nach der Transfektion wurden die Zellen mit 1,2xPEM gewaschen und anschließend mit 3,7% Paraformaldehyd in 1,2xPEM für 10min bei Raumtemperatur fixiert. Nachdem die Zellen mit 1xPBS gewaschen wurden, wurden sie mit 0,2%TritonX100 in PBS für 10min bei Raumtemperatur permeabilisiert. Nun wurde 4 mal für je 3min mit PBS gewaschen. Im Anschluß daran erfolgte das Blocken unspezifischer Bindungsstellen mit 1%BSA in PBS für 20min bei RT. Es erfolgte die Inkubation mit dem primären Antikörper in PBS+1%BSA nach Angaben des Herstellers. Nach 4 mal 3min waschen mit PBS wurden die Zellen mit dem sekundären Antikörper in PBS (Verdünnung nach Herstellerangaben) für 30min bei Raumtemperatur inkubiert. Die Zellen wurden erneut 4 mal 3min mit PBS gewaschen und in DAPI-Medium eingebettet.

↓37

Tab. 3.1.1: Behandlungen der Zellen vor der Immunfluoreszenz

Art der Behandlung

Endkonzentration der zugesetzten Substanz im Medium

Inkubation

Kälteschock

-

4°C für 30min

Rapamycin

25nM

37°C für 30min

Ocadaic acid

100nM

37°C für 30min

Forskolin

40µM

37°C für 15h

ddForskolin

40µM

37°C für 15h

IBMX

150µM

37°C für 15h

Fostriecin

500nM

37°C für 1h

LLnL

25µM

37°C für 2h

Lactacystin

300nM / 1mM

37°C für 4h

LiCl

50mM

37°C für 4h

Wortmannin

100nM

37°C für 1h

CKI-7

100µM

37°C für 4h

HePC

5µM

37°C für 1h

U37122

1µM

37°C für 1h

U37343

1µM

37°C für 1h

Colcemid

100mg/ml

37°C für 2h

4.3.2 Fluoreszenz-Mikroskopie / 3D-Mikroskopie / Lebendzellanalyse

Die mikroskopische Analyse der Immunfluoreszenz-Präparate erfolgte an einem Auflicht-Fluoreszenzmikroskop (Axioskop, Zeiss), das sowohl mit einem Doppelbandpassfilter (Chroma Technologies) zur simultanen Visualisierung roter und grüner Fluoreszenzen als auch mit separaten Einzelbandpassfiltern zur einfachen Darstellung blauer, roter und grüner Fluoreszenzen ausgerüstet war. Mit einer CCD (Charge coupled device) -Kamera (Hamamatsu) wurden schwarz-weiße digitale Bilder aufgenommen. Mit Hilfe des Bildverarbeitungsprogramm ISIS3 (Metasystems) wurden den einzelnen Graubildern die Farben der eingesetzten Fluorochrome zugeordnet. Die Zusammenlegung dieser Bilder resultiert in RGB-Bildern (rot/grün/blau).

Die 3D-Analysen der Immunfluoreszenz-Präparate wurden mit einem Mikroskop des Typs Axiovert (Zeiss) durchgeführt. Das Objektiv (100x-plan-neofluar Öl-Imm./NA 1.35; Zeiss) war an einen PIFOC z-SCAN (Physik Instrumente) und eine 12-bit CCD-Kamera (SensiCam; PCO) gekoppelt. Die Kontrolle erfolgte durch die TILLvisION v4.0 software. Die Fluorochrome wurden über einen Polychrome IV Monochromator (T.I.L.L. Photonics Deutschland) in Kombination mit einem Vierfachbandpass Strahlenteiler und Sperrfilter (Chroma Technology Corp.) angeregt. Das erlaubte die sequentielle Aufnahme von blauen (DAPI 372nm), roten (Cy3 565nm) und grünen (GFP 496nm) Fluoreszenzen aus einer Z-Ebene. Die Dekonvolution der Bilddaten erfolgte mit dem cMLE Algorithmus der Huygens 2.1.4-essential Software (Scientific Volume Imaging, Holland). Das Rendering (digitales Berechnen eines Bildes) zur 3D-Darstellung der Zellen wurde mit dem Programm Imaris 3.3.2 (Bitplane, Schweiz) durchgeführt.

