[Seite 14↓]

2  Material und Methoden

2.1 Probanden und Patienten

2.1.1 Probanden

Nach Stellung eines Antrages und Zustimmung der Ethikkommission zu Untersuchungen aller genannten Gruppen, wurden zunächst insgesamt 30 gesunde Probanden untersucht. Das Ziel bestand in der erstmaligen Ermittlung von Normalwerten bzw. -bereichen für Sauerstoffverbrauch, Stimulierbarkeit und Umfang der sauerstoffverbrauchenden Prozesse in PBMC.

Dazu wurden jeweils 15 weibliche und 15 männliche Probanden im Alter zwischen 20-30 Jahren ausgewählt. Das Durchschnittsalter betrug 24 Jahre. Dabei handelte es sich hauptsächlich um gesunde Studenten und junge Mitarbeiter des Universitätsklinikums Charité. Sie wurden aufgeklärt und hatten ihr Einverständnis zur Blutentnahme gegeben. Es wurden nur solche Probanden in die Untersuchungen aufgenommen, deren subjektives Wohlbefinden zum Zeitpunkt der Blutentnahme nicht eingeschränkt war. Desweiteren lagen zu diesem Zeitpunkt keine Infekte oder andere bekannte akute und chronische Erkrankungen vor.

2.1.2 Patienten mit einer entzündlich-rheumatischen Erkrankung

Die Patienten wurden in zwei Gruppen, bestehend aus Patienten mit einer inaktiven entzündlich-rheumatischen Erkrankung und Patienten mit einer aktiven entzündlich-rheumatischen Erkrankung, eingeteilt. Nach Erhebung der Anamnese und körperlicher Untersuchung, erfolgte die Blutentnahme für Routineuntersuchungen und für Untersuchungen zum Sauerstoffverbrauch der PBMC. Alle Patienten wurden zuvor aufgeklärt und hatten ihre Einwilligung dazu gegeben.


[Seite 15↓]

2.1.2.1  Patienten mit einer inaktiven entzündlich-rheumatischen Erkrankung

Das Patientenkollektiv rekrutierte sich aus Patienten, die in der hiesigen rheumatologischen Polikliniksprechstunde mit ihrer bekannten Erkrankung in regelmäßiger Betreuung waren. Entsprechend der Gruppenplanung wurden nur solche Patienten ausgewählt, die klinisch keine oder nur geringe Beschwerden aufwiesen und unauffällige oder nur grenzwertig erhöhte laborchemische Entzündungsparameter hatten. Außerdem waren die Patienten dieser Gruppe mit einer niedrigen Glukokortikoiddosis von maximal 20 mg Prednisolon pro Tag eingestellt.

Diese Gruppe setzte sich insgesamt aus 16 Patienten zusammen, 9 weiblichen und 7 männlichen. Das durschnittliche Alter betrug in dieser Gruppe 56 Jahre. Das Krankheitsspektrum war sehr unterschiedlich. Fünf Patienten litten an einer Rheumatoiden Arthritis, 4 an einer Polymyalgia Rheumatica / Arteriitis temporalis, 3 an einem Systemischen Lupus Erythematodes und je ein Patient an einer Sklerodermie, einem Diskoiden Lupus Erythematodes, einem RS3PE-Syndrom und an einem Morbus Cogan.

2.1.2.2 Patienten mit einer aktiven entzündlich-rheumatischen Erkrankung

Die Patienten mit einer aktiven entzündlich-rheumatischen Erkrankung wurden stationär in der Rheumatologischen Abteilung der Charité behandelt. Sie kamen zur Therapie eines Krankheitsschubes ihrer zum Teil lange bekannten oder erstmals diagnostizierten entzündlich-rheumatischen Erkrankung. Dieses Patientenkollektiv war gekennzeichnet durch eine erkrankungsbedingte klinische Symptomatik und laborchemisch erhöhte Entzündungsparameter. Desweiteren waren sie mit niedrig dosierten Glukokortikoiden oder überhaupt nicht medikamentös vorbehandelt.

Für unsere Untersuchungen wurden nur Patienten mit einer gesicherten entzündlich-rheumatischen Erkrankung berücksichtigt, bei denen vor und nach Einleitung einer mittelhoch (≤ 1mg Prednisolonäquivalent/kg/Tag) bis hoch dosierten (≥ 1mg Prednisolonäquivalent/kg/Tag) Glukokortikoidtherapie Blut entnommen werden konnte. Die Diagnosestellung und Bestimmung der Krankheitsaktivität erfolgte nach international anerkannten Kriterien, welche in diesem Kapitel im Detail besprochen werden.

Es wurde zunächst das Blut von 21 Patienten untersucht. Letztendlich erfüllten nur 12 Patienten die oben genannten Kriterien und konnten daher in die Auswertung einbezogen werden. Alle 12 Patienten waren weiblich. Das Patientenalter dieser Gruppe betrug im Durchschnitt 47 Jahre. Die [Seite 16↓]Blutentnahme erfolgte vor Behandlung und im Durchschnitt vier bis fünf Tage nach deren Beginn. Zu diesem Zeitpunkt war bei allen Patienten schon eine deutliche Zustandsbesserung eingetreten. Das Krankheitsspektrum war ähnlich wie in der Gruppe von Patienten mit einer inaktiven entzündlich-rheumatischen Erkrankung. Drei Patienten litten an einer Rheumatoiden Arthritis, 3 an einem Systemischen Lupus Erythematodes, 2 an einer Polymyalgia Rheumatica / Arteriitis temporalis, 2 an einem Sjögren-Syndrom und je eine Patientin an einer Mischkollagenose und an einem Morbus Behçet. Die Patienten konnten in drei Therapiegruppen eingeteilt werden. Vier Patienten wurden initial mit 30 - ≤ 50 mg und 5 Patienten mit 50 - ≤ 100 mg Prednisolon pro Tag behandelt. Weitere 3 Patienten erhielten als Initialtherapie 250 - ≤ 500 mg Methylprednisolon pro Tag. In der folgenden Tabelle sind zusammenfassend die Anzahl und Diagnosen der Patienten mit entzündlich-rheumatischen Erkrankungen dargestellt.

Tabelle 1: Diagnosen und Anzahl der untersuchten Patienten mit entzündlich-rheumatischen Erkrankungen

Diagnose

Anzahl der untersuchten Patienten

inaktiv

aktiv

Rheumatoide Arthritis

5

3

SLE

3

3

Polymyalgia Rheumatica / Arteriitis Temporalis

4

2

Sklerodermie

1

 

Diskoider Lupus Erythematodes

1

 

RS3PE-Syndrom

1

 

Cogan-Syndrom

1

 

Mischkollagenose

 

1

Sjögren-Syndrom

 

2

Morbus Behçet

 

1


[Seite 17↓]

2.1.3  Einschätzung der Krankheitsaktivität entzündlich-rheumatischer Erkrankungen

2.1.3.1 Rheumatoide Arthritis (RA)

Die Rheumatoide Arthritis ist eine meist schubweise oder kontinuierlich progredient verlaufende entzündlich-systemische Bindegewebserkrankung mit Hauptmanifestationen an den Gelenken, die durch Arthritis, Synovialitis, Bursitis und Tendovaginitis charakterisiert ist. In der Regel geht sie mit allgemeinen Krankheitszeichen einher und kann auch zu extraartikulären Organmanifestationen führen. [Lohr & Keppler et al. 1999]

Die Diagnose der RA wurde anhand der revidierten Kriterien des American College of Rheumatology (ARA-Kriterien) von 1987 gestellt. [Arnett et al. 1987] Demnach müssen vier von diesen sieben Kriterien erfüllt sein und die Kriterien eins bis vier für mindestens sechs Wochen vorliegen.

