<?xml version="1.0" encoding="ISO-8859-1"?><cms:container xmlns:cms="http://edoc.hu-berlin.de/diml/module/cms"><cms:document><cms:meta><cms:entry id="front" part="front" ref="front" type="front"/><cms:entry type="title">Functional analysis of phototropin in  <em>Chlamydomonas reinhardtii</em>
      </cms:entry><cms:entry type="author">Yinghong Lu</cms:entry><cms:entry id="chapter1" part="chapter1" ref="chapter1" type="chapter">1</cms:entry><cms:entry id="N1007A" part="chapter1" ref="N1007A" type="citenumber">1</cms:entry><cms:entry id="N1008C" part="chapter1" ref="N1008C" type="citenumber">2</cms:entry><cms:entry id="chapter2" part="chapter2" ref="chapter2" type="chapter">2</cms:entry><cms:entry id="N100C3" part="chapter2" ref="N100C3" type="section">2.1</cms:entry><cms:entry id="N100CA" part="chapter2" ref="N100CA" type="citenumber">3</cms:entry><cms:entry id="N100D3" part="chapter2" ref="N100D3" type="mm">642#100</cms:entry><cms:entry id="N100E1" part="chapter2" ref="N100E1" type="citenumber">4</cms:entry><cms:entry id="N10108" part="chapter2" ref="N10108" type="citenumber">5</cms:entry><cms:entry id="N1010B" part="chapter2" ref="N1010B" type="mm">384#438</cms:entry><cms:entry id="N1014C" part="chapter2" ref="N1014C" type="citenumber">6</cms:entry><cms:entry id="N1015A" part="chapter2" ref="N1015A" type="section">2.2</cms:entry><cms:entry id="N10170" part="chapter2" ref="N10170" type="citenumber">7</cms:entry><cms:entry id="N10173" part="chapter2" ref="N10173" type="mm">444#366</cms:entry><cms:entry id="N101B4" part="chapter2" ref="N101B4" type="citenumber">8</cms:entry><cms:entry id="N101B7" part="chapter2" ref="N101B7" type="mm">328#429</cms:entry><cms:entry id="DDE_LINK2" part="chapter2" ref="DDE_LINK2" type="link"/><cms:entry id="N101D4" part="chapter2" ref="N101D4" type="citenumber">9</cms:entry><cms:entry id="N101E8" part="chapter2" ref="N101E8" type="section">2.3</cms:entry><cms:entry id="N101F2" part="chapter2" ref="N101F2" type="citenumber">10</cms:entry><cms:entry id="N1022B" part="chapter2" ref="N1022B" type="citenumber">11</cms:entry><cms:entry id="N1027C" part="chapter2" ref="N1027C" type="citenumber">12</cms:entry><cms:entry id="N102C0" part="chapter2" ref="N102C0" type="section">2.4</cms:entry><cms:entry id="N102C7" part="chapter2" ref="N102C7" type="citenumber">13</cms:entry><cms:entry id="N102D3" part="chapter2" ref="N102D3" type="mm">642#443</cms:entry><cms:entry id="N102E1" part="chapter2" ref="N102E1" type="citenumber">14</cms:entry><cms:entry id="N102ED" part="chapter2" ref="N102ED" type="citenumber">15</cms:entry><cms:entry id="N10308" part="chapter2" ref="N10308" type="mm">507#568</cms:entry><cms:entry id="N10316" part="chapter2" ref="N10316" type="citenumber">16</cms:entry><cms:entry id="N10319" part="chapter2" ref="N10319" type="mm">444#805</cms:entry><cms:entry id="N10329" part="chapter2" ref="N10329" type="section">2.5</cms:entry><cms:entry id="N1033C" part="chapter2" ref="N1033C" type="citenumber">17</cms:entry><cms:entry id="chapter3" part="chapter3" ref="chapter3" type="chapter">3</cms:entry><cms:entry id="N10347" part="chapter3" ref="N10347" type="section">3.1</cms:entry><cms:entry id="N1034C" part="chapter3" ref="N1034C" type="subsection">3.1.1</cms:entry><cms:entry id="N10351" part="chapter3" ref="N10351" type="helpercitenumber">17</cms:entry><cms:entry id="N10359" part="chapter3" ref="N10359" type="mm">575#201</cms:entry><cms:entry id="N10382" part="chapter3" ref="N10382" type="citenumber">18</cms:entry><cms:entry id="N103A0" part="chapter3" ref="N103A0" type="citenumber">19</cms:entry><cms:entry id="N103A3" part="chapter3" ref="N103A3" type="mm">523#411</cms:entry><cms:entry id="N103DD" part="chapter3" ref="N103DD" type="subsection">3.1.2</cms:entry><cms:entry id="N103E4" part="chapter3" ref="N103E4" type="citenumber">20</cms:entry><cms:entry id="N103F6" part="chapter3" ref="N103F6" type="citenumber">21</cms:entry><cms:entry id="N103F9" part="chapter3" ref="N103F9" type="mm">642#286</cms:entry><cms:entry id="N1042C" part="chapter3" ref="N1042C" type="subsection">3.1.3</cms:entry><cms:entry id="N10439" part="chapter3" ref="N10439" type="citenumber">22</cms:entry><cms:entry id="N1043C" part="chapter3" ref="N1043C" type="mm">642#349</cms:entry><cms:entry id="N1045B" part="chapter3" ref="N1045B" type="section">3.2</cms:entry><cms:entry id="N10463" part="chapter3" ref="N10463" type="subsection">3.2.1</cms:entry><cms:entry id="N10469" part="chapter3" ref="N10469" type="citenumber">23</cms:entry><cms:entry id="N1048D" part="chapter3" ref="N1048D" type="citenumber">24</cms:entry><cms:entry id="N10490" part="chapter3" ref="N10490" type="mm">642#451</cms:entry><cms:entry id="N104B5" part="chapter3" ref="N104B5" type="subsection">3.2.2</cms:entry><cms:entry id="N104C2" part="chapter3" ref="N104C2" type="citenumber">25</cms:entry><cms:entry id="N104E2" part="chapter3" ref="N104E2" type="subsection">3.2.3</cms:entry><cms:entry id="N104FE" part="chapter3" ref="N104FE" type="citenumber">26</cms:entry><cms:entry id="N10501" part="chapter3" ref="N10501" type="mm">507#724</cms:entry><cms:entry id="N10512" part="chapter3" ref="N10512" type="mm">514#732</cms:entry><cms:entry id="N1055E" part="chapter3" ref="N1055E" type="section">3.3</cms:entry><cms:entry id="N10565" part="chapter3" ref="N10565" type="citenumber">27</cms:entry><cms:entry id="N10572" part="chapter3" ref="N10572" type="subsection">3.3.1</cms:entry><cms:entry id="N1057C" part="chapter3" ref="N1057C" type="citenumber">28</cms:entry><cms:entry id="N105AF" part="chapter3" ref="N105AF" type="mm">431#274</cms:entry><cms:entry id="N105C5" part="chapter3" ref="N105C5" type="subsection">3.3.2</cms:entry><cms:entry id="N105CC" part="chapter3" ref="N105CC" type="citenumber">29</cms:entry><cms:entry id="N105D8" part="chapter3" ref="N105D8" type="mm">588#483</cms:entry><cms:entry id="N10607" part="chapter3" ref="N10607" type="citenumber">30</cms:entry><cms:entry id="N10635" part="chapter3" ref="N10635" type="subsection">3.3.3</cms:entry><cms:entry id="N1063C" part="chapter3" ref="N1063C" type="citenumber">31</cms:entry><cms:entry id="N10657" part="chapter3" ref="N10657" type="citenumber">32</cms:entry><cms:entry id="N1069C" part="chapter3" ref="N1069C" type="citenumber">33</cms:entry><cms:entry id="N1069F" part="chapter3" ref="N1069F" type="mm">603#335</cms:entry><cms:entry id="N106BC" part="chapter3" ref="N106BC" type="section">3.4</cms:entry><cms:entry id="N106C1" part="chapter3" ref="N106C1" type="subsection">3.4.1</cms:entry><cms:entry id="DDE_LINK1" part="chapter3" ref="DDE_LINK1" type="link"/><cms:entry id="N106DD" part="chapter3" ref="N106DD" type="citenumber">34</cms:entry><cms:entry id="N106EF" part="chapter3" ref="N106EF" type="mm">619#202</cms:entry><cms:entry id="N10700" part="chapter3" ref="N10700" type="citenumber">35</cms:entry><cms:entry id="N10703" part="chapter3" ref="N10703" type="mm">599#187</cms:entry><cms:entry id="N1071D" part="chapter3" ref="N1071D" type="citenumber">36</cms:entry><cms:entry id="N1072F" part="chapter3" ref="N1072F" type="citenumber">37</cms:entry><cms:entry id="N10732" part="chapter3" ref="N10732" type="mm">599#102</cms:entry><cms:entry id="N10748" part="chapter3" ref="N10748" type="subsection">3.4.2</cms:entry><cms:entry id="N10758" part="chapter3" ref="N10758" type="citenumber">38</cms:entry><cms:entry id="N10761" part="chapter3" ref="N10761" type="mm">591#521</cms:entry><cms:entry id="N10775" part="chapter3" ref="N10775" type="citenumber">39</cms:entry><cms:entry id="N10778" part="chapter3" ref="N10778" type="mm">463#280</cms:entry><cms:entry id="N1079E" part="chapter3" ref="N1079E" type="citenumber">40</cms:entry><cms:entry id="N107A7" part="chapter3" ref="N107A7" type="mm">439#344</cms:entry><cms:entry id="N107C1" part="chapter3" ref="N107C1" type="mm">475#555</cms:entry><cms:entry id="N107D8" part="chapter3" ref="N107D8" type="citenumber">41</cms:entry><cms:entry id="N107DB" part="chapter3" ref="N107DB" type="mm">635#439</cms:entry><cms:entry id="N107EE" part="chapter3" ref="N107EE" type="subsection">3.4.3</cms:entry><cms:entry id="N107F6" part="chapter3" ref="N107F6" type="block">3.4.3.1</cms:entry><cms:entry id="N10809" part="chapter3" ref="N10809" type="citenumber">42</cms:entry><cms:entry id="N1080C" part="chapter3" ref="N1080C" type="mm">631#179</cms:entry><cms:entry id="N10820" part="chapter3" ref="N10820" type="table"/><cms:entry id="DDE_LINK21" part="chapter3" ref="DDE_LINK21" type="link"/><cms:entry id="N108AD" part="chapter3" ref="N108AD" type="citenumber">43</cms:entry><cms:entry id="N108B5" part="chapter3" ref="N108B5" type="block">3.4.3.2</cms:entry><cms:entry id="N108BF" part="chapter3" ref="N108BF" type="citenumber">44</cms:entry><cms:entry id="N108C2" part="chapter3" ref="N108C2" type="mm">475#250</cms:entry><cms:entry id="N108D5" part="chapter3" ref="N108D5" type="block">3.4.3.3</cms:entry><cms:entry id="N108E2" part="chapter3" ref="N108E2" type="citenumber">45</cms:entry><cms:entry id="N108E5" part="chapter3" ref="N108E5" type="mm">395#360</cms:entry><cms:entry id="N108F6" part="chapter3" ref="N108F6" type="mm">642#523</cms:entry><cms:entry id="N10904" part="chapter3" ref="N10904" type="citenumber">46</cms:entry><cms:entry id="N10907" part="chapter3" ref="N10907" type="mm">630#934</cms:entry><cms:entry id="N1090D" part="chapter3" ref="N1090D" type="mm">614#934</cms:entry><cms:entry id="N10914" part="chapter3" ref="N10914" type="mm">614#934</cms:entry><cms:entry