↓38

Die Lebendzellanalysen wurden wie bei der 3D-Mikroskopie mit einem Mikroskop des Typs Axiovert (Zeiss) durchgeführt. Das Objektiv (100x-plan-neofluar Öl-Imm./NA 1.35; Zeiss) war an einen PIFOC z-SCAN (Physik Instrumente) und eine 12-bit CCD-Kamera (SensiCam; PCO) gekoppelt. Die Kontrolle erfolgte durch die TILLvisION v4.0 software. Die Fluorochrome wurden über einen Polychrome IV Monochromator (T.I.L.L. Photonics Deutschland) in Kombination mit einem Vierfachbandpass Strahlenteiler und Sperrfilter (Chroma Technology Corp.) angeregt. In 1-minütigen Intervallen wurden über ein Zeitfenster von 4h Bilder aufgenommen (resultierend in 240 Einzelaufnahmen). Die einzelnen Bilder wurden mit Hilfe der TILLvisION v4.0 software zu einem Film verbunden.

Nachträgliche Bildbearbeitungen sowie das Erstellen der Abbildungen erfolgte mit dem Adobe Photoshop 7.0 und Paintshop Pro Version 6.02.

4.3.3 Proteinbestimmung nach Bradford

Die Proteinbestimmung nach Bradford dient der Ermittlung der Proteinkonzentration. Diese Methode basiert auf dem Gleichgewicht zwischen zwei Formen von Coomassie Blue G. Im sauren Milieu liegt der Farbstoff in einer protonierten, roten Form vor. Bindet dieser an ein Protein, so nimmt er eine nicht protonierte, blaue Form an. Die Intensität der blaue Farbe kann im Photometer bei einer Wellenlänge von 595nm gemessen werden und ist proportional zur Menge des an den Farbstoff gebundenen Proteins. Um den Proteingehalt einer Probe zu ermitteln, wurde zunächst eine Eichreihe pipettiert. Dazu wurde BSA in 1:1000 verdünntem Probenpuffer auf die folgenden Konzentrationen verdünnt: 1µg/ml, 2µg/ml, 4µg/ml, 5µg/ml, 7,5µg/ml, 10µg/ml. Die Proben wurden 1:1000 in H2O verdünnt. Je 80µl der BSA-Verdünnungen bzw. der verdünnten Proben wurden mit 20µl Bradford-Reagenz (Sigma) gemischt und in eine Mikrotiterplatte (Falcon) pipettiert. Die Messung der Absorption bei 595nm erfolgte im Spektralphotometer Anthos 2020. Die Proteinkonzentration der Proben wurde über eine Standardkurve bestimmt.

4.3.4 Westernblot

4.3.4.1  Sodiumdodecylsulfat Polyacrylamid-Gelelektrophorese (SDS-PAGE)

↓39

Bei der SDS-PAGE handelt es sich um eine Methode, mit der Proteine ihrem Molekulargewicht entsprechend aufgetrennt werden. Durch Inkubation der Proteine mit dem stark anionischen Detergenz SDS (in Verbindung mit einem Reduktionsmittel wie DTT oder ß-Mercaptoethanol) und hoher Temperatur werden diese vollständig denaturiert und dissoziiert. Die Proteine binden das SDS und erhalten dadurch eine negative Ladung. Da die Menge an gebundenem SDS proportional zum Molekulargewicht des Proteins ist (1,4g SDS binden etwa 1g Protein), wandern die SDS-Proteinkomplexe abhängig von ihrer Größe durch das Gel. Die SDS-Gele wurden in dieser Arbeit nach den Angaben in Tab.3.4.1.1 hergestellt.

Tab.3.4.1.1 SDS-Gele

Komponente

Volumen (in ml) zur Herstellung von 5ml Trenngel

H2O

2,6

Acrylamid/bis-Acrylamid 37,5:1 Mix (Roth)

1,0

1,5M Tris (pH8,8)

1,3

10% SDS

0,05

10% APS (Biorad)

0,05

TEMED (GibcoBRL)

0,004

Komponente

Volumen (in ml) zur Herstellung von 1ml Sammelgel

H2O

0,68

Acrylamid/bis-Acrylamid 37,5:1 Mix (Roth)

0,17

1,5M Tris (pH6,8)

0,13

10% SDS

0,01

10% APS (Biorad)

0,01

TEMED (GibcoBRL)

0,001

Vor dem Auftragen auf das Gel wurden die Proben mit magic mix bzw. SDS-PAGE-Puffer versetzt und 5min bei 95°C denaturiert. Der Gellauf erfolgte bei 200V für etwa 45min.