  1. Morgensteifigkeit der Gelenke von mindestens einer Stunde Dauer
  2. Arthritis von 3 oder mehr Gelenkbereichen (Weichteilschwellung oder Erguß)
  3. Arthritis der Gelenke an Hand- und Fingergelenken (Schmerzen und Schwellungen von Handwurzel-, Fingergrund- oder Mittelgelenken)
  4. Symmetrische Arthritis (gleichzeitiger Befall desselben Gelenkbereiches beider Körperhälften)
  5. Subkutane Rheumaknoten
  6. Rheumafaktoren im Serum nachweisbar
  7. Radiologische Veränderungen (gelenknahe Osteoporose und (oder) Erosionen)

Indikation für den Beginn oder die Intensivierung der Glukokortikoidtherapie war eine erhöhte Aktivität der Erkrankung. Darunter wird das Vorhandensein von mehr als drei geschwollenen Gelenken, Morgensteifigkeit von mehr als 45 Minuten und eine Erhöhung des C-reaktiven Proteins oder der Blutsenkung verstanden. [Silman & Symmons et al. 1995]


[Seite 18↓]

2.1.3.2  Systemischer Lupus Erythematodes (SLE)

Der systemische Lupus erythematodes ist eine Systemerkrankung mit oligo- oder multisymptomatischen Verlauf, die das Bindegewebe und Gefäßsystem betrifft.

Die Diagnose des SLE wurde anhand der Kriterien des American College of Rheumatology (ACR) von 1982 gestellt und liegt bei Erfüllung von vier oder mehr Kriterien vor. [Tan et al. 1982]

  1. Schmetterlingserythem (Rötung über Wangen- und Nasenrücken)
  2. diskoider Lupus erythematodes (erhabene, gerötete hyperkeratotische Effloreszenzen mit Schuppenbildung)
  3. Photosensibilität
  4. Orale oder nasopharyngeale Ulzerationen
  5. Nichterosive Arthritis an mehr als zwei peripheren Gelenken
  6. Polyserositis
  7. Nierenbeteiligung (Glomerulonephritis, Nephrotisches Syndrom, renaler Hypertonus)
  8. ZNS- Beteiligung (u.a. Krampfanfälle, Polyneuropathien, Psychosen)
  9. Hämatologische Beteiligung (Anämie, Leukopenie, Lymphopenie, Thrombopenie)
  10. Immunologische Befunde (Antikörper gegen native DNA, gegen Sm-Nukleoprotein, Phospholipidantikörper)
  11. Antinukleäre Antikörper

Die klinische Aktivität wurde unter Benutzung der ECLAM-Kriterien (European consensus of Lupus activity measurement) beurteilt. [Vitali et al. 1992] Zu diesen Kriterien gehören generalisierte Manifestationen (Fieber, Müdigkeit), Gelenkmanifestationen, aktive oder latente Haut- und Schleimhautmanifestationen, Myositis, Perikarditis, Manifestation an Lunge, Intestinum, Nervensystem, Niere, hämatologische Veränderungen (Anämie, Leuko-, und Thrombopenie), erhöhte BSG und Hypokomplementämie (manifest oder in Entwicklung). Den einzelnen Kriterien werden je nach Wertigkeit 0,5 bis maximal zwei Punkte zugeordnet. In unserer Untersuchung wurde eine erhöhte Krankheitsaktivität angenommen, wenn der ECLAM-Score mindestens sechs Punkte betrug.


[Seite 19↓]

Als inaktiv konnten in unserer Studie Patienten eingeordnet werden, wenn sie in den letzten drei Monaten keine Aktivität zeigten und einen ECLAM-Score ≤ 3 aufwiesen, wobei moderate Änderungen der Laborparameter erlaubt waren. Die Patienten erhielten in der Regel eine begleitende Therapie mit einer Glukokortikoiddosis < 15 mg Prednisolonäquivalent und anderen Immunsuppressiva.

Als Indikation für den Beginn oder die Intensivierung einer Therapie mit Glukokortikoiden wurde sowohl die klinische Aktivität (Arthritis, Serositis, Myositis, Vaskulitis, Fieber und andere Manifestationen) als auch die laborchemische Aktivität (Anstieg des DNA-Antikörper-Titers, signifikante Erniedrigung der C3 und C4-Konzentrationen, Proteinurie, Leukopenie und andere Parameter) angesehen. [Lohr & Keppler et al. 1999; Silman & Symmons et al. 1995]

Der Diskoide Lupus Erythematodes stellt die kutane Verlaufsform des SLE dar. Er befällt zumeist die Haut des Gesichts, des Kopfes und der Hände. Ein disseminierter Hautbefall ist eher selten. Der Diskoide LE ist gekennzeichnet durch münzgroße, scharf begrenzte Herde mit zentralen Hyperkeratosen. Die Abheilung erfolgt meist unter narbiger Atrophie mit Hyper- oder Depigmentierung. Die Diagnose wird anhand des klinisch-histologischen Bildes gestellt (herdförmige perivaskuläre entzündliche Infiltrate, Epidermisatrophie, Basalzelldegeneration, Hyperkeratose). Weiterhin ist ein positiver DIF-Test (bandförmiger Nachweis von Immunglobulinen und Komplementfaktoren in der Basalmembranzone) typisch. Allgemeine laborchemische Parameter sind in der Regel unauffällig. In bis zu 5% der Fälle geht die Erkrankung im Verlauf in einen SLE über. [Rassner et al. 1992]


[Seite 20↓]

2.1.3.3  Polymyalgia arteriitica

Die Polymyalgia rheumatica und die Arteriitis temporalis werden, obwohl sie in etwa der Hälfte der Fälle klinisch voneinander unterscheidbare Symptome aufweisen, als Entität unter dem Begriff Polymyalgia arteriitica zusammengefaßt. [Lohr & Keppler et al. 1999]

Die Polymyalgia rheumatica ist eine entzündliche Multiorganerkrankung. Sie ist gekennzeichnet durch heftige Muskelschmerzen im Schulter- und Beckengürtelbereich, Morgensteifigkeit und allgemeine Krankheitszeichen. Sie tritt in der Regel jenseits des 50. Lebensjahres auf und zeigt in ca. 50% der Fälle eine Assoziation mit der Arteriitis temporalis.

Die Diagnosekriterien für die Polymyalgia rheumatica sind Muskelschmerzen (Schultergürtel, Oberschenkel), starkes allgemeines Krankheitsgefühl, akuter Krankheitsbeginn (innerhalb von zwei Wochen), Gewichtsverlust, deutliche BSG-Beschleunigung (> 40 mm in der ersten Stunde) sowie beidseitiger Oberarmdruckschmerz. Eine Polymyalgia rheumatica wird angenommen, wenn drei Kriterien positiv oder ein Kriterium zusammen mit einer Arteriitis temporalis auftritt. [Bird et al. 1979]

Bei der Arteriitis temporalis handelt es sich um eine Vaskulitis im Versorgungsbereich der Arteria carotis. Sie ist häufig durch einen unspezifischen, schleichenden Krankheitsbeginn mit Fieber, Abgeschlagenheit, Depression und Gewichtsverlust gekennzeichnet. In der Regel tritt sie wie die Polymyalgia rheumatica jenseits des 50. Lebensjahr auf. Zu den Symptomen gehören Kopfschmerzen unterschiedlicher Lokalisation, charakteristische Dysästhesien der Kopfhaut, Berührungsempfindlichkeit und verminderte Pulsation der Temporalarterien sowie Sehstörungen bis hin zur Kieferklaudikation. In einigen Fällen werden auch die Aorta und ihre großen Äste befallen. Die histologische Sicherung erfolgt mittels Arterienbiopsie durch den Nachweis einer Infiltration mit mononukleären Zellen, z.T. mit einer granulomatösen Entzündung und mehrkernigen Riesenzellen.