id="N1091B" part="chapter3" ref="N1091B" type="citenumber">47</cms:entry><cms:entry id="N1091E" part="chapter3" ref="N1091E" type="mm">614#934</cms:entry><cms:entry id="N10925" part="chapter3" ref="N10925" type="subsection">3.4.4</cms:entry><cms:entry id="N10944" part="chapter3" ref="N10944" type="mm">595#118</cms:entry><cms:entry id="N1095E" part="chapter3" ref="N1095E" type="citenumber">48</cms:entry><cms:entry id="N10961" part="chapter3" ref="N10961" type="mm">599#217</cms:entry><cms:entry id="N1097A" part="chapter3" ref="N1097A" type="subsection">3.4.5</cms:entry><cms:entry id="N10984" part="chapter3" ref="N10984" type="citenumber">49</cms:entry><cms:entry id="N10991" part="chapter3" ref="N10991" type="block">3.4.5.1</cms:entry><cms:entry id="N109A7" part="chapter3" ref="N109A7" type="mm">639#509</cms:entry><cms:entry id="N109CA" part="chapter3" ref="N109CA" type="citenumber">50</cms:entry><cms:entry id="N109CD" part="chapter3" ref="N109CD" type="mm">603#457</cms:entry><cms:entry id="N10A0B" part="chapter3" ref="N10A0B" type="citenumber">51</cms:entry><cms:entry id="N10A0E" part="chapter3" ref="N10A0E" type="mm">343#98</cms:entry><cms:entry id="N10A24" part="chapter3" ref="N10A24" type="block">3.4.5.2</cms:entry><cms:entry id="N10A31" part="chapter3" ref="N10A31" type="mm">591#95</cms:entry><cms:entry id="N10A42" part="chapter3" ref="N10A42" type="citenumber">52</cms:entry><cms:entry id="N10A51" part="chapter3" ref="N10A51" type="mm">391#307</cms:entry><cms:entry id="N10A6B" part="chapter3" ref="N10A6B" type="citenumber">53</cms:entry><cms:entry id="N10A6E" part="chapter3" ref="N10A6E" type="mm">495#176</cms:entry><cms:entry id="N10A85" part="chapter3" ref="N10A85" type="citenumber">54</cms:entry><cms:entry id="N10A88" part="chapter3" ref="N10A88" type="mm">539#410</cms:entry><cms:entry id="N10A9C" part="chapter3" ref="N10A9C" type="mm">642#816</cms:entry><cms:entry id="N10AA7" part="chapter3" ref="N10AA7" type="mm">642#678</cms:entry><cms:entry id="N10AB2" part="chapter3" ref="N10AB2" type="citenumber">55</cms:entry><cms:entry id="N10AB5" part="chapter3" ref="N10AB5" type="mm">642#441</cms:entry><cms:entry id="N10ABC" part="chapter3" ref="N10ABC" type="mm">642#439</cms:entry><cms:entry id="N10AC0" part="chapter3" ref="N10AC0" type="mm">642#442</cms:entry><cms:entry id="N10AC4" part="chapter3" ref="N10AC4" type="mm">642#440</cms:entry><cms:entry id="chapter4" part="chapter4" ref="chapter4" type="chapter">4</cms:entry><cms:entry id="N10AD2" part="chapter4" ref="N10AD2" type="section">4.1</cms:entry><cms:entry id="N10ADA" part="chapter4" ref="N10ADA" type="helpercitenumber">55</cms:entry><cms:entry id="N10AE5" part="chapter4" ref="N10AE5" type="citenumber">56</cms:entry><cms:entry id="DDE_LINK11" part="chapter4" ref="DDE_LINK11" type="link"/><cms:entry id="N10AFD" part="chapter4" ref="N10AFD" type="mm">581#248</cms:entry><cms:entry id="N10B10" part="chapter4" ref="N10B10" type="citenumber">57</cms:entry><cms:entry id="N10B46" part="chapter4" ref="N10B46" type="citenumber">58</cms:entry><cms:entry id="N10B76" part="chapter4" ref="N10B76" type="citenumber">59</cms:entry><cms:entry id="N10B7E" part="chapter4" ref="N10B7E" type="section">4.2</cms:entry><cms:entry id="N10B9C" part="chapter4" ref="N10B9C" type="citenumber">60</cms:entry><cms:entry id="N10BC6" part="chapter4" ref="N10BC6" type="citenumber">61</cms:entry><cms:entry id="N10BE0" part="chapter4" ref="N10BE0" type="section">4.3</cms:entry><cms:entry id="N10BE7" part="chapter4" ref="N10BE7" type="citenumber">62</cms:entry><cms:entry id="N10C08" part="chapter4" ref="N10C08" type="citenumber">63</cms:entry><cms:entry id="N10C4D" part="chapter4" ref="N10C4D" type="citenumber">64</cms:entry><cms:entry id="N10C55" part="chapter4" ref="N10C55" type="section">4.4</cms:entry><cms:entry id="N10C7A" part="chapter4" ref="N10C7A" type="citenumber">65</cms:entry><cms:entry id="N10CBF" part="chapter4" ref="N10CBF" type="citenumber">66</cms:entry><cms:entry id="N10CDA" part="chapter4" ref="N10CDA" type="citenumber">67</cms:entry><cms:entry id="N10CEC" part="chapter4" ref="N10CEC" type="mm">354#156</cms:entry><cms:entry id="N10D09" part="chapter4" ref="N10D09" type="citenumber">68</cms:entry><cms:entry ref="chapter5" type="chapter">5</cms:entry><cms:entry ref="N10D23" type="section">5.1</cms:entry><cms:entry ref="N10D30" type="subsection">5.1.1</cms:entry><cms:entry ref="N10D38" type="helpercitenumber">68</cms:entry><cms:entry ref="N10D52" type="citenumber">69</cms:entry><cms:entry ref="N10DA6" type="citenumber">70</cms:entry><cms:entry ref="N10DAE" type="table"/><cms:entry ref="N10E8C" type="citenumber">71-76</cms:entry><cms:entry ref="N10E8F" type="table"/><cms:entry ref="N10F92" type="citenumber">77-82</cms:entry><cms:entry ref="N10FD6" type="citenumber">83-85</cms:entry><cms:entry ref="N10FD9" type="table"/><cms:entry ref="N110A0" type="citenumber">86</cms:entry><cms:entry ref="N110A5" type="subsection">5.1.2</cms:entry><cms:entry ref="N110C2" type="subsection">5.1.3</cms:entry><cms:entry ref="N110C9" type="citenumber">87</cms:entry><cms:entry ref="N110DB" type="table"/><cms:entry ref="N1115C" type="subsection">5.1.4</cms:entry><cms:entry ref="N11163" type="citenumber">89</cms:entry><cms:entry ref="N1116F" type="citenumber">90</cms:entry><cms:entry ref="N11174" type="subsection">5.1.5</cms:entry><cms:entry ref="N11183" type="subsection">5.1.6</cms:entry><cms:entry ref="N1119C" type="citenumber">91</cms:entry><cms:entry ref="N111A1" type="subsection">5.1.7</cms:entry><cms:entry ref="N111A9" type="block">5.1.7.1</cms:entry><cms:entry ref="N111BB" type="block">5.1.7.2</cms:entry><cms:entry ref="N111CB" type="subsection">5.1.8</cms:entry><cms:entry ref="N111D2" type="citenumber">92</cms:entry><cms:entry ref="N1120B" type="citenumber">93</cms:entry><cms:entry ref="N1122D" type="subsection">5.1.9</cms:entry><cms:entry ref="N1123D" type="citenumber">94</cms:entry><cms:entry ref="N11245" type="table"/><cms:entry ref="N11291" type="section">5.2</cms:entry><cms:entry ref="N11299" type="subsection">5.2.1</cms:entry><cms:entry ref="N112A2" type="citenumber">95</cms:entry><cms:entry ref="N112AE" type="citenumber">96</cms:entry><cms:entry ref="N112BD" type="table"/><cms:entry ref="N113BD" type="citenumber">97</cms:entry><cms:entry ref="N113EB" type="table"/><cms:entry ref="N114EF" type="subsection">5.2.2</cms:entry><cms:entry ref="N114F4" type="block">5.2.2.1</cms:entry><cms:entry ref="N114FB" type="citenumber">98</cms:entry><cms:entry ref="N1150C" type="block">5.2.2.2</cms:entry><cms:entry ref="N11513" type="citenumber">99</cms:entry><cms:entry ref="N11521" type="block">5.2.2.3</cms:entry><cms:entry ref="N1152E" type="citenumber">100</cms:entry><cms:entry ref="N11538" type="block">5.2.2.4</cms:entry><cms:entry ref="N1154F" type="section">5.3</cms:entry><cms:entry ref="N11557" type="subsection">5.3.1</cms:entry><cms:entry ref="N11561" type="citenumber">101</cms:entry><cms:entry ref="N11585" type="table"/><cms:entry ref="N11600" type="citenumber">102</cms:entry><cms:entry ref="N11609" type="table"/><cms:entry ref="N11689" type="citenumber">103</cms:entry><cms:entry ref="N1168C" type="table"/><cms:entry ref="N116E3" type="subsection">5.3.2</cms:entry><cms:entry ref="N116F5" type="citenumber">104</cms:entry><cms:entry ref="N1171B" type="citenumber">105</cms:entry><cms:entry ref="N11724" type="table"/><cms:entry ref="N117BA" type="citenumber">106</cms:entry><cms:entry ref="N117CC" type="table"/><cms:entry ref="N1182C" type="citenumber">107</cms:entry><cms:entry ref="N1182F" type="table"/><cms:entry ref="N118AE" type="citenumber">108</cms:entry><cms:entry ref="N118B1" type="table"/><cms:entry ref="N11926" type="subsection">5.3.3</cms:entry><cms:entry ref="N11933" type="citenumber">109</cms:entry><cms:entry ref="N1193F" type="table"/><cms:entry ref="N1199F" type="subsection">5.3.4</cms:entry><cms:entry ref="N119A7" type="block">5.3.4.1</cms:entry><cms:entry ref="N119B1" type="citenumber">110</cms:entry><cms:entry ref="N119B9" type="block">5.3.4.2</cms:entry><cms:entry ref="N119C9" type="section">5.4</cms:entry><cms:entry ref="N119D1" type="subsection">5.4.1</cms:entry><cms:entry ref="N119DB" type="citenumber">111</cms:entry><cms:entry ref="N119EA" type="citenumber">112</cms:entry><cms:entry ref="N119ED" type="table"/><cms:entry ref="N11A78" type="section">5.5</cms:entry><cms:entry ref="N11A82" type="subsection">5.5.1</cms:entry><cms:entry ref="N11ABD" type="citenumber">113</cms:entry><cms:entry ref="N11ADB" type="subsection">5.5.2</cms:entry><cms:entry ref="N11AE7" type="subsection">5.5.3</cms:entry><cms:entry ref="N11AEE" type="citenumber">114</cms:entry><cms:entry ref="N11AFA" type="table"/><cms:entry ref="N11B40" type="citenumber">115</cms:entry><cms:entry ref="N11B49" type="table"/><cms:entry ref="N11BC7" type="subsection">5.5.4</cms:entry><cms:entry ref="N11BD0" type="subsection">5.5.5</cms:entry><cms:entry ref="N11BD7" type="citenumber">116</cms:entry><cms:entry ref="N11BDD" type="table"/><cms:entry ref="N11C8F" type="citenumber">117</cms:entry><cms:entry ref="N11C95" type="table"/><cms:entry ref="N11D4A" type="subsection">5.5.6</cms:entry><cms:entry ref="N11D51" type="citenumber">118</cms:entry><cms:entry ref="N11D58" type="subsection">5.5.7</cms:entry><cms:entry ref="N11D63" type="subsection">5.5.8</cms:entry><cms:entry ref="N11D7A" type="section">5.6</cms:entry><cms:entry ref="N11D7F" type="subsection">5.6.1</cms:entry><cms:entry ref="N11D86" type="citenumber">119</cms:entry><cms:entry