4.3.4.2 Westernblot

↓40

Mit diesem Verfahren werden die im SDS-Gel aufgetrennten Proteine auf eine Polyvinylindendifluorid (PVDF)-Membran transferiert, auf der sie mit spezifischen Antikörpern detektiert werden können. In dieser Arbeit wurden die SDS-Gele nach dem Gellauf für 15min in 1xBlotting-Puffer (mit 20% Methanol) gelegt. Die PVDF-Membranen (Roche) wurden wie folgt vorbereitet: 2sek in Methanol, 2min in Wasser, 15min in Blotting-Puffer. Blotting Papier (Biorad) wurde kurz in Blotting-Puffer getaucht. Im Anschluß daran wurde der Blot folgendermaßen in einer Trans-Blot SD semidry Transfer Cell (Biorad) aufgebaut:

- ( Kathode)

Blotting Papier

↓41

Gel

PVDF-Membran

Blotting Papier

↓42

+ (Anode)

Es wurde bei 20V für 30min geblottet.

Im Anschluss daran wurde die Membran zum Blocken in 5% Milchpulver in PBST gelegt und für 30min bei Raumtemperatur inkubiert. Nun erfolgte die Inkubation mit dem primären Antikörper in PBST+1% BSA nach Angaben des Herstellers. Nach 4x3min waschen mit PBST wurden die Blots mit dem sekundären, Horseradishperoxidase(HRP)-konjugierten Antikörper in PBST (Verdünnung nach Herstellerangaben) inkubiert. Die Detektion erfolgte mit Western Lightning Chemiluminescence Reagent (Perkin Elmer) nach den Angaben des Herstellers.

4.3.5 Transfektion / Zellfraktionierung

↓43

Einen Tag vor der Transfektion wurden 8x105 Zellen pro 75cm2-Flasche ausgesät. Die Zellen wurden mit Polyfect Transfection Reagent (Qiagen) nach den Angaben des Herstellers transfiziert.

48h nach der Transfektion wurden die Zellen einmal mit PBS gewaschen und durch Abschaben mit einem Zellschaber (Biochrom) vom Flaschenboden abgelöst. Die Zellen wurden abzentrifugiert (1000xg, 10min). Im Anschluss daran wurde das Zell-Pellet in Puffer A resuspendiert. Die Zellen wurden mit dem Potter aufgeschlossen. Die Kern- und Cytosol-Fraktionen wurden durch Zentrifugation (1000xg 10min) voneinander getrennt. Die Zell-Pellets (Kernfraktion) wurden in 2xmagic mix resuspendiert. Die Fraktionen wurden mittels Westernblot analysiert.

4.3.6  Transfektion / Immunpräzipitation / in-vitro Behandlungen

Einen Tag vor der Transfektion wurden 8x105 Zellen pro 75cm2-Flasche ausgesät. Die Zellen wurden mit Polyfect Transfection Reagent (Qiagen) nach den Angaben des Herstellers transfiziert.

↓44

48h nach der Transfektion wurden die Zellen einmal mit PBS gewaschen und durch Abschaben mit einem Zellschaber (Biochrom) vom Flaschenboden abgelöst. Die Zellen wurden abzentrifugiert (1000xg, 10min) und das Zell-Pellet in 40mMHepes/150mMNaCl resuspendiert. Der Zellaufschluss erfolgte mittels Ultraschall. Protein-A-Agarose bzw. Protein-G-Agarose (Roche) wurde durch dreimaliges Waschen mit 40mM Hepes/150mM NaCl vorbereitet. Jeweils 2mg Protein wurden in 1ml 40mM Hepes/150mM NaCl gelöst. Um unspezifische Bindungen von Proteinen an die Protein-A-Agarose bzw. Protein-G-Agarose vorzubeugen, wurde ein „precleaning“ durchgeführt: Zu den 2mg Protein in 1ml 40mMHepes/150mMNaCl wurden 50µl Protein-A-Agarose bzw. Protein-G-Agarose zugesetzt. Es folgte eine Inkubation für 1,5h im Überkopfschüttler bei 4°C. Die Agarose wurde durch eine Zentrifugation (3000rpm, 1min, 4°C) vom Ansatz abgetrennt. Der Überstand wurde mit 1-2µg Antikörper versetzt. Es folgte eine Inkubation über Nacht bei 4°C im Überkopfschüttler. Anschließend wurden 75µl Protein-A-Agarose bzw. Protein-G-Agarose zugesetzt und 2h im Überkopfschüttler bei 4°C inkubiert. Die Protein-A-Agarose bzw. Protein-G-Agarose, an die nun Antikörper, Zielprotein und Interaktionspartner des Zielproteins gebunden sind, wurde drei mal gewaschen. Im Anschluss daran wurde die Protein-A-Agarose bzw. Protein-G-Agarose abzentrifugiert (3000rpm, 1min, 4°C) und der Überstand abgenommen.