Die Diagnose wird anhand der Kriterien nach Hunder et al. [1990] gestellt. Hierzu gehören ein positiver bioptischer Befund, typische Kopfschmerzen, Berührungsempfindlichkeit der Temporalarterie, Alter über 50 Jahren und eine BSG > 50 mm in der ersten Stunde. Drei Kriterien müssen mindestens erfüllt sein. Schon bei begründetem Verdacht muß eine hoch dosierte Glukokortikoidtherapie eingeleitet werden. Später werden die Patienten langfristig auf eine Erhaltungsdosis entsprechend dem klinischen Befund und den Entzündungsparametern eingestellt.


[Seite 21↓]

Die Einschätzung der Aktivität der Polymyalgia arteriitica erfolgt anhand der klinischen Symptomatik und im Zusammenhang mit den laborchemischen Entzündungsparametern. Es existieren keine standardisierten Scores. Nützliche Parameter zur Aktivitätsbeurteilung sind eine erhöhte BSG, CRP, Plasmaviskosität und α1-Antichymotrypsin. Desweiteren korrelieren erhöhte Mengen von löslichen IL-6 und IL-2 Rezeptor mit der Krankheitsaktivität. [Silman & Symmons et al. 1995]

2.1.3.4 Morbus Behçet

Der Morbus Behçet ist eine systemische Vaskulitis der kleinen Gefäße und tritt bevorzugt bei Mittelmeeranwohnern und Japanern auf. Die Erkrankung ist durch schmerzhafte orale und genitale Ulzerationen in Kombination mit Krankheitsmanifestationen an den Augen und Gelenken gekennzeichnet. Weiterhin kann es zu zerebral-nervösen Symptomen, Thrombosen und gastrointestinalen Affektionen kommen.

Die Diagnose wird anhand der Kriterien der International Study Group (ISG) for Behçet`s Disease gestellt. [ISG for Behcet`s Disease 1990] Diese Erkrankung liegt bei rezidivierenden oralen Aphthen ( ≥ 3 mal im Jahr) mit zusätzlich 2 der nachfolgenden Kriterien vor: Genitale Ulzerationen, Augenläsionen (Uveitis, Iritis mit Hypopyon und (oder) Retinitis), Hautläsionen (Erythema nodosum, Follikulitis, sterile Pusteln) und ein positiver Pathergietest.

Die Einschätzung der Aktivität erfolgt anhand der Ausprägung klinischer Manifestationen an den einzelnen Organsystemen. Es gibt derzeitig keine geeigneten Laborparameter, die gut mit der Krankheitsaktivität korrelieren. Zumeist zeigt sich nur eine geringe Erhöhung der Entzündungsparameter. Bei systemischen Manifestationen kommen Glukokortikoide in Kombination mit anderen Immunsuppressiva zum Einsatz. [Silman & Symmons et al. 1995]


[Seite 22↓]

2.1.3.5  Progressive systemische Sklerose

Die Progressive Systemische Sklerose, auch Sklerodermie genannt, ist eine Systemerkrankung des Bindegewebes. Es kommt zur Kollagenanhäufung und Fibrose von Haut und inneren Organen, welche von einer obliterierenden Angiopathie begleitet wird.

Die Diagnose wird anhand der ARA-Kriterien für die Sklerodermie (1980) gestellt. [Masi et al. 1980] Sie ist anzunehmen, wenn entweder das Hauptkriterium oder mindestens zwei der Nebenkriterien erfüllt sind. Als Hauptkriterium gilt die symmetrische Sklerodermie proximal der MCP (Metakarpalphalangen) oder MTP (Metatarsalphalangen). Zu den Nebenkriterien zählen grübchenförmige Narben oder Substanzverlust der distalen Finger- bzw. Zehenweichteile, Sklerodaktylie und basale Lungenfibrose.

In 90% der Fälle sind ANA-Antikörper nachweisbar. Die limitierte Form, das CREST-Syndrom, ist durch Calcinosis cutis, Raynaudsymptomatik, ösophageale Motilitätsstörungen, Sklerodaktylie und Teleangiektasien charakterisiert. Bei dieser können in 50% der Fälle ACA (Anti-Centromer-AK) nachgewiesen werden. Bei der diffusen Verlaufsform mit Beteiligung innerer Organe gelingt in 40% der Fälle der Nachweis von Anti-SCL 70. Die Einschätzung der Krankheitsaktivität erfolgt anhand der klinischen Symptomatik und der allgemeinen laborchemischen Entzündungsparameter. Es existieren bisher keine standardisierten Scores. [Silman & Symmons et al. 1995] Medsger et al. [1999] veröffentlichte vor kurzem Kriterien, die als Grundlage zur Entwicklung eines Aktivitäts-Indexes dienen sollen.

2.1.3.6 Mischkollagenose (MCTD)

Die Mischkollagenose (mixed connective tissue disease; Sharp-Syndrom) ist ein rheumatisches Erkrankungsbild mit sich überlagernden Symptomen von einem systemischen Lupus erythematodes, einer progressiven systemischen Sklerose und einer Dermato- oder Polymyositis. Bisher fehlen zur Diagnosestellung allgemein akzeptierte Klassifikationssysteme. Richtungsweisend sind vor allem die Anamnese und der körperliche Untersuchungsbefund mit überlappenden Symptomen der genannten systemischen Bindegewebserkrankungen, rheumatoiden Arthritis sowie serologische Befunde. [Miehle et al. 2000] Nach Venables et al. [1996] gehören zu den häufigsten Symptomen Arthralgien / Arthritiden (meist symmetrischer und überwiegend Befall der kleinen Fingergelenke), das Raynaud-Phänomen, Ösophagusmotilitätsstörungen, Lungenveränderungen (z.B. trockene Pleuritis, fibrosierende Alveolitis), Handschwellungen, Myositis, [Seite 23↓]Lymphadenopathie, Hautveränderungen (z.B. Ulzerationen, Sklerodaktylie), Serositiden, Fieber und andere. Serologisch ist der hochtitrige Nachweis von Antikörpern gegen U1-small nuclear ribonucleoprotein (U1-snRNP) stark wegweisend. Weiterhin können antinukleäre Antikörper (ANA), ssDNA- und dsDNA-Antikörper und Antikörper gegen verschiedene extrahierbare nukleäre Antigene (ENA) sowie Rheumafaktoren vorkommen. Unspezifische serologische Befunde sind eine beschleunigte BSG, Hypergammaglobulinämie und Leukopenie mit im Vordergrund stehender Lymphopenie.

Die Einschätzung der Krankheitsaktivität erfolgt anhand der klinischen Symptomatik der einzelnen Erkrankungskomponenten und mit Hilfe von allgemeinen laborchemischen Entzündungsparametern. Es existieren keine standardisierten Scores. [Miehle et al. 2000]

2.1.3.7 Sjögren - Syndrom

Das Sjögren-Syndrom ist eine chronische Systemerkrankung die durch Trockenheit des Mundes, der Augen und anderer Schleimhäute gekennzeichnet ist.