ref="N11D94" type="subsection">5.6.2</cms:entry><cms:entry ref="N11DA4" type="citenumber">120</cms:entry><cms:entry ref="N11DA7" type="table"/><cms:entry ref="N11E25" type="table"/><cms:entry ref="N11EB3" type="subsection">5.6.3</cms:entry><cms:entry ref="N11EB8" type="block">5.6.3.1</cms:entry><cms:entry ref="N11EBF" type="citenumber">121</cms:entry><cms:entry ref="N11ED0" type="table"/><cms:entry ref="N11F4F" type="citenumber">122</cms:entry><cms:entry ref="N11F58" type="table"/><cms:entry ref="N11FC3" type="block">5.6.3.2</cms:entry><cms:entry ref="N11FCD" type="subsection">5.6.4</cms:entry><cms:entry ref="N11FD4" type="citenumber">123</cms:entry><cms:entry ref="N11FE0" type="table"/><cms:entry ref="N1204A" type="citenumber">124</cms:entry><cms:entry ref="N12053" type="table"/><cms:entry ref="N120C3" type="citenumber">125</cms:entry><cms:entry ref="N120D2" type="citenumber">126</cms:entry><cms:entry ref="N120DB" type="table"/><cms:entry ref="N12144" type="subsection">5.6.5</cms:entry><cms:entry ref="N1215F" type="citenumber">127</cms:entry><cms:entry ref="N12176" type="subsection">5.6.6</cms:entry><cms:entry ref="N1217C" type="citenumber">128</cms:entry><cms:entry ref="N12188" type="citenumber">129</cms:entry><cms:entry ref="N1218B" type="table"/><cms:entry ref="N121FB" type="table"/><cms:entry ref="N12265" type="citenumber">130</cms:entry><cms:entry ref="N1226E" type="table"/><cms:entry ref="N122D2" type="subsection">5.6.7</cms:entry><cms:entry ref="N122DC" type="citenumber">131</cms:entry><cms:entry ref="N122E8" type="table"/><cms:entry ref="N12352" type="citenumber">132</cms:entry><cms:entry ref="N1235B" type="table"/><cms:entry ref="N123D1" type="citenumber">133</cms:entry><cms:entry ref="N123D4" type="table"/><cms:entry ref="N12458" type="section">5.7</cms:entry><cms:entry ref="N1245D" type="subsection">5.7.1</cms:entry><cms:entry ref="N12464" type="table"/><cms:entry ref="N12676" type="subsection">5.7.2</cms:entry><cms:entry ref="N1267D" type="table"/><cms:entry ref="N1282E" type="subsection">5.7.3</cms:entry><cms:entry ref="N12833" type="block">5.7.3.1</cms:entry><cms:entry ref="N1283A" type="citenumber">134</cms:entry><cms:entry ref="N1283D" type="table"/><cms:entry ref="N12A9C" type="block">5.7.3.2</cms:entry><cms:entry ref="N12AA3" type="table"/><cms:entry ref="N12B60" type="subsection">5.7.4</cms:entry><cms:entry ref="N12B67" type="citenumber">135</cms:entry><cms:entry ref="N12B6B" type="block">5.7.4.1</cms:entry><cms:entry ref="N12B72" type="table"/><cms:entry ref="N12C77" type="block">5.7.4.2</cms:entry><cms:entry ref="N12C7E" type="citenumber">136</cms:entry><cms:entry ref="N12C81" type="table"/><cms:entry ref="N12D9B" type="block">5.7.4.3</cms:entry><cms:entry ref="N12DA2" type="table"/><cms:entry ref="DDE_LINK3" type="link"/><cms:entry ref="N12E7E" type="citenumber">137</cms:entry><cms:entry ref="N12E8F" type="block">5.7.4.4</cms:entry><cms:entry ref="N12E96" type="table"/><cms:entry ref="N12EF9" type="block">5.7.4.5</cms:entry><cms:entry ref="N12F00" type="citenumber">138</cms:entry><cms:entry ref="N12F03" type="table"/><cms:entry ref="N12F66" type="block">5.7.4.6</cms:entry><cms:entry ref="N12F6D" type="table"/><cms:entry ref="N12FF2" type="citenumber">139</cms:entry><cms:entry ref="N13002" type="block">5.7.4.7</cms:entry><cms:entry ref="N13009" type="table"/><cms:entry ref="N13081" type="block">5.7.4.8</cms:entry><cms:entry ref="N13088" type="citenumber">140</cms:entry><cms:entry ref="N1308B" type="table"/><cms:entry ref="N130F4" type="block">5.7.4.9</cms:entry><cms:entry ref="N130FB" type="table"/><cms:entry ref="N1316B" type="citenumber">141</cms:entry><cms:entry ref="N1318E" type="block">5.7.4.10</cms:entry><cms:entry ref="N13195" type="table"/><cms:entry ref="N131F0" type="citenumber">142</cms:entry><cms:entry ref="N131FB" type="block">5.7.4.11</cms:entry><cms:entry ref="N13202" type="table"/><cms:entry ref="N132B4" type="back"/><cms:entry id="N132B6" part="N132B6" ref="N132B6" type="acknowledgement">Acknowledgments</cms:entry><cms:entry id="N132DD" part="N132DD" ref="N132DD" type="abbreviation">Abbreviations</cms:entry><cms:entry id="N132E4" part="N132DD" ref="N132E4" type="table"/><cms:entry id="N137A6" part="N137A6" ref="N137A6" type="bibliography">References</cms:entry><cms:entry id="N143C1" part="N143C1" ref="N143C1" type="vita">Lebenslauf</cms:entry><cms:entry id="N143CE" part="N143C1" ref="N143CE" type="table"/><cms:entry id="N14495" part="N14495" ref="N14495" type="declaration">Erklärung</cms:entry><cms:entry part="chapter5" type=":current"/><cms:entry type=":lang">en</cms:entry><cms:entry id=":contents" part="front" ref=":contents" type=":contents">Table of contents</cms:entry><cms:entry type=":help"><url href="http://...">Help</url></cms:entry></cms:meta><cms:content><chapter id="chapter5" label="5">
         <head>Materials and methods</head>
         <section id="N10D23" label="5.1">
            <head>Methods about handling with <em>C. reinhardtii </em>
               <em color="292526" slant="roman">(buffer recipes included)</em>
            </head>
            <subsection id="N10D30" label="5.1.1">
               <head>Growing <em>C. reinhardtii</em> in liquid culture</head>
               <p><citenumber helper="true" id="N10D38" start="68"/>
                  <em>C. reinhardtii</em> could be grown in liquid culture in Erlenmeyer flasks. In this thesis, 100ml Erlenmeyer flask with ~50ml culture medium was commonly used for growing <em>Chlamydomonas</em>. To prevent <em>Chlamydomonas</em> from precipitating or sticking together, the liquid culture in Erlenmeyer flasks were shaken or stirred continuously. The shaking speed was around 120rpm and stirring speed was around 200rpm. According to different requirement, different light intensities were applied to <em>Chlamydomonas</em> cultures. High light condition was ~9-10W/m<sup>2</sup>, middle light condition was ~4W/m<sup>2</sup> and low light condition was less than 1W/m<sup>2</sup>. The growing tempeature was 25ºC.</p>
               <p>
                  <citenumber id="N10D52" start="69"/>For screening large numbers of transformants, 96-well plates and 24-well plates were used for growing single <em>Chlamydomonas</em> clones. Those plates were transparent and made of plastic. They were placed under middle light condition (~4W/m<sup>2</sup>) and were kept still.</p>
               <p>For light gradient experiment, a home made light filter was used to create a light intensity gradient (20W/m<sup>2</sup>, 14.2W/m<sup>2</sup>, 11W/m<sup>2</sup>, 9.4W/m<sup>2</sup>, 5.2W/m<sup>2</sup>, 3W/m<sup>2</sup>, 1.6W/m<sup>2</sup>, 0.71W/m<sup>2</sup>, 230&#956;W/m<sup>2</sup>, 160&#956;W/m<sup>2</sup>, 95&#956;W/m<sup>2</sup>). 24 well plates were used for growing cells. They were kept still and were blown with an electric fan to get rid of the heat caused by the strong light intensity.</p>
               <p>Both HSA (high salt acetate) and TAP (Tris-Acetate-Phosphate) were used as media for vegetatively growing <em>Chlamydomonas</em>. For strain 806 and cw2, HSAS was used. For strain <em>cw15 arg- A</em> or <em>CC48 arg-</em>, TAPA, TAPAYZ, TAPATYZ or TAPAP was used. For wild type strain, <em>CC124mt(-)</em>, <em>CC125mt(+)</em>, <em>CC620mt(+)</em>, <em>CC621mt(-)</em> and bald strain <em>CC477</em>, <em>CC478</em> and <em>CC479</em>, TAP or HSA was chosen as growing media. For dark growing culture, TAPTY was used. For <em>CC32pab1mt(+)</em>, TAPP, TAPY, TAPYP or TAPPP was used. </p>
               <p>
                  <citenumber id="N10DA6" start="70"/>
                  <strong>TAP (Tris-Acetate-Phosphate)</strong>
               </p>
               <p><table frame="none" id="N10DAE" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NH<sub>4</sub>Cl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p> 7.5 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.4  mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CaCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.34 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>K<sub>2</sub>HPO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.54 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KH<sub>2</sub>PO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.46 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaAc</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris/Cl pH 7.0</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>20 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Hunter's trace elements</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1% </p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table></p>
               <p>
                  <strong>Hunter's trace elements</strong>
               </p>
               <p>
                  <citenumber id="N10E8C" start="71-76"/>
                  <table frame="none" id="N10E8F" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>ZnSO<sub>4</sub> · 7H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>22 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>H<sub>3</sub>BO<sub>3</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>11.4 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MnCl<sub>2</sub> · 4H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5.06 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>FeSO<sub>4</sub> · 7H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>4.99 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CoCl<sub>2</sub> · 6H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1.61 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CuSO<sub>4</sub> · 5H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1.57 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>(NH<sub>4</sub>)<sub>6</sub>Mo<sub>7</sub>O<sub>24</sub> · 2H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1.1 g </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>50 g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Dissolve in 1 liter water</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p><p><citenumber id="N10F92" start="77-82"/>TAPA(Tris-Actate-Phosphate-Arginine)</p>