Die in-vitro-Behandlungen der Immunpräzipitate bzw. der Zellfraktionen wurden wie in Tab.3.6.1 dargestellt durchgeführt.

Tab.3.6.1: in-vitro-Behandlungen

Reagenz / Enzym

zugesetzte Menge

Inkubation

Hersteller

Purified PP2A

0,5U

2h bei 37°C im für λ Phosphatase (NEB) mitgelieferten Puffer

Upstate

λ Phosphatase

2000U

2h bei 30°C im mitgelieferten Puffer

NEB

↓45

Nach den entsprechenden in-vitro Behandlungen wurden die Immunpräzipitate mittels Westernblot analysiert.

4.3.7 RNAi (RNA interference)

RNAi ist eine Form posttranskriptionaler Genregulation, welche durch doppelsträngige RNA-Moleküle vermittelt wird. Als siRNA (short interfering RNA) bezeichnet man kurze (21-23 Nukleotide), doppelsträngige RNA-Moleküle (dsRNA), die durch intrazelluläre Spaltung längerer dsRNA-Moleküle mit dem Enzym Dicer entstehen (Abb.3.7.1).

Abb.3.7.1: Spaltung längerer dsRNA-Moleküle mit dem Enzym Dicer

↓46

Diese siRNA-Moleküle können spezifisch an ihre Ziel-mRNA binden und deren Degradierung durch den RISC-Proteinkomplex (RNA-induced silencing complex) auslösen Abb.3.7.2). Als Folge dessen kann das entsprechende Protein nicht weiter synthetisiert werden. Der RISC-Komplex umfasst mehrere Proteine, wie zum Beispiel eine Helicase, die die dsRNA auftrennt.

Abb.3.7.2: Degradierung einer Ziel-mRNA durch den RISC-Proteinkomplex.

Dieser Mechanismus kann experimentell ausgenutzt werden, indem synthetisierte siRNA-Moleküle mittels Transfektion in Zellen eingeschleust werden, und somit die Expression spezifischer Ziel-Gene verringert werden kann.

↓47

Hierfür wurden in dieser Arbeit 1x105 HeLa Zellen pro well einer 6-well-Platte einen Tag vor der Transfektion ausgesät. Die Transfektion erfolgte mit Hilfe des Transfektionsreagenz Oligofectamine (Invitrogen) nach den Angaben des Herstellers. Es wurden 1,3µg synthetischer siRNA pro well transfiziert. Die Sequenzen der genspezifischen siRNA sind in Tab.3.7.1 aufgeführt. Als Negativ-Kontrolle wurde non-silencing siRNA (Qiagen) eingesetzt. Die Transfektionseffiziens wurde mit FITC-markierter siRNA überprüft und betrug etwa 95%.

Tab.3.7.1: Zielsequenzen der siRNA

Zielgen

Zielsequenz / Bestellnr.

Hersteller

α4

CAAGAGAGGCATCAACTTCTA

Qiagen

GSK3β

Cat.#51012 silencer validated siRNA (targeted exons 2&3)

Ambion

β-catenin

GCTGAAACATGCAGTTGTA

Qiagen

Fu

AGAGTCTACTGAAGTGACA

Qiagen

4.3.8  Orthophosphat-Markierung

In diesem Verfahren wird untersucht, ob ein Zielprotein in der Zelle phosphoryliert wird. Zu dem Kulturmedium wird radioaktiv markiertes Phosphat zugegeben, welches an Phosphoproteine angehangen wird. Diese radioaktiv markierten Proteine reinigt man mittels Immunpräzipitation auf. Wurde das Zielprotein phosphoryliert, so ist es radioaktiv markiert und kann mittels Autoradiographie nachgewiesen werden.