Die Diagnose wird anhand von Kriterien gestellt, die 1993 durch eine europäische Arbeitsgruppe erarbeit worden sind. [Vitali et al. 1993] Von den sechs erstellten Kriterien müssen mindestens vier erfüllt sein. Zu diesen gehören das subjektive Gefühl von trockenen Augen, subjektive Beschwerden aufgrund eines trockenen Mundes, nachweisbare Dysfunktion der Tränendrüsen (Schirmer-Test), der Speicheldrüsen, eine positive Lippenbiopsie mit Nachweis von lymphozytärer Infiltration und der Nachweis von Autoantikörpern (Ro und La).

Die Einschätzung der Krankheitsaktivität erfolgt anhand der Ausprägung der klinischen Symptomatik und laborchemischen Parametern. Ein Score existiert nicht. [Silman & Symmons et al. 1995] Nach Oxholm et al. [1992] unterscheidet man primäre und sekundäre Aktivitätsmarker. Primäre Aktivitätsmarker reflektieren direkt den Ablauf des Entzündungsprozesses in den Drüsen und befallenen Organen. Es werden Substanzen produziert, die im Blut und Sekreten nachweisbar sind. Dazu gehören Immunglobuline, Autoantikörper, Immunkomplexe, ß2-Mikroglobulin, löslicher IL-2 Rezeptor oder auch Komplementfaktoren. Histopathologisch gelingt der direkte Nachweis einer lymphozytärer Infiltration in den Drüsen. Sekundäre Aktivitätsmarker spiegeln den resultierenden klinischen Schaden der betroffenen Organe wider. Bei Befall der Tränendrüse gelingt beispielsweise der Nachweis eines pathologischen Schirmer-Tests durch die verminderte Produktion von Tränenflüssigkeit.


[Seite 24↓]

2.1.3.8  Cogan-Syndrom

Der Morbus Cogan ist eine seltene chronisch entzündliche Erkrankung, die durch eine interstitielle Keratitis, progrediente Innenohrschwerhörigkeit, Schwindel und Ohrgeräusche gekennzeichnet ist. Der Entzündungsprozeß kann sich zusätzlich auch auf andere okuläre Strukturen ausweiten. Häufig ist die Erkrankung von einer Vaskulitis begleitet, die oftmalig in Form einer Aortitis, Takayasu-ähnlichen Vaskulitis oder einer Vaskulitis der mittelgroßen Gefäße auftritt. Diagnosestellung und die Einschätzung von Krankheitsaktivität erfolgt anhand der klinischen Symptomatik und allgemeiner laborchemischer Entzündungsparameter. Die Erkrankung wird mit Glukokortikoiden und anderen immunsuppressiven Medikamenten behandelt. [St Clair et al. 1999]

2.1.3.9 RS3PE-Syndrom

Das RS3PE-Syndrom (Remitting Seronegative Symmetrical Synovitis with Pitting Edema) stellt wahrscheinlich eine Manifestation der Rheumatoiden Arthritis im Alter dar. [Segerer et al. 1999] Bei den Patienten kommt es neben einer plötzlich auftretenden symmetrischen Polysynovitis zu eindrückbaren Ödemen der Hand- und Fußrücken. Das Syndrom weist eine hohe Assoziation zu HLA-B7 auf und betrifft überwiegend Männer im höheren Alter. [Segerer et al. 1999; Mc Carty et al. 1985]

Die Diagnose und Einschätzung der Krankheitsaktivität erfolgt anhand der klinischen Symptomatik und allgemeiner laborchemischer Entzündungsparameter. In der Regel sind die Patienten Rheumafaktor-negativ. Das klassische Syndrom weist eine kurze Krankheitsdauer auf, ruft keine systemischen Manifestationen hervor und hat eine günstige Prognose. Die Erkrankung wird mit niedrig dosierten Glukokortikoiden behandelt. Nach Besserung der Beschwerden wird die Dosis weiter reduziert und nach Wochen ausgeschlichen, ohne daß ein hohes Rezidivrisiko besteht.


[Seite 25↓]

2.1.4  Patienten mit einer aktiven Infektionskrankheit vor Therapiebeginn

Als Vergleich zu den in der vorliegenden Arbeit schwerpunktmäßig untersuchten Patienten mit einer aktiven entzündlich-rheumatischen Erkrankung wurden orientierend im Sinne einer Pilotstudie 5 Patienten mit einer aktiven Infektionskrankheit vor Therapiebeginn untersucht. Dabei handelte es sich um männliche Patienten, welche stationär in der Infektiologischen Abteilung der Charité (Standort Wedding) behandelt wurden. Dieses Patientenkollektiv war durch eine erkrankungsbedingte klinische Symptomatik und laborchemisch erhöhte Entzündungsparameter gekennzeichnet. Das Durchschnittsalter dieser Gruppe betrug 26 Jahre. Zum Zeitpunkt der Blutentnahme erfolgte bei keinem Patienten eine medikamentöse Behandlung. Alle Patienten wurden aufgeklärt und hatten ihre Einwilligung zur Blutentnahme gegeben. In der folgenden Tabelle sind zusammenfassend die Diagnosen und Anzahl der untersuchten Patienten mit einer akuten Infektionskrankheit dargestellt.

Tabelle 2: Diagnosen und Anzahl der untersuchten Patienten mit einer akuten Infektionskrankheit

Diagnose / Infektion

Anzahl der untersuchten Patienten

Hepatitis A

1

Hepatitis B

2

Infektiöse Mononukleose

1

Erysipel

1

2.1.4.1 Hepatitis A / B Infektion

Virushepatitiden sind durch hepatotrope Viren verursachte Entzündungen der Leber mit sekundärer Leberzellschädigung. Sie werden mit grippalen Symptomen (Fieber, Abgeschlagenheit) und gastrointestinalen Beschwerden (Appetitlosigkeit, Übelkeit, Druckschmerz im rechten Oberbauch) symptomatisch. Das Stadium der Lebermanifestation kann ikterisch oder anikterisch verlaufen. Beim ikterischen Verlauf kommt es zu einer Dunkelfärbung des Urins, Entfärbung des Stuhls, Ikterus, Juckreiz und häufig auch zur Lebervergrößerung.


[Seite 26↓]

Die Hepatitis A wird durch ein RNA-Virus (HAV) hervorgerufen und verursacht etwa 55% aller akuten Virushepatitiden. Sie heilt regelmäßig aus und führt zur lebenslangen Immunität. Serologischer Marker der akuten Infektion ist der Nachweis von Anti-HAV-IgM.

Die Hepatitis B wird durch ein DNA-Virus (HBV) hervorgerufen und verursacht in Deutschland etwa 35% der Virushepatitiden. Sie kann in einen chronischen Verlauf übergehen. Serologische Marker der akuten Infektion sind HBsAg, HBeAg (korreliert mit dem Grad der Virusreplikation) und Anti-HBc-IgM.