               <p>TAP medium with 50mg/l L-arginine</p>
               <p>
                  TAPAYZ(Tris-Actate-Phosphate-Arginine-Yeast extract-Zeocin)</p>
               <p>TAPA medium with 10mg/l zeocin and 0.3%Yeast extract</p>
               <p>TAPATYZ(Tris-Actate-Phosphate-Arginine-Trypton-Yeast extract-Zeocin)</p>
               <p>TAPAYZ medium with 0.2% Bacto-Tryptone</p>
               <p>TAPAP(Tris-Actate-Phosphate-Arginine-Paromomycine)</p>
               <p>TAPA medium with 10mg/l paromomycine</p>
               <p>TAPTY(Tris-Actate-Phosphate-Arginine-Trypton-Yeast extract)</p>
               <p>TAP medium with 0.2% Bacto-Tryptone and 0.3%Yeast extract</p>
               <p>TAPY( Tris-Actate-Phosphate-Yeast extract)</p>
               <p>TAP medium with 0.3% Yeast extract</p>
               <p>TAPYP( Tris-Actate-Phosphate-Yeast extract-Paromomycine)</p>
               <p>TAPY medium with 10mg/l Paromomycine</p>
               <p>TAPPab( Tris-Acetate-Phosphate-PAB)</p>
               <p>TAP medium with 50mg/l PAB (p-aminobenzoic acid)</p>
               <p>TAPP(Tris-Acetate-Phosphate-Paromomycine)</p>
               <p>TAP medium with 10mg/l paromomycine</p>
               <p>TAPPP( Tris-Acetate-Phosphate-PAB-Paromomycine)</p>
               <p>TAPP medium with 10mg/l Paromomycine</p>
               <p>
                  
                  <strong>HSA( High Salt Acetate)</strong>
               </p>
               <p><citenumber id="N10FD6" start="83-85"/>
                  <table frame="none" id="N10FD9" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NH<sub>4</sub>Cl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p> 9.3  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.81 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CaCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>K<sub>2</sub>HPO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>6.2  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KH<sub>2</sub>PO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>6.8  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaAc</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>15 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Hunter's trace elements</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1% (v/v)</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>HASS(High Salt Acetate Sorbitol)</p>
               <p>
                  <citenumber id="N110A0" start="86"/>HAS medium with 250mM Sorbitol </p>
            </subsection>
            <subsection id="N110A5" label="5.1.2">
               <head>Growing <em>Chlamydomonas</em>
                  <em>reinhardtii</em> on Agar</head>
               <p>Standard bacteriological petri plates(150×15mm) were used for growing <em>Chlamydomonas</em> transformants. 1.5% agar was added to the media mentioned above. Those plates are placed in 25ºC with 4W/m<sup>2</sup> light.</p>
               <p>For keeping strains, agar slants in test tubes were used. Those agar slants contain 1.5% to 2% agar and TAPTY medium. Screw-capped test tube were used. Stock culture were kept in 18ºC under low light (&lt;1W/m<sup>2</sup>).</p>
               <freehead/>
            </subsection>
            <subsection id="N110C2" label="5.1.3">
               <head>Gametogenesis</head>
               <p>
                  <citenumber id="N110C9" start="87"/>Gametes were generated by resuspending vegetative cells in nitrogen minimal medium (NMM). Vegetative cells were collect by centrifugation at 2,500 rpm× 5min. The pellet was resuspended in NMM and centrifugated at 2,500 rpm× 5min again. Then the cells were resuspended in NMM at a density of ~1×10<sup>7</sup> cells/ml and were placed under continuous light for 48 hours. To prepare pre-gametes, vegetative cells were collected and washed the same way as above. The the pellet was resuspended in NMM at a density of ~1×10<sup>7 </sup>cells/ml and was incubated in darkness continuously for 48 hours. Gametes could also be prepared from pregamete by incubating pregametes under continuous illumination for 2 hours.</p>
               <p>
                  <strong>NMM (Nitrogen minimal medium)</strong>
               </p>
               <p>
                  <table frame="none" id="N110DB" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.81 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CaCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>K<sub>2</sub>HPO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>6.2  mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KH<sub>2</sub>PO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>6.8  mM</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N1115C" label="5.1.4">
               <head>Isolation of Flagella (pH Shock Protocol)</head>
               <p>
                  <citenumber id="N11163" start="89"/>Cells grown in 2-liter culture were harvested by centrifugation (2,500rpm×5min) and resuspended in 100ml 10mM Tris buffer, pH7.8. Then the cells were collected at 2,500rpm for 5 min again and resuspended in 100ml 10mM Tris buffer, pH7.8. The cells were centrifugated again and the pellet was resuspended in 100ml 7% sucrose-10mM Tris buffer, pH7.8, at 4ºC.  All the steps after this were carried out at 4C and it was essential to work quickly. Sedimented cells left in a pellet rapidly lysed, releasing their internal constituents and contaminating the final preparation of flagella.</p>
               <p>The suspension of cells in 7% sucrose-Tris was vigorously stirred with a magnetic stirrer and 910µl 0.5N acetic acid was quickly added to rapidly decrease pH to 4.5. After 90 sec, 90-100% of the cells deflagellated. 1080µl 0.5N KOH was then added to the suspension to raise pH to 7.8.</p>
               <p>For separation of the flagella, 15-ml aliquots were transferred to chilled 50-ml conical polycarbonate centrifuge tubes. 20ml of 25% sucrose-10mM Tris buffer was then placed under the 15ml aliquot of cell suspension. The tubes were centrifuged at 2000g for 11 min. The flagella were left in the 7% sucrose-10mM Tris buffer layer. The 7% sucrose-10mM Tris buffer layer was then collect and merged.</p>
               <p>
                  <citenumber id="N1116F" start="90"/>To remove any remaining cell bodies, 20ml portion of flagella suspensions were underlayered with 4 ml 25% sucrose-10mM Tris buffer as above and centrifuged for 9 min at 1800g. The supernatant was collected and centrifuged at 27,000 g for 20 min. The sedimented flagella were then obtained. </p>
            </subsection>
            <subsection id="N11174" label="5.1.5">
               <head>Flagella fractionation</head>
               <p>To obtain soluble fraction of flagella, ice-cold F buffer(pH7.4)  was used to resuspend flagella pellet. The buffer volume was also around 1.5 times of the initial packed cell volume. F buffer was composed of 30mM HEPES, 5mM MgSO<sub>4</sub>, 1mM dithiothreitol, 0.5mM Na<sub>2</sub>EDTA, 25mM KCl, 0.5% polyethylene glycol (20,000 Da). It was FN buffer without detergent. 1mM phenylmethysulfonyl chloride (PMSF) was added to minimize proteolysis. Repeated freezing in liquid nitrogen and thawing in 37°C incubator were applied to the resuspension. Then the resuspension was centrifuged at 100,000g for 40 min. The supernatant was considered as the soluble fraction of flagella. The pellet was considered as the insoluble fraction of flagella.</p>
            </subsection>
            <subsection id="N11183" label="5.1.6">
               <head>Preparation of Gamete Autolysin</head>
               <p>Wild-type strain <em>CC124mt(-) </em>and <em>CC125mt(+)</em> were pre-grown in 500-ml liquid phototrophic culture for 2 days to a final cell density of ~7×10<sup>6</sup> cells/ml. Cells were then harvested by centrifugation at ~2000rpm for 5 min. The pellet was washed once with NMM and then resuspend in NMM at a density of 2×10<sup>6</sup> cells/ml. The cultures were illuminated with continuous light for 24 hours. Gametes were then harvested and resuspended at a density of ~4×10<sup>7</sup> cells/ml in NMM. The two mating types were mixed and mated for 1 hour. </p>
               <p>
                  <citenumber id="N1119C" start="91"/>After mating, cells were collected by centrifugation at 3000g for 5 minutes. The supernatant fraction was collected and spun at 18,000g for 10min. Then the supernatant was lyophilized and resuspended in a small volume of NMM for use.</p>
            </subsection>
            <subsection id="N111A1" label="5.1.7">
               <head>Transformation of <em>Chlamydomonas</em>
               </head>
               <block id="N111A9" label="5.1.7.1">
                  <head>Transformation of cell-wall-deficient strain (Glass bead method)</head>