↓48

Für die Markierung wurden 8x105 Zellen einen Tag vor der Transfektion in 75cm2-Flaschen ausgesät. Die Zellen wurden mit Polyfect Transfection Reagent (QIAgen) nach den Angaben des Herstellers transfiziert. 24h nach der Transfektion wurde das Kulturmedium entfernt und durch 5ml phosphatfreies DMEM (ICN) pro Flasche ersetzt. Es wurden 5 mCi H3 32PO4 in HCl (Amersham) zugesetzt. Die Zellen wurden für 24h in diesem labeling-Medium inkubiert. Anschließend wurden die Zellen in TBS gewaschen, abgeschabt und abzentrifugiert. Das Zell-Pellet wurde in 1ml 40mM Hepes/150mM NaCl resuspendiert. Der Zellaufschluss erfolgte mittels QIAshredder (Qiagen). Die radioaktiv markierten Proteine wurden mittels Immunpräzipitation aufgereinigt und auf einem SDS-Gel aufgetrennt (Durchführung wie oben beschrieben). Das SDS-Gel wurde getrocknet und ein Röntgenfilm (Fuji) exponiert.

4.4  Herstellung eines GLI3-Antikörpers

4.4.1  Klonierung

Zwei Fragmente der GLI3-cDNA (codierend für Aminosäure 1-121 bzw. Aminosäure 1171-1470) wurden mittels PCR amplifiziert. Die hierfür verwendeten Primer sind in Tab.4.1.1 dargestellt.

Tab.4.1.1: Primer zur Klonierung

Primername

Sequenz (5’-3’)

TA (°C)

Gli3-f22

ATCGGATCCATGGAGGCCCAGTCCCACAG

63

Gli3-r22

TTGTCGACGCTATCATTAGTGGGGCTCCATGTAACCTA

59

Gli3-f23

ATCGGATCCCTGTCCTCCTCCAAGCTCAAG

61

Gli3-r23

TTGTCGACGCTATCATTACTGTAGCAGGCAGCTGGCGT

63

↓49

Die PCR-Produkte wurden aufgereinigt und mit den Restriktionsenzymen BamHI und SalI geschnitten und in den Vektor pET32a (Novagen) ligiert. Im pET32a-Vektor exprimierte Peptide werden mit 3 Tags versehen: S-Tag, His-Tag und Thioredoxin-Tag. Der His-Tag wurde hier zur späteren Peptidaufreinigung ausgenutzt, der Thioredoxin-Tag gewährt eine bessere Löslichkeit der produzierten Peptide.

4.4.2 Peptidexpression in E. coli und Aufreinigung

Die Plasmide wurden in den E. coli-Expressionsstamm BL-21Codon-Plus (DE3)-RIL (Novagen) transformiert. Der Transformationsansatz wurde auf LB-Medium mit Ampicillin (50µg/ml) und Chloramphenicol (33,74µg/ml) ausplattiert. Das im Expressionsstamm enthaltene RIL-Plasmid trägt ein Chloramphenicol-Resistenzgen, das pET32a-Plasmid trägt ein Ampicillin-Resistenzgen. Es erfolgte eine Inkubation bei 37°C über Nacht. Anschließend wurde eine 20ml-Flüssigkultur mit einer der gewachsenen Kolonien angeimpft und bei 37°C über Nacht geschüttelt. Am nächsten Tag wurde eine 1l-Flüssigkultur mit den 20ml Übernachtkultur angeimpft. Es erfolgte eine Inkubation bei 37°C bis die OD600 = 0,5-0,7 erreicht war. Es wurde ein 1ml-Aliquot zur späteren Analyse auf einem SDS-Gel genommen (nicht induziert). Nun wurde die Expression der Peptide durch Zugabe von 0,1mM IPTG induziert. Es wurde für 1,5h bei 30°C inkubiert. Im Anschluss wurde zunächst ein 1ml-Aliquot zur späteren Analyse auf einem SDS-Gel genommen (induziert) und die restlichen Zellen wurden vom Medium mittels Zentrifugation (4000xg, 20min, 4°C) abgetrennt. Das Zell-Pellet wurde ausgewogen und in 3ml/g Pellet Lysis Buffer (Qiagen, QIAexpressionist) resuspendiert. Die Zellen wurden in flüssigem Stickstoff eingefroren. Später wurden die Zellen auf Eis aufgetaut und mittels Ultraschall aufgeschlossen. Die lösliche Fraktion wurde von der unlöslichen durch einen Zentrifugationsschritt (10000xg, 30min, 4°C) abgetrennt. Es wurde sowohl von der löslichen (Überstand) als auch von der unlöslichen (Pellet) Fraktion ein Aliquot zur späteren Analyse auf einem SDS-Gel genommen. Die Aufreinigung der Peptide erfolgte nun unter Verwendung des QIAexpressionist-Systems (Qiagen) nach den Angaben des Herstellers. Hierbei wird die Bindung des His-Tags der Peptide an Nickel ausgenutzt, um das Peptid in einer Säule binden, waschen und eluieren zu können.