Die Diagnose der Hepatitis wird anhand des klinischen Bildes und laborchemischer Parameter resultierend aus den Leberfunktionsstörungen (Transaminasen, γ-GT, AP, Bilirubin, Quick, Fe) gestellt. Die Formen der Virushepatitiden lassen sich klinisch nur schwer unterscheiden, so daß dem direktem Nachweis des Virus sowie spezifischer Antikörper und Titer eine entscheidende Bedeutung zukommt. [Lohr & Keppler et al. 1999]

2.1.4.2 Infektiöse Mononukleose

Die Infektiöse Mononukleose wird auch „Pfeiffersches Drüsenfieber“ genannt und ist eine durch das Epstein-Barr-Virus (EBV) hervorgerufene Erkrankung. Zielzellen des Virus sind B-Lymphozyten und Epithelien des Oropharynx. Die Infektion verläuft bei Kindern oft subklinisch. Im Schulkind- und Erwachsenenalter kann sie jedoch zu einer Angina mit flächenhaften weißlichen Belägen auf den Tonsillen, begleitet von hohem Fieber führen. Zusätzlich kommt es bei glandulärem Verlauf zu einer lokalen oder generalisierten Lymphadenopathie mit Milzschwellung. Die Diagnose wird anhand des klinischen Bildes im Zusammenhang mit dem Nachweis von spezifischen Antikörpern gestellt. [Lohr & Keppler et al. 1999]

2.1.4.3 Erysipel

Das Erysipel ist eine auf dem Lymphweg zur Ausbreitung neigende bakterielle Entzündung der Haut und des Unterhautzellgewebes. Erreger sind zumeist ß-hämolysierende Streptokokken. Auf der Haut befindet sich eine scharf begrenzte, schmerzhafte, ödematöse Rötung mit flammenförmigen Ausläufern, oft mit Bläschen und Blasen. Die akute Infektion ist von hohem Fieber und Schüttelfrost begleitet. [Pschyrembel 1990]


[Seite 27↓]

2.2  Gewinnung der PBMC und Herstellung der Zellsuspension

Die PBMC für die Sauerstoffverbrauchsmessungen wurden durch Blutentnahme bei Probanden und Patienten gewonnen. Dazu wurden 46 ml Vollblut aus einer peripheren Armvene entnommen und zur Antikoagulation mit drei Tropfen Heparin versetzt.

PBMC, die zur Weiterverarbeitung in der PCR dienten, wurden aus frischen Buffy coats isoliert. Die Buffy coats stellte die Blutspende der Charité zur Verfügung. Unter Buffy coat versteht man die Schicht aus Leukozyten und Thrombozyten, die sich nach Zentrifugation von ungerinnbar gemachtem Blut zwischen Plasma und sedimentierten Erythrozyten bildet.

Die Gewinnung der PBMC aus Vollblut bzw. Buffy coats erfolgte durch eine Dichtegradientenzentrifugation. Bedingt durch die Schwerkraft oder hier Zentrifugalkraft sedimentieren Zellen, wenn ihre Dichte größer ist als die ihrer Umgebung und schwimmen auf, wenn sie geringer ist. Existiert kein Dichteunterschied, so schweben sie. Die Zentrifugationslösung besteht aus kolloidalen Kieselgel, deren Konzentration und damit auch Dichte von der Oberfläche bis zum Boden zunimmt (Dichtegradient).

Als Zentrifugationslösung wurde Ficoll (Pharmacia Biotech, Uppsala, Schweden) genutzt. Ficoll dient speziell der Präparation von PBMC. Zunächst wird auf den Filter eines Röhrchen mit 50 ml Fassungsvolumen etwa 20 ml Ficoll gegeben. Nach kurzer Zentrifugation befindet sich die Ficoll-Lösung unterhalb des Filters. Danach wird das Vollblut bzw. etwas vom Buffy coat hinzu gegeben und das Röhrchen mit isotonischer Kochsalzlösung auf ein Gesamtvolumen von 50 ml aufgefüllt. Anschließend wird die Probe bei 2000 rpm für 20 Minuten zentrifugiert. Die Lymphozytenschicht, die sich nach der Zentrifugation zwischen Ficoll und Plasma als weiße Interphase darstellt, wird vorsichtig abpipettiert und in ein neues Röhrchen ohne Filter überführt. Dieses Röhrchen wird erneut mit isotonischer Kochsalzlösung auf 50 ml aufgefüllt und bei 1800 rpm für 8 min zentrifugiert.

Nach diesem Schritt befindet sich nun am Boden des Röhrchens das Zellpellet. Der Überstand wird vorsichtig abgesaugt und verworfen. Dem Zellpellet aus Vollblut werden 3 ml und dem aus Buffy coats ca. 10 ml eines Inkubationsmediums zugegeben. Die Zellen werden resuspendiert und bis zur weiteren Verarbeitung auf Eis bei 4°C kühl gestellt.

Das Inkubationsmedium ist eine 1:1,5 Mischung aus Borsook- und Eaglemedium. Es ist isoton und enthält keine Glukose. Das Borsook-Medium besteht aus 0,15 M Tris/HCl-Lösung, pH 7,4, [Seite 28↓]der 19 L-Aminosäuren zugesetzt sind. [Borsook et al. 1971] Das Eagle-Medium ist eine Lösung aus Hanks Salzen ohne Glutamin und NaHCO3. [Eagle et al. 1955]

Die Zellkonzentration wurde auf 1,5-2,5 x 107 Lymphozyten pro ml Medium eingestellt. Diese Zellkonzentration ist relativ hoch, aber notwendig für die Sauerstoffverbrauchsmessungen. Die Differentialzählung ergab einen Anteil von 80-90% Lymphozyten sowie 10-20% Monozyten und Granulozyten. Außerdem enthielt die Zellsuspension Thrombozyten und noch sehr wenige Resterythrozyten. Die Vitalitätstestung der Zellen erfolgte durch Färbung mit Trypanblau. Über 95% der mikroskopierten Zellen nahmen keine Blaufärbung an und waren damit lebensfähig.

Bis zu ihrer Verwendung lagerte die gewonnene Zellsuspension für maximal 3 Stunden auf Eis. Eine signifikante bakterielle Kontamination trat unter diesen Bedingungen nicht auf, obwohl auf einen Antibiotikazusatz wegen der möglichen Beeinträchtigung der lymphozytären Proteinsynthese verzichtet wurde. [Buttgereit et al. 1992] Bei Untersuchungen zur Expression der Phosphodiesterase (PDE) wurden die Zellen nach ihrer Präparation unmittelbar weiter verarbeitet.

2.3 Messung des Sauerstoffverbrauchs

2.3.1 Prinzip der Methode und Versuchsdurchführung

2.3.1.1 Prinzip

Der Sauerstoffverbrauch wurde amperometrisch mit der Clark-Elektrode bestimmt. Der amperometrischen Methode liegt eine spezielle Form der Elektrolyse zu Grunde. Über mehrere Zwischenstufen wird Sauerstoff zu Hydroxylionen reduziert. Es entsteht ein Stromfluß, der bei gegebener Spannung der Konzentration an Sauerstoff proportional ist. Mit der Clark-Elektrode ist es möglich, die Sauerstoffkonzentration der Meßlösung kontinuierlich zu bestimmen. Durch Anschluß eines Schreibers an das Meßgerät läßt sich der Sauerstoffverbrauch über die Zeit registrieren. [Rapoport et al. 1977]


[Seite 29↓]

2.3.1.2  Versuchsdurchführung

Zur Messung des Sauerstoffverbrauches wurden 0,7 ml der Zellsuspension in die Meßkammer der Elektrode gegeben. Bei vorgegebener Zellkonzentration entsprach dies einer Zellzahl von ungefähr 1-1,75 x 107 Zellen. Über ein Thermostat wurden Meßsystem und Zellsuspension während des Experimentes bei 37°C konstant gehalten. Ein Magnetrührer im Meßzylinder sorgte für eine ausreichende Äquibrilierung der Suspension mit Sauerstoff und gewährleistete im Verlauf des Experimentes eine optimale Diffusion des Sauerstoffs zur Elektrode. Die Registriergeschwindigkeit des Schreibers betrug 0,2 mm/sec.