                  <p>Cells were grown to mid-log phase (1-2×10<sup>6</sup>cells/ml) in TAPTY medium under continuous bright light (~4W/m<sup>2</sup>). The cells were then harvested by spinning at 2,500g for 5min. The centrifugation should be carried out at room teperature. The cells were resuspended in fresh TAPTY mediumby gentle pipetting to a concentration of 2×10<sup>8</sup>cells/ml. 300µlof the cell suspension was transferred into 2ml eppendorf tube containing 300mg of 0.4mm diameter glass beads. 1µg of linearised DNA containing the construct for transformation and 100µl 20% PEG6000 (sterile) were added. If selection marker was not present in the same plasmid, 1ug of linearised DNA which contained selection marker was added as well. The mixture was mixed by Vortex for 15sec. The cells were then transferred to a 100ml Erlenmeyer flask with 50ml TAPTY medium and grown overnight (~18 hours) under continuous light at 25°C. The next day, the cells were pelleted by centrifugation for 5 min at 2,500 rpm. The pellet was gently resuspended in ~0.5ml TAPTY medium and then plated on TAPTY 1.5% agar with 10 µg/ml zeocin.</p>
               </block>
               <block id="N111BB" label="5.1.7.2">
                  <head>Transformation of wild type cell</head>
                  <p>Autolysin was used in the transformation. Cells were grown to mid-log phase (1-2×10<sup>6</sup>cells/ml) in TAPTY medium under continuous bright light (~4W/m<sup>2</sup>). Then autolysin was added in to the culture and the flask was kept in darkness for 30-45 min. The cells were then harvested by spinning at 2,500g for 5min. The rest steps were same as in 5.1.7.1 . </p>
               </block>
            </subsection>
            <subsection id="N111CB" label="5.1.8">
               <head>Mating Assay</head>
               <p>
                  <citenumber id="N111D2" start="92"/>In this thesis, one metabolic deficient strain <em>CC32pab1mt(+)</em> with promomycin resistance was chosen as one mating partner and one wild type strain <em>CC124mt(-) </em>was chosen as another mating partner. </p>
               <p>Pre-grown culture of both mating types were grown to mid-log phase under middle light condition (~4W/m<sup>2</sup>) in TAPTY medium. Cell density was measured. About 5×10<sup>6 </sup>cells of <em>CC124mt(-)</em> were inoculated in fresh TAP medium. Around 5×10<sup>6 </sup>cells of <em>CC32pab1mt(+)</em> transformants C4 and G5 were inoculated in fresh TAPPab medium. All the cultures were incubated in low light condition (~1W/m<sup>2</sup>) at 25°C for 5-7 days until cell density reached 2-3×10<sup>6 </sup>cells/ml. </p>
               <p>
                  <em color="292526" slant="roman">The cells were then harvested and the cell numbers of different strains were counted. The pellet was washed once with NMM and resuspended in NMM at 1×10</em>
                  <em color="292526" slant="roman">
                     <sup>7 </sup>
                  </em>
                  <em color="292526" slant="roman">cells/ml. The cell suspension was kept in low light condition for 2 days (48 hours) at  25°C.</em>
               </p>
               <p>
                  <citenumber id="N1120B" start="93"/>The cells were harvested again and cell number of different strain was counted. 5×10<sup>6 </sup>cells of C4 and 5×10<sup>6 </sup>cells of CC124mt- was mixed, and  5×10<sup>6 </sup>cells of control strain G5 and 5×10<sup>6 </sup>cells of CC124mt- was mixed. Those mixtures were kept in 2 ml sterile cups. The cells were spun at 1000g for 4 min and the volume was adjusted to 1ml in each mating reaction. The pellet was resuspended by vortex. Those cups were then placed in 25°C baker with light (~8W/m<sup>2</sup>).</p>
               <p>After one hour, the cell mixtures were centrifuged at 1000g for 4 min again and 500µl of NMM was discarded. The pellets were resuspended again and were plated on TAPP agar plates. Those plates were kept in high light condition (~9W/m<sup>2</sup>), middle light condition (~4W/m<sup>2</sup>) or low light condition (&lt;1W/m<sup>2</sup>) at 25°C. Every 7 days, cell number on each plate was checked and compared.</p>
               <freehead/>
            </subsection>
            <subsection id="N1122D" label="5.1.9">
               <head>Fractionation of <em>Chlamydomonas</em> cells</head>
               <p>Cells were grown to a density of 5×10<sup>6</sup> cells/ml and harvested by centrifugation at 2,500 rpm for 5 min. The pellet was then resuspended in ME buffer and sonicated 15times in ice bath. The homogenate was centrifuged at 13,000g for 15min. The pellet was composed of large organelles. The microsomal fraction was pelleted by centrifugation at 120,000g for 40 min. The supernatant after this centrifugation was regarded as cytoplasmic fraction.</p>
               <p>
                  <citenumber id="N1123D" start="94"/>
                  <strong>ME buffer</strong>
               </p>
               <p><table frame="none" id="N11245" orient="port" tocentry="1">
																<tgroup align="left" char="" charoff="50" cols="2">
																<colspec colname="1" colnum="1"/>
																<colspec colname="2" colnum="2"/>
																	<tbody valign="top">
																		<row>
																		<entry morerows="0" rotate="0" valign="top"><p>MOPS</p></entry>
																		<entry morerows="0" rotate="0" valign="top"><p>10mM</p></entry>
																		</row>
																		<row>
																		<entry morerows="0" rotate="0" valign="top"><p>EDTA</p></entry>
																		<entry morerows="0" rotate="0" valign="top"><p>1mM</p></entry>
																		</row>
																		<row>
																		<entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
																		<p>Adjust pH to 6.8</p>
																		</entry>
																		</row>
																	</tbody>
																</tgroup>
					</table>
				</p>
               
            </subsection>
         </section>
         <section id="N11291" label="5.2">
            <head>Methods about handling with Diatom <em>Cylindrotheca fusiformis </em>(buffer recipes included)</head>
            <subsection id="N11299" label="5.2.1">
               <head>Growing <em>C.  fusiformis</em>
               </head>
               <p><citenumber id="N112A2" start="95"/>Diatom cells could be grown in liquid culture in Erlenmeyer flasks. In this thesis, 250ml Erlenmeyer flask with ~100ml culture medium was commonly used for growing diatom. The cells were kept in 18°C room with continuous light illumination (~10W/m<sup>2</sup>).</p>
               <p>Since diatom cells had a strong tendency to stick together and form big clump of cells, cell culture should be shaken vigorously. The cultures were normally shaken at 300rpm. </p>
               <p>
                  <citenumber id="N112AE" start="96"/>ASW medium (Artificial Sea Water medium) was used to grow diatom. The diatom strain could either be kept in liquid culture or agar slant (2%). In either case, culture should be kept in dim light (&lt;1W/m<sup>2</sup>). When strain was kept in liquid, test tube filled with 5-7cm ASW medium was used. The medium should be renewed every four weeks.  For the strains kept on agar slant, the strains should be inoculated onto fresh slant every two months. </p>
               <p>
                  <strong>ASW-Medium</strong>
               </p>
               <p>
                  <table frame="none" id="N112BD" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycylglycine</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>600mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>23.4g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1M CaCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>7.5ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2M MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2M MgCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>3M KCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2 ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.5M KNO<sub>3</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>3 ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>100mM Na<sub>2</sub>SiO<sub>3</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2 ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1000 ×SE solution</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 ml</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1mg/ml Thiamin</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.5ml</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N113BD" start="97"/>
                  <em color="292526" slant="roman">Dissolve in 1 liter H2O and adjust to pH8.0 with 1M NaOH. Autoclave the medium. After cooling down to room temperature, 2ml of 100mM K</em>
                  <em color="292526" slant="roman">
                     <sub>2</sub>
                  </em>
                  <em color="292526" slant="roman">PO</em>
                  <em color="292526" slant="roman">
                     <sub>4</sub>
                  </em>should be added. </p>
               <p>
                  <strong>1000</strong>
                  <strong>
                     <em color="292526" slant="roman">×SE solution</em>
                  </strong>
               </p>
               <p>