4.4.3 Coomassie Staining

Die während der Expression und Aufreinigung der Peptide gewonnenen Aliquots wurden auf SDS-Gelen aufgetrennt. Die Proteine in den SDS-Gelen wurden mittels Färbung mit Coomassie Blau visualisiert. Dazu wurden die SDS-Gele zunächst für 1h bei Raumtemperatur in staining Coomassie-Lösung inkubiert, und anschließend für 1h bei Raumtemperatur in destaining Coomassie-Lösung entfärbt.

4.4.4 Affinitätsreinigung der Antikörper

↓50

Die aufgereinigten Peptide wurden in 100mM Hepes (pH7,2) dialysiert und zur Immunisierung von Kaninchen eingesetzt. Das Serum des Kaninchens, das mit dem Peptid „Gli3-22“ (Aminosäure 1-121) immunisiert wurde, wurde einer Affinitätsreinigung unterzogen. Dazu wurde das in E. coli exprimierte, aufgereinigte Peptid mit dem Enzym Thrombin (Novagen) geschnitten. Durch das Schneiden mit Thrombin wurden der Thioredoxin-Tag und der His-Tag vom GLI3-Peptid abgeschnitten. Mit Hilfe von Ni-NTA (Qiagen, QIAexpressionist) wurde das GLI3-Peptid von den Tags getrennt. Das GLI3-Peptid wurde nun an eine Sulfolink-Säule (Pierce) gebunden. In diesem System werden Peptide, die ein (oder mehrere) Cystein enthalten, über spezifische Bindungen von freien Sulfhydrylgruppen des Peptids an Iodacetylgruppen der Gel-Matrix, in einer Säule immobilisiert. Die Bindung des Peptids an die Säule, sowie das Blocken unspezifischer Bindungen erfolgte nach den Angaben des Herstellers. Die so hergestellte Säule wurde im Anschluss zur Affinitätsreinigung der GLI3-Antikörper aus dem Serum des Kaninchens benutzt. Zu 50ml Serum wurden 50ml binding buffer (Pierce) und die an das GLI3-Peptid gekoppelte Sulfolink-Gel-Matrix zugegeben. Es wurde bei 4°C über Nacht im Überkopfschüttler inkubiert. Anschließend wurde der Ansatz in eine Polypropylensäule (Qiagen) überführt, und der Durchlauf abgelassen. Die Elution der Antikörper erfolgte in folgenden Schritten (insgesamt 25 Eluate):

Der pH-Wert der Eluate wurde durch sofortige Zugabe von 100µl 1M Tris pH 7,5 neutralisiert.

4.4.5 Dot Blot

↓51

Um zu testen, in welchem Eluat der oben aufgeführten Affinitätsreinigung GLI3-Antikörper vorliegen, wurde ein Dot Blot durchgeführt. Hierzu wurden jeweils ~25µg des Thrombin-geschnittenen GLI3-Peptids auf eine Nitrozellulose-Membran (Amersham) aufgetropft. Im Anschluss daran wurde die Membran zum Blocken in 5%Milchpulver in PBST gelegt und für 30min bei Raumtemperatur inkubiert. Nun erfolgte die Inkubation mit dem affinitätsgereinigten GLI3-Antikörper in PBST+1%BSA (Verdünnung 1:100) bei 4°C über Nacht. Nach 4 mal 3min waschen mit PBST wurden die Blots mit dem sekundären, HRP-markierten Anti-Kaninchen-Antikörper in PBST (Verdünnung nach Herstellerangaben) inkubiert. Die Detektion erfolgte mit Western Lightning Chemiluminescence Reagent (Perkin Elmer) nach den Angaben des Herstellers.