Im Kontakt mit der Luft (Sauerstoffgehalt der Luft: 20,9 Vol%) lösen sich bei 37°C und Normaldruck maximal 4,7 ml O2 in 1 l H2O. Demnach befanden sich nach ausreichender Äquibrilierung 147,7 nmol gelöster Sauerstoff in 0,7 ml Zellsuspension. Die Ermittlung des Meßbereiches (D100%) erfolgte durch Zugabe des einfachen Mediums ohne Zellen. Der Anstieg der erfaßten Kurve (Dx) ist ein Maß für den Sauerstoffverbrauch (O2) pro Zeiteinheit (t).

Unter Berücksichtigung der eingesetzten Zellsuspensionsmenge errechneten wir den Sauerstoffverbrauch der PBMC normiert auf nmol O2/min/107Zellen nach folgender Formel:

Durch Zugabe von Con A und selektiver Hemmstoffe zu dem vollständig gefüllten und abgeschlossenen Meßzylinder gingen Zellen durch Verdrängung verloren. Die dadurch eingetretene Verdünnung wurde mathematisch berücksichtigt.


[Seite 30↓]

Abbildung 2: Originalmessung zur Bestimmung des Sauerstoffverbrauches (O2) pro Zeiteinheit (t)


[Seite 31↓]

2.3.2  Concanavalin A und selektive Hemmstoffe

2.3.2.1 Concanavalin A (Con A)

Zur Stimulierung der PBMC wurde das mitogene Lektin Concanavalin A (Serva, Heidelberg, Germany) verwendet, welches aus Schwertbohnen gewonnen wird. Es wurde in einer Endkonzentration von 50 μg/ml eingesetzt. Diese Konzentration ergab sich aus Vorversuchen als optimale Menge zur Stimulierung von frisch aus humanem Vollblut präparierter PBMC. Bei einer standardisierten Zellkonzentration von 1,5-2,5 x 107 Zellen/ml Medium entspricht dies einer durchschnittlichen Zugabe von 25 μg Con A / 107 Zellen bzw. 2,5 μg Con A / 106 Zellen. Damit liegt die verwendete Con A Konzentration in einem allgemein zur Stimulierung eingesetzten Bereich. [Edgar et al. 1999; Zempleni et al. 1999; Almawi et al. 1999] Con A wurde in einer Stammlösung mit 5 mg/ml destilliertem Wasser angesetzt.

2.3.2.2 Hemmstoffe

Die Bestimmung der sauerstoffverbrauchenden Prozesse erfolgte indirekt mittels selektiver Hemmstoffe.

Für die Blockierung der Na+K+-ATPase wurde Ouabain, für die Proteinsynthese Cycloheximid, für die Ca 2+-ATPase Lanthan und für die DNA/RNA-Synthese Actinomycin D eingesetzt. Alle Substanzen wurden in Eagle´s Basalmedium gelöst.

Ansätze der Hemmstoffe:

1.

Ouabain

21,87 mg / 3 ml

 

Boehringer, Mannheim, Germany

entspricht: 10 mM

2.

Cycloheximid

8,43 mg / 3 ml

 

Serva, Heidelberg, Germany

entspricht: 10 mM

3.

Lanthan-(III)-chlorid-7-hydrat

22,29 mg / 3 ml

 

Sigma-Aldrich Chemie, Deisenhofen, Germany

entspricht: 20 mM

4.

Actinomycin D

7,6 mg / 10 ml

 

Boehringer, Mannheim, Germany

entspricht: 0,6 mM


[Seite 32↓]

2.4  Semiquantitative PCR

2.4.1 Prinzip der Methode

Zur Untersuchung des Einflusses von Glukokortikoiden auf die Expression der cAMP-spezifischen PDE (Phosphodiesterase) wurde die Methode der semiquantitativen PCR eingesetzt.

Die PCR (polymerase chain reaction) ist eine Methode zur Vervielfältigung von Nukleinsäuren, die Mitte der achtziger Jahre von Kary Mullis entwickelt wurde. [Saiki et al. 1985; Mullis et al. 1987; Gassen et al. 1994]Das Reaktionsprinzip nutzt bestimmte Eigenschaften der Replikation (Verdopplung) von DNA in der Zelle. Für die Reaktion werden eine DNA- oder RNA-Matrize, eine DNA-Polymerase, Desoxynukleotide, zwei Oligonukleotide als Primer und ein geeignetes Puffersystem benötigt. Die DNA-Polymerase, ein DNA-vervielfältigendes Enzym, bedient sich der Einzelstrang-DNA als Matrize für die Synthese eines neuen, komplementären Stranges. Den Startpunkt der DNA-Synthese kann man festlegen, indem man Oligonukleotidprimer hinzufügt, die sich an der gewünschten Stelle an die Matrize anlagern. Diese Primer sind aus den flankierenden Bereichen der Matrize abgeleitet, weshalb das zu amplifizierende Fragment zwischen ihnen liegt.

Die gesamte Reaktion basiert auf drei Teilschritten mit jeweils unterschiedlichen Temperaturen, die ständig wiederholt werden. Im ersten Schritt, der Denaturierung der DNA-Doppelstränge (ca. 94°C) wird die DNA in Einzelstränge aufgeschmolzen. Beim Annealing, dem zweiten Schritt (ca. 50°C), hybridisieren die Oligonukleotidprimer mit den beiden DNA-Matrizen. Im dritten Schritt, der Polymerisation (ca. 72°C), dienen die Primer der DNA-Polymerase als Startmoleküle zur Kopierung der beiden Matrizenstränge.

In jedem Zyklus verdoppelt sich die Menge des von den Primern eingerahmten Matrizenfragments und wird im folgenden Zyklus zum Ausgangsmaterial. Als Endergebnis einer PCR enthält das Reaktionsgemisch am Ende von n Zyklen ein theoretisches Maximum von 2 n doppelsträngigen DNA-Molekülen, die Kopien der DNA-Sequenz zwischen den Primern darstellen. [Gassen et al. 1994; Voet et al. 1992]

Die PCR wurde zwar ursprünglich für die Analytik der DNA entwickelt, konnte jedoch schon kurze Zeit später auch für Untersuchungen der RNA etabliert werden. So wurde es möglich RNA [Seite 33↓]als direktes Substrat, aber auch cDNA/RNA-Gemische für die PCR einzusetzen. Zur Analyse von Genexpressionen wird häufig die RT-PCR eingesetzt. Dabei dient RNA als Ausgangsmaterial. Mit dem Enzym Reverse Transkriptase wird dann eine DNA-Kopie (cDNA; copy DNA) hergestellt, die als Ausgangsmatrize für die Amplifikation dient. [Hermsdorf et al. 1999; Gassen et al. 1994]

Die Vervielfältigung der Nukleinsäuren folgt einer charakteristischen Kinetik. Bei Kenntnis und unter Berücksichtigung dieser Kinetik ist es möglich, die PCR als quantitative Methode einzusetzen und die Mengen an Nukleinsäuren von zwei oder mehreren Zellproben miteinander zu vergleichen. Die PCR und ihr Einsatz als quantitatives Verfahren stellt heute eine etablierte und anerkannte Methode zur Bestimmung von Nukleinsäuremengen dar. [Gassen et al. 1994, Guyon et al. 1994]