                  <table frame="none" id="N113EB" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>H<sub>3</sub>BO<sub>3</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1.14g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Na<sub>2</sub>EDTA 2H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>6.05g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>ZnCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>620mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CuCl<sub>2</sub>   H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>270mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Na<sub>2</sub>MoO<sub>4</sub> · 2H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>250mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CoCl<sub>2</sub> · 6H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>420mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>FeCl<sub>2</sub> · 4H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>970mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MnCl<sub>2</sub> · 4H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>360mg</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Dissolve in 1 Liter H<sub>2</sub>O</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N114EF" label="5.2.2">
               <head>Transformation of diatom cells</head>
               <block id="N114F4" label="5.2.2.1">
                  <head>Adsorption of plasmid-DNA on tungsten particles (M17)</head>
                  <p>
                     <citenumber id="N114FB" start="98"/>Tungsten particles should be washed before use. 10mg Tungsten particles were put in to 500µl ethanol (p.a.) and carefully resuspended. The suspension was then spun for 1 min at 4000rpm. The supernatant was discarded and 250µl ethanol (p.a.) was added. The pellet was then resuspended and the suspension was vortexed for 1-2min. The mixture was centrifuged at 4000rpm for 1 min and the supernatant was discarded. Then, the pellet was washed for three tims with 250µl strile water. Each time, the mixture was resuspended by vortex for 1-2 min. After the last centrifugation, 150µl H<sub>2</sub>O was added to resuspend the pellet. Aliquot in 50µl portion was put in 1.5ml sterile cups.</p>
                  <p>To each 50µl aliquot of tungsten particles, 5µl 1ug/µl plasmid-DNA, 50µl 2.5M CaCl<sub>2 </sub>(Sterile) and 20µl 0.1M Spermidin (free base, sterile) were added under constant vortexing. The mixture was then vortexed for 3 minutes and centrifuged for 10 second. The supernatant was discarded afterward. </p>
                  <p>The pellet was resuspended in 250µl Ethanol (p.a.) by vortexing for 1 min. Again, the suspension was centrifugated for 10 second and the supernatant was removed. The pellet was then resuspended in 50µl ethanol (p.a.). The mixture was incubated on ice until transformation.</p>
               </block>
               <block id="N1150C" label="5.2.2.2">
                  <head>Preparation of diatom cells</head>
                  <p>
                     <citenumber id="N11513" start="99"/>
                     <em>C. fusiformis</em>  cells were grown to mid-log phase (1×10<sup>6</sup>cells/ml) when the culture appeared a light brown. The cell number was counted by using hemocytometer. For each plate,  5×10<sup>7</sup>cells were needed. Those cells were harvested in sterile 50ml Falcon tube by room temperature centrifugation at 2,800g for 10 min. The cells were then resuspended in ~50ml ASW medium for washing. The cells were spun down again at 2800g for 10 min. The pellet was resuspended and for each plate, the volume should be ~250µl. The suspension was plated in the central region (Ø ca. 5cm) of an ASW-plate.</p>
               </block>
               <block id="N11521" label="5.2.2.3">
                  <head>Shooting of cells</head>
                  <p>Before shoot cells, rupture disc and microcarriers should be washed in ethanol (p.a.) and dried in a petri dish in the clean bench. Stopping screen and microcarrier-holder were kept at 200°C for 4 hours before use. All parts of the particle gun were first washed with 70% ethanol. A microcarrier was placed into a microcarrier holder. The DNA-coated tungsten particles were resuspended and 10µl of the suspension was taken out and dropped in the central area of the microcarrier. Then the microcarrier was left in clean bench for ~10 min for drying. </p>
                  <p>The microcarrier holder was placed in the microcarrier Lauch assembly. A Rupture disk was placed in a Rupture disk holder. The ASW-plate with cell suspension was then put on the plae holder and the distance between Rupture disc and the agar plate should be ~7cm.</p>
                  <p>
                     <citenumber id="N1152E" start="100"/>
                     <em color="292526" slant="roman">The particle deliver</em> chamber was evacuated and cells were shot with He as pressure gas. The pressure should be 1350 psi. After shooting, the pressure was returned to atomshperic pressure and the plate was removed. The cells were then kept in culture room (18°C) with continuous light illumination for 24 hours.</p>
               </block>
               <block id="N11538" label="5.2.2.4">
                  <head>Selection of resistant <em>C. fusiformis</em> Cells</head>
                  <p>The ASW plate was washed once with 2ml and once with 1ml fresh ASW medium. The cell number was then counted. Then the cells were resuspended in ASW at a density of 10<sup>7</sup>cells per 250µl ASW medium. </p>
                  <p>250µl of such cell suspension was plated on a ASWZ plate.  Those plates were placed in culture room (18°C) for 7-10 days with continuous illumination (~6W/m<sup>2</sup>). Clones of transformants could be seen afterwards. </p>
               </block>
            </subsection>
         </section>
         <section id="N1154F" label="5.3">
            <head>Methods about handling with <em>Escherichia coli</em>(buffer recipes included)</head>
            <subsection id="N11557" label="5.3.1">
               <head>Growing <em>E. coli</em>
               </head>
               <p>
                  <citenumber id="N11561" start="101"/>
                  <em color="292526" slant="roman">The standard medium for </em>
                  <em color="292526">E. coli </em>
                  <em color="292526" slant="roman">growth was LB. For plasmid preparation, TB was used. In the liquid culture, the cells were grown at 37°C</em> with shaking (250rpm). Transformants for E. coli were screened on LB agar plates with ampicillin (100<em color="292526" slant="roman">µ</em>g/ml), the plates were kept in <em color="292526" slant="roman">37°C</em> baker for clones growing.</p>
               <p>
                  <strong>LB</strong>
               </p>
               <p>
                  <table frame="none" id="N11585" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto Trypton </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto Yeast extract</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Dissolve in 1 Liter <em color="292526" slant="roman">H</em>
                                    <em color="292526" slant="roman">
                                       <sub>2</sub>
                                    </em>
                                    <em color="292526" slant="roman">O and autoclave.</em>
                                 </p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N11600" start="102"/>
                  <strong>TB</strong>
               </p>
               <p>
                  <table frame="none" id="N11609" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Media component</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto Trypton </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>12g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto Yeast extract</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>24g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Re-distilled glycerol</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>4g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Dissolve in 900ml H<sub>2</sub>O and autoclave.</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>Phosphate component</strong>
               </p>
               <p>
                  <citenumber id="N11689" start="103"/>
                  <table frame="none" id="N1168C" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KH<sub>2</sub>PO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2.3g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>K<sub>2</sub>HPO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>12.5g</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>Dissolve in 100ml H<sub>2</sub>O and autoclave. When the media and phosphate solution are cool, combine them to give 1 liter of TB.</p>
            </subsection>
            <subsection id="N116E3" label="5.3.2">
               <head>Making competent cells of <em>E. coli</em>
               </head>
               <p>
                  <em color="292526" slant="roman">A 2-3 mm diameter colony was picked from a freshly streaked SOB agar plate and inoculated in 250ml Erlenmeyer flask containing 50ml SOB medium (The cells were best streaked from a frozen stock). The culture was kept in 37°C baker overnight with continuously shaking (&gt;180rpm)</em>.</p>
               <p>
                  <citenumber id="N116F5" start="104"/>On the next morning, the overnight culture was inoculated in 500ml Erlenmeyer flask containing 200ml SOB medium until the  OD<sub>578</sub> reached around 0.05. The culture was then kept in  37°C baker for around 2-3 hours till OD<sub>578</sub> reached 0.3-0.4.</p>