4.4.6 Mäuse-Embryonen

Die Extremitäten-Anlagen von 15 NMRI-Mäuseembryonen (E11.5) wurden in 400µl Puffer A aufgenommen. Der Zellaufschluss erfolgte mit dem Potter. Die Kern- und Cytosol-Fraktionen wurden durch Zentrifugation (1000xg, 10min, 4°C) voneinander getrennt. Die Zell-Pellets (Kernfraktion) wurden in 2x magic mix resuspendiert. Die Fraktionen wurden mittels Westernblot analysiert.

4.5  Semiquantitative RT-PCR

Semiquantitative RT-PCR ist eine gängige Methode zur quantitativen Analyse der Genexpression. Ausgehend von gleichen Mengen an RNA verschiedener Proben, wird unter gleichen Bedingungen cDNA synthetisiert und das gleiche PCR-Produkt darauf amplifiziert. Die Menge des entstandenen PCR-Produkts ist proportional der Menge der RNA des jeweiligenTranskripts. Im gleichen Reaktionsansatz wird zusätzlich ein Kontroll-Transkript (hier: 18S rRNA) zum Abgleich experimentell bedingter Abweichungen amplifiziert.

4.5.1  Zellen / Behandlungen

↓52

Für die semiquantitativen RT-PCR’s wurden jeweils 1,1x106 Zellen einen Tag vor der Behandlung und RNA-Isolation in 10cm-Petrischalen ausgesät. 24h nach der Transfektion wurden die Zellen für 4h mit LiCl (50mM) bzw. Rapamycin (25nM) behandelt.

4.5.2 RNA-Isolation aus Zellen

Die Zellen wurden mit einem Zell-Schaber vom Boden des Kulturgefäßes gelöst und abzentrifugiert (1000xg, 10min, 4°C). Der Zellaufschluss erfolgte im Lysepuffer (Qiagen) mit Hilfe des QIAshredder Kit (Qiagen). Die RNA-Isolation erfolgte mit dem RNeasy Mini Kit (Qiagen) nach dem mitgelieferten Protokoll.

4.5.3 cDNA-Synthese

Zur cDNA-Synthese wurde 1µg RNA mit 1µl 10mM dNTPs (Fermentas), 3µl pd(N)6 (100ng/µl, Pharmacia) und H2O (ad 15,5µl) gemischt. Es erfolgte eine Inkubation bei 70°C für 5min. Danach wurden 5µl 5x1st Strand Buffer (Invitrogen), 2,5µl 0,1M DTT (Invitrogen) und 0,5µl RNA Guard (Amersham) zugesetzt und für 2min bei 42°C inkubiert. Nach Zugabe von 1µl Superscript II Reverser Transkriptase (Invitrogen) wurde zunächst 1h bei 42°C inkubiert. Im Anschluss wurde die cDNA-Synthese durch eine Inkubation bei 70°C für 15min beendet. Es wurden jeweils 3µl cDNA für die folgenden semiquantitativen RT-PCRs eingesetzt.

4.5.4 Semiquantitative RT-PCR

↓53

Die semiquantitativen RT-PCRs wurden unter Verwendung des QuantumRNA 18S Internal Standards Kits (Ambion) nach dem mitgelieferten Protokoll durchgeführt. Die genspezifischen Primer, sowie die PCR-Bedingungen sind in Tab.5.4.1 dargestellt.

Tab.5.4.1: semiquantitative RT-PCR

Gen

Primernamen

Primersequenz (5’-3’)

TA (°C)

Primer:Competimer-Verhältnis

Zyklenzahl

Zelllinie

PTCH1

RT-PTCH1-for3

TACGGACATTGTACCTCGGG

59,4

1:9

30

HeLa

PTCH1

RT-PTCH1-rev1

GGCATGTAGTCGGCTTTGTC

59,4

1:9

30

HeLa

Fu

RT-Fu-f2

GCCCTGTACTATCTGCATTC

57,5

1:9

30

HeLa

Fu

RT-Fu-r2

TTGAGAATGAGGCTGACCAG

57,3

1:9

30

HeLa

ß-catenin

ß-catenin-sense

ATGGAACCAGACAGAAAAGC

55,3

1:9

30

HeLa

ß-catenin

ß-catenin-antisense

GCTACTTGTTCTGAGTGAAG

55,3

1:9

30

HeLa


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
17.08.2007