2.4.2 Versuchsablauf

2.4.2.1 Zellpräparation und Inkubation mit Glukokortikoiden

Die Gewinnung der PBMC und Herstellung der Zellsuspension erfolgte wie im Kapitel 2.2 beschrieben. Es wurden humane PBMC aus Buffy coats verwendet, welche die Blutspendezentrale der Charité bereitstellte. Die angestrebte Konzentration der Zellsuspension betrug 2,0 x 107 Zellen/ml. Die präparierte Zellsuspension wurde 5 min mit Luftsauerstoff äquilibriert und anschließend mit einem Glukokortikoid inkubiert. Die Inkubation mit dem Glukokortikoid Prednyliden-21-diethylaminoacetat-HCl erfolgte mit 0,17 mg/107 Zellen (Decortilen®, MERCK, Darmstadt, Deutschland). Die Inkubation mit dem Glukokortikoid Dexamethason-21-Dihydrogenphosphat-Di-Na (Fortecortin®, MERCK, Darmstadt, Deutschland) erfolgte mit 0,2 mg/107 Zellen. Diese Konzentrationen leiten sich aus Untersuchungen unserer Arbeitsgruppe an humanen PBMC aus Buffy coats ab. Da sich mit ihnen ein deutlicher Hemmeffekt auf den Sauerstoffverbrauch nachweisen ließ [Schmid et al. 2000], sollten nun für diese Konzentrationen Untersuchungen zur Expression der cAMP-spezifischen PDE folgen.


[Seite 34↓]

2.4.2.2  Lysierung der PBMC und Isolierung der Gesamt-RNA

Die Gewinnung von Gesamt-RNA führten wir anhand des Protokoll des RNeasyTM Kit der Firma QIAGEN (Hilden, Deutschland) durch. Die Lysierung der PBMC erfolgte mit Hilfe des Lysepuffers Buffer RLT des RNeasyTM Kit. Im Anschluß daran wurde das Protokoll zur Gewinnung einer höheren Ausbeute und Reinheit der RNA durch eine Phenol-Chloroform-Extraktion nach Chomczinski erweitert. [Bonham et al. 1996, Chomczinski et al. 1987] Die Phenol-Chloroform-Fällungsreaktion basiert auf dem unterschiedlichen Lösungsverhalten von DNA und RNA in organischen Lösungsmitteln. Mit ihr kann schon ein großer Anteil von Proteinen und DNA entfernt werden.

Zunächst wurde die Zellsuspension mit PBS gewaschen, der Überstand dekantiert und RLT-Lysepuffer auf das erhaltene Zellpellet gegeben. Die Homogenisierung der Probe erfolgte mittels QIAshredder.

Das gewonnene Lysat / Probe wurde entsprechend auf Tubes verteilt und mit 1/10 Volumen Na-Acetat (2 M, ph 4,0), 1 Volumen H2O-gesättigtes Phenol und pro ml Phenol mit 0,2 ml Chloroform / Isoamylalkohol-Gemisch (49:1) versetzt. Zur Phasentrennung erfolgte eine Zentrifugation für 20 min bei 10 000 rpm und 4°C. Danach wurde die obere wässrige Phase, in der sich die RNA befindet, abpipettiert, in Tubes verteilt und mit je 1 Volumen 70% igen DEPC-Alkohol gemischt.

Die weiteren Schritte zur Isolierung der RNA erfolgten wieder anhand des Protokolls des RNeasyTM Kit. Das Prinzip beruht auf einer Bindung der RNA an eine Silikonmembran. Nach mehreren Waschschritten mit hochkonzentrierten Salzlösungen und Alkohol, wurde die RNA durch RNase-freiem Wasser aus der Membran gelöst und darin aufgenommen. Anschließend erfolgte entweder eine sofortige Weiterverarbeitung oder die RNA-Proben wurden bei -80°C eingefroren. Zur qualitativen Überprüfung der RNA wurde die Gelelektrophorese eingesetzt. Die Konzentrationsbestimmung der gewonnenen RNA erfolgte mit dem Spektralphotometer Gene Quant II (Pharmacia Biotech, Freiburg, Deutschland) bei λ260 nm. Der Reinheitsfaktor betrug mindestens 1,7-2.


[Seite 35↓]

2.4.2.3  Umschreibung der RNA in cDNA

Die RNA-Gesamtpopulation setzt sich bei Eukaryoten zu 80-85% aus ribosomaler RNA, zu 10-15% aus transfer RNA und zu 2-4% aus messenger RNA zusammen. Die Analyse der mRNA-Population gibt Aufschluß darüber, welche Gene zum Zeitpunkt der Präparation in der jeweiligen Zelle exprimiert werden. Damit können Aussagen über den aktuellen Genexpressionsstatus des untersuchten Materials getroffen werden. [Gassen et al. 1994, Guyon et al. 1994]Durch Wahl des Oligo(dT)-Primer läßt sich aus der Gesamt-RNA eine mRNA-spezifische cDNA synthetisieren. Zur Umschreibung werden folgende Substanzen in einem Reaktionsvolumen von

20 μl je Probe benötigt:

11 μl RNA-Primer-Mix:

 

- 10 μl einer definierten RNA-Menge (x μl RNA-Probe aufgefüllt mit Aqua dest.)

 

- 1 μl Oligo(dT) 12-18 -Primer 1

9 μl Master Mix:

 

- 1 μl SUPERSCRIPTTM II RNase H -Reverse Transcriptase 1

 

- 4 μl RT-Puffer (Strand Buffer) 1

 

- 2 μl DTT-Puffer 1

 

- 1 μl RNase-Inhibitor 1

 

- 1μl dNTP-Mix (je 10 mM dATP, dCTP, dGTP, dTTP) 2

Der RNA-Primer-Mix wurde bei 80 °C für 5 min denaturiert und anschließend auf Eis gestellt. Der Mastermix wurde bei 43 °C für 5 min vorgewärmt, danach wurden je 9 μl Mastermix zum RNA-Primer-Mix zugegeben. Der gesamte Ansatz wurde bei 43 °C für 90 min zur Synthese und abschließend bei 90 °C für 1 min zur Enzyminaktivierung inkubiert. Das erhaltene cDNA/RNA- Gemisch wurde bei -20 °C gelagert.


[Seite 36↓]

2.4.2.4  Einstellung der cDNA-Menge

Für den Vergleich der PCR-Produktmengen ist der Einsatz gleicher Ausgangsmengen an cDNA notwendig. Ein Einsatz unterschiedlicher cDNA-Mengen würde von vornherein eine unterschiedliche Menge an amplifizierten Nukleinsäuren nach sich ziehen und damit einen korrekten Vergleich des Untersuchungsmaterials ausschließen. Aus diesem Grund wurden die Mengen an cDNA der Proben abgeschätzt und gegenfalls korrigiert. [Schmid et al. 2000]

Die Einstellung der cDNA erfolgte über eine PCR, bei der als Standard Glyceraldehyd-3-phosphat-dehydrogenase (GAPDH) spezifische Sequenzen amplifiziert wurden. Das GAPDH-Gen gehört zu den sogenannten „housekeeping genes“. Das sind Gene, die im Zellzyklus mit gleichbleibender Intensität exprimiert werden und ubiquitär vorhanden sind. Daher wird die Expression der GAPDH häufig als interner Standard bei Genexpressionsuntersuchungen verwendet. [Hermsdorf et al. 1999; Köhler et al. 1995; Guyon et al. 1994; Dukas et al. 1993]

2.4.2.5 Amplifikation der cDNA

Die für die Amplifikation der cAMP-spezifischen PDE und der GAPDH notwendigen Primer wurden computergestützt ermittelt. Mit Hilfe der Softwareprogramme Gene Man (Version 3.21, DNASTAR, Inc.) und Primer Select (Version 3.04a, DNASTAR, Inc.) wurden die DNA-Sequenzen gesucht und die entsprechenden Primer ausgewählt. [Schmid et al. 2000] Zur Amplifikation kamen folgende Substanzen zum Einsatz:

10 mM dNTP-Mix (mit je 10 mM dATP, dCTP, dGTP, dTTP) 2

Ampli Taq Gold (5 U/μl) 3

10X PCR-Puffer 3

100 μM Primer (cAMP-spezifische PDE / GAPDH) 1

steriles Aqua dest.