               <p>
                  <em color="292526" slant="roman">The cells were harvested by centrifugation at 2400 rpm for 7 min </em>(4<em color="292526" slant="roman">°C).  The pellet was resuspended in 15ml Tfb I buffer(kept on ice before use). The incubation times varied for different strains. For DH5</em>
                  <em color="292526" slant="roman">&#945;</em>
                  <em color="292526" slant="roman"> the incubation time should be 10 min while for BL21 the incubation time should be 30 min.  The suspension was spun at 2,000 rpm for 5 min (4°C</em>). The pellet was resuspended with 2ml TfbII buffer (kept on ice before use). </p>
               <p>Aliquot of 110µl of the cell suspension was  put into 500ml PCR tube and frozen quickly in liquid nitrogen. The cells were kept in -80°C freezer and could be used at any time.</p>
               <p>
                  <citenumber id="N1171B" start="105"/>
                  <strong>SOB-Mg</strong>
               </p>
               <p>
                  <table frame="none" id="N11724" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto tryptone</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>20g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Bacto yeast extract</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>BaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 ml of a 1M stock</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2.5ml of a 1M stock</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>Dissolve in 1 liter DDW and autoclave.</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>MgCl</strong>
                  <strong>
                     <sub>2</sub>
                  </strong>
                  <strong>+MgSO</strong>
                  <strong>
                     <sub>4</sub>
                  </strong>
                  <strong> 2M stock</strong>
               </p>
               <p>
                  <citenumber id="N117BA" start="106"/>Combine 203g/l MgCl<sub>2</sub> · 6H<sub>2</sub>O and 247g/l MgSO<sub>4</sub> · 7H<sub>2</sub>O in DDW and sterilize by filtration through a pre-rinsed 0.2um filter unit.</p>
               <p>
                  <table frame="none" id="N117CC" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>SOB medium</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>SOB-Mg medium</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 liter</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgCl<sub>2</sub> + MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 ml of a 2M stock</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>Tfb I</strong>
               </p>
               <p>
                  <citenumber id="N1182C" start="107"/>
                  <table frame="none" id="N1182F" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KAc</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>30mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MnCl<sub>2</sub> · 2H<sub>2</sub>O</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>50mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>100mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycerol</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>15%(v/v)</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>Use HAc to adjust pH to 5.8 and sterilize by filtration through a pre-rinsed 0.2um filter unit. The solution should be kept in 4°C.</p>
               <p>
                  <strong>Tfb II</strong>
               </p>
               <p>
                  <citenumber id="N118AE" start="108"/>
                  <table frame="none" id="N118B1" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MOPS</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>CaCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>75mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>KCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycerol </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>15%(v/v)</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>Use NaOH to adjust pH to 7.0 and sterilize by filtration 987ewqthrough a pre-rinsed 0.2um filter unit. The solution should be kept in 4°C.</p>
            </subsection>
            <subsection id="N11926" label="5.3.3">
               <head>Transformation of <em>E. coli </em>cells</head>
               <p>The tubes prepared from the step above was removed from the freezer and thawed on ice. DNA solution (volume &lt; 10ul) was added. The tube was swirled gently to mix the DNA evenly with the cells.  The tube was then incubated on ice for 10-30 min.</p>
               <p>
                  <citenumber id="N11933" start="109"/>The cells were then treated with heat shock by placing the tube in a 42°C water-bath for 90 sec. The tube was chilled on ice for 1-2 min. 800µl of SOC medium was added in the tube and the tube was incubated at 37°C with moderate agitation for 30-60 min. The suspension was spread on SOB agar plate containing appropriate antibiotics. The plate was incubated at 37°C overnight. Colonies would appear in 12-16 hours.</p>
               <p>
                  <strong>SOC medium</strong>
               </p>
               <p>
                  <table frame="none" id="N1193F" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>SOB-Mg medium</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 litre</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgCl<sub>2</sub> + MgSO<sub>4</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 ml of a 2 M stock</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glucose</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 ml of a 2 M stock</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N1199F" label="5.3.4">
               <head>Storing and retrieving <em>E. coli</em> in frozen at -80°C</head>
               <block id="N119A7" label="5.3.4.1">
                  <head>Preparing frozen stocks of <em>E. coli</em>
                  </head>
                  <p>
                     <citenumber id="N119B1" start="110"/>Some E. coli strain was collected by a flamed tungsten loop from an agar plate, a liquid culture or a previous frozen stock. The cells were spread on an SOB agar plate. The plate was then incubated at 37°C until 2-3mm diameter colonies formed. One colony was picked and inoculated in a test tube containing 5ml SOB medium. The tube was kept in 37°C with agitation till the cells reached the mid-log phase (OD<sub>550</sub>=0.5-0.7).  The  culture was then 1:1 diluted  with a solution composed of  60% SOB medium and 40% glycerol. The mixture was vortexed gently and aliquot of 0.5-1ml cell suspension was put in series of 2 ml cups. The cups was put into liquid nitrogen for fast freezing and then stored in -80°C.</p>
               </block>
               <block id="N119B9" label="5.3.4.2">
                  <head>Retrieving E. coli from -80°C frozen stocks</head>
                  <p>A tube of the frozen stock was removed from the freeze and placed on dry ice. Quickly scrape a clump of frozen stock from the surface of the frozen suspension. The frozen clump of cells was placed on an SOB agar plate and it would thaw immediately. The cells are dispersed to obtain single colony. </p>
                  <p>The plate was incubated at 37°C overnight.</p>
                  <freehead/>
               </block>
            </subsection>
         </section>
         <section id="N119C9" label="5.4">
            <head>Methods about handling with <em>X. laevi</em>s oocyte (buffer recipes included)</head>
            <subsection id="N119D1" label="5.4.1">
               <head>Microinjection of <em>X. laevis</em> oocyte and detection of target protein expression</head>
               <p>
                  <citenumber id="N119DB" start="111"/>mRNA of target protein was prepared by RNA synthesis kit (Ambion). 10 ng of mRNA was injected into one mature oocyte. Those injected oocytes were kept in 18°C with constant agitation. </p>
               <p>Three days later,  the injected oocytes were harvested, each in one 500µl PCR tube. 50µl of HbA buffer was added. The oocytes were broken by pipetting. The tubes were centrifugated at 200g for 1 min and the supernatant was transferred to another clean tube. 2µl of supernatant was used for dot blot. The supernatant of those oocytes which expressed target protein was kept in -20°C for use. </p>
               <p>
                  <strong>HbA buffer</strong>
               </p>
               <p>
                  <citenumber id="N119EA" start="112"/>
                  <table frame="none" id="N119ED" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris HCl (pH7.6)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>20mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>MgCl<sub>2</sub>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaH<sub>2</sub>PO4</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Saccharose</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>80mM</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
         </section>
         <section id="N11A78" label="5.5">
            <head>Methods about handling with DNA <em color="292526" slant="roman">(buffer recipes included)</em>
            </head>
            <subsection id="N11A82" label="5.5.1">
               <head>Isolation of genomic DNA from <em>C. reinhardtii</em>
               </head>
               <p>The Isolation kit was made by Promega and the protocol was changed a little in this thesis. It is described as below:</p>