[Seite 37↓]

Tabelle 3: Primer zur Amplifikation der cAMP-spezifischen PDE und der GAPDH

mRNA

Accession-Nummer

Primer

Primersequenzen (5‘-3‘)

Amplifikat-Länge (in bp)

cAMP-

spezifische

PDE

M37744

„upper“

„lower“

AGTGTTCACGGACCTGGAGATT

GCCTGGCCCCTTGACT

730

GAPDH

M33197

„upper“

„lower“

ATGGGGAAGGTGAAGGTCGGAGTC

GACGCCTGCTTCACCACCTTCTTG

797

Die Substanzen wurden in einem Reaktionsvolumen von 100 μl auf Eis pipettiert. Je nach Anzahl der benötigten Ansätze wurde entsprechend ein Vielfaches der Reagenzien angesetzt.

92

μl PCR-Mix

- 2 μl dNTP-Mix (0,2 mM je dATP, dCTP, dGTP, dTTP)

- 10 μl 10X PCR-Puffer (10 mM Tris-HCl, 50 mM KCl, 1,5 mM MgCl2 )

- 80 μl Aqua dest.

2

μl cDNA (Probe)

 

4

μl PDE-Primer-Mix

bzw. GAPDH-Primer-Mix:

- 2 μl „upper“ + 2 μl „lower“ Primer (1 μM je Primer)

- 2 μl „upper“ + 2 μl „lower“ Primer (0,5 μM je Primer)

2

μl Ampli Taq Gold (Menge: 2U)

 

Die Amplifikation erfolgte im Thermocycler (PTC-100, MJ Research) mit dem folgenden Protokoll:

1.

Initiale Aktivierung der Ampli Taq Gold

93 °C

20 min

2.

Denaturierung

94 °C

1 min

3.

Annealing

61 °C

1 min

4.

Extention (Polymerisation)

72 °C

2 min

  

(35 Wiederholungen des Schritt 2-4)

 

5.

abschließende Extention

72 °C

10 min


[Seite 38↓]

Am Ende der Extentionsphasen erfolgte die Entnahmen von jeweils 10 μl Probe. Die geschah für GAPDH-spezifische Sequenzen nach dem 22., 24., 26., 28., 30. und 32. Zyklus und für cAMP-spezifische PDE-Sequenzen nach dem 28., 30., 32., 34., 36. und 38. Zyklus. Die PCR-Produkte wurden bei 4° C gelagert.

2.4.2.6 Analyse der Amplifikationsprodukte

Die PCR-Produkte wurden elektrophoretisch in einem 1% igen Agarosegel aufgetrennt und computergestützt analysiert und quantifiziert. Es wurde 1% (w/v) Agarose 4 in 1 x TAE-Puffer 4 (40 mM Tris-Acetat, 1 mM EDTA mit Essigsäure auf pH 8,0 eingestellt) durch Aufkochen in der Mikrowelle gelöst. Nach Zugabe von Ethidiumbromid 4 mit einer Endkonzentration von 0,1 μg/ml wurde das Gel gegossen. Anschließend erfolgte die Pipettierung von jeweils 4 μl PCR-Proben mit 2 μl 3 x Ladepuffer (0,03 % Bromphenolblau, 0,03 % Xylene Cyanol FF, 15 % Glycerol, 25 mM EDTA pH 8,0) in die Geltaschen und unter konstanter Stromstärke und -spannung die Auftrennung. Bei jeder Elektrophorese wurde ein Längenstandard (Low DNA MASSTM Ladder) 1 mitgeführt.

Die Aufnahme des Gels erfolgte mit Hilfe des Videokamera-Dokumentationssytemes. (Appligene, Inc.) Unter UV-Durchleuchtung (Transluminator Modell EB25, Ultra-LUM, Inc.) wurde eine Schwarzweißaufnahme erzeugt, digital gespeichert und mittels Software Imager 1D&2D (Version 2.0, Appligene, Inc.) densitometrisch ausgewertet. Durch Summation der Helligkeitswerte im Bereich der Spuren wurde eine Kurve erzeugt, deren Integral proportional zu der erfassenden Bandenintensität war und somit als Maß für diese verwendet werden konnte. Die Angaben erfolgten in AU (arbitary units). [Schmid et al. 2000]


[Seite 39↓]

2.4.2.7  Spaltung der DNA mit Restriktionsendonukleasen

Die amplifizierten DNA-Produkte wurden mit Restriktionsendonukleasen geschnitten und gelelektrophoretisch aufgetrennt. Restriktionsendonukleasen sind Enzyme, die spezifische Basensequenzen erkennen und die Nukleotidstränge an dieser Stelle spalten. Nach elektrophoretischer Auftrennung ergeben die Fragmente der Nukleotidstränge ein spezifisches Muster, das charakteristisch für die untersuchten Nukleotidstränge ist. Das Muster ergibt damit einen Hinweis auf die Spezifität der amplifizierten PCR-Produkte. [Schmid et al. 2000]

Zum Schneiden der PCR-Produkte der cAMP-spezifischen PDE wurden die Restriktionsenzyme Nco I 5 und Pst I 5 ermittelt, zum Fragmentieren der PCR-Produkte der GAPDH die Restriktionsenzyme Hinf I 2 und Hinf III 6. Als Puffer wurde 10 x OPA Puffer Plus 6 eingesetzt. Die Ermittlung der Restriktionsschnittstellen erfolgte computergestützt mit Hilfe des Programmes Map Draw (Version 3.08, DNASTAR, Inc.). Bei der Auftrennung wurde als Längenstandard der DNA Molecular Weight Marker VI 2 verwendet. Zu einem Gesamtvolumen von 10 μl erfolgte die Zugabe von je 4 μl PCR-Produkt, 5U des spezifischen Restriktionsenzym und des entsprechenden Volumens des OPA Puffer Plus. Nach einer Inkubation bei 37 °C für 60 min wurde das Gemisch in einem 2 %igen Agarosegel aufgetrennt.

1 Life Technologie GmbH, Eggenstein, Deutschland;

2 La Roche, Mannheim, Deutschland;

3 Perkin Elmer-Applied Biosystems Division, Foster City, USA;

4 Sigma, Deisenhofen, Deutschland;

5 Pharmacia Biotech, Freiburg, Deutschland;

6 Pharmacia, Freiburg, Deutschland


[Seite 40↓]

2.5  Statistische Auswertungen

Die Auswertung der Ergebnisse erfolgte auf der Grundlage der Berechnung des arithmetischen Mittelwertes (MW) und der Standardabweichung (SD bzw. SEM). Zum Vergleich zweier verbundener Stichproben wurde der T-Test bei gepaarten Stichproben eingesetzt. Beim Vergleich zweier nicht verbundener Stichproben wurde der T-Test bei unabhängigen Stichproben angewendet. Eine statistische Wahrscheinlichkeit von p ≤ 0,05 wurde als signifikant angesehen.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
30.09.2004