               <p>The cells were grown to a density of 2 <em color="292526" slant="roman">× </em>10<sup>6</sup> - 1 <em color="292526" slant="roman">× </em>10<sup>7</sup> cells/ml and maximally 2 <em color="292526" slant="roman">× 10</em>
                  <em color="292526" slant="roman">
                     <sup>8</sup>
                  </em>
                  <em color="292526" slant="roman"> cells were used for the extraction. The cells were harvested and washed in 25ml 1×PBS (cold). The pellet was then resuspended in 600µl </em>
                  <em color="292526">Nuclei Lysis Solution</em>
                  <em color="292526" slant="roman"> and transfered to a 2ml tube (At this step, cells could be kept in -80°C for a long time.).</em>
               </p>
               <p>
                  <citenumber id="N11ABD" start="113"/>The suspension <em color="292526" slant="roman">was then incubated at 65°C for 15min and then cooled down to RT. 3µl </em>
                  <em color="292526">RNase-Solution</em>
                  <em color="292526" slant="roman"> (RNase A, 4mg/ml) was added. The tube was kept at 37°C for 15 min. 250µlof Protein Precipitation solution was added and the suspension was vortexed.  The tube was spun at full speed for 3 min in a microcentrifuge afterwards (If supernatant was not clear, it would be transferred to a new tube and spun again.).</em>
               </p>
               <p>
                  <em color="292526" slant="roman">Genomic DNA got preci</em>pitated by 700µl 100 isopropanol. The tube was centrifuged at full speed for 1 min. The pellet was washed with 600µl 70% ethanol. The DNA was dried in the air for 10-15 min and resuspended in 100-200µl of <em>Rehydration solution</em> at 65°C for 15 min.</p>
            </subsection>
            <subsection id="N11ADB" label="5.5.2">
               <head>Isolation plasmid-DNA from <em>E. coli </em>
               </head>
               <p>A single colony picked from LB agar plate was inoculated into a test tube containing 5ml TB medium. The suspension was incubated in 37°C overnight with agitation (~250rpm). The cells were harvested the next day. Nucleospin Plasmid Kit (Macherey Nagel) was used to isolate plasmid DNA. Concentration and purity of DNA were determined by UV spectometer.</p>
            </subsection>
            <subsection id="N11AE7" label="5.5.3">
               <head>Agarose gel electrophoresis of DNA</head>
               <p>
                  <citenumber id="N11AEE" start="114"/>TAE buffer was used routinely for agarose gel electrophoresis in this thesis. Ethidium Bromide (0.5ug/ml in agarose gel) was used to dye DNA. UV-lamp was used to observe DNA band.  DNA samples were mixed with 6×loading buffer before loaded in the gel. Electrophoresis was carried out at constant voltage (5V/cm).</p>
               <p>
                  <strong>TAE buffer (pH8.0)</strong>
               </p>
               <p>
                  <table frame="none" id="N11AFA" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris-acetic acid</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>40mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1mM</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N11B40" start="115"/>
                  <strong>6 × loading buffer</strong>
               </p>
               <p>
                  <table frame="none" id="N11B49" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glyc<em color="292526" slant="roman">erol</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">50%(v/v)</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>7.5mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Xylenxyanol</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.4%(w/v)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Bromophenol </em>Blue</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.4%(w/v)</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N11BC7" label="5.5.4">
               <head>Purification of DNA from agarose gel</head>
               <p>Necleospin Extract Kit (Macherey Nagel) was used to purify DNA fragment from agarose gel after electrophoresis.</p>
            </subsection>
            <subsection id="N11BD0" label="5.5.5">
               <head>Amplification of DNA fragment by Polymerase Chain Reaction(PCR)</head>
               <p>
                  <citenumber id="N11BD7" start="116"/>A standard Polymerase Chain Reaction was carried out in 50µl volume with the ingredient below (Saiki et al., 1988).</p>
               <p>
                  <table frame="none" id="N11BDD" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 × PCR buffer</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5µl</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>10 × dNTP Mixture (2mM)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5µl</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>50pM Forward primer</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1µl</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>50pM Reverse primer</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1µl</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Template-DNA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1µl(10ng)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Taq Polymerase</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1U</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>DDW</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>up to 50µl</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>Because of the high GC content of Chlamy gene, 1M Betain was often added in the PCR reaction.</p>
               <p>
                  <citenumber id="N11C8F" start="117"/>The standard temperature cycle is decribed as below:</p>
               <p>
                  <table frame="none" id="N11C95" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Step <em color="292526" slant="roman">1.    95°C</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">5 min</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Step 2.     94°C</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>30s</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Step 3.  56°C-70°C</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>30s</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Step 4.    72°C</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1min/kb</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>25 cycles between Step 2 and Step 4</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Step 5.    72°C</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5min</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Step 6.     4°C</em>
                                 </p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>PCR reaction could not only be used to amplify target DNA for cloning but to detect the <em>E. coli</em> transformants. Cell clumps picked from colonies on the plate could be directly added in the PCR reaction as templates. PCR could be also used to introduce mutation in target genes.</p>
            </subsection>
            <subsection id="N11D4A" label="5.5.6">
               <head>Digestion of DNA</head>
               <p>
                  <citenumber id="N11D51" start="118"/>Restriction enzymes were mainly purchased from NEB or MBI. Single restriction enzyme digestion or double restriction enzyme digestion were carried out after the direction of the manual.</p>
               <freehead/>
            </subsection>
            <subsection id="N11D58" label="5.5.7">
               <head>Ligation of DNA</head>
               <p>The ratio between vector DNA and target DNA were normally 1:3, which also varied in different cases. The T4 ligase was purchased from NEB and the ligation reaction was carried out according to the instruction.</p>
               <freehead/>
            </subsection>
            <subsection id="N11D63" label="5.5.8">
               <head>
                  <em>in vitro </em>synthesis of mRNA from DNA</head>
               <p>RNA synthes<em color="292526" slant="roman">i</em>s kit (mMESSAGE mMACHINE<sup>®</sup>)was purchased from Ambion and the process was carried out after manual instruction. </p>
               <freehead/>
            </subsection>
         </section>
         <section id="N11D7A" label="5.6">
            <head>Method about handling with Protein (buffer recipes included)</head>
            <subsection id="N11D7F" label="5.6.1">
               <head>Protein amount detection by BC Assay</head>
               <p>
                  <citenumber id="N11D86" start="119"/>The BC Assay (bioinchoninic acid) was a colorimeric assay, which involved the reduction of Cu<sup>2+</sup> to Cu<sup>+</sup> by peptidic bounds of proteins. The bioinchoninic acid chelated Cu<sup>+</sup> with high specificity to form a water soluble purple color complex. Concentration known BSA (Bovine Serum Albumin) solution was used as standard. The kit was purchased from Interchim. The assay procedures were carried out after the manual instructions.</p>
            </subsection>
            <subsection id="N11D94" label="5.6.2">
               <head>SDS-PAGE (SDS-Polyacrylamide Gel Electrophoresis)</head>
               <p>SDS-PAGE was used to separate protein mixtures so that their relative abundances, purities and molecular weights could be determined. Mixed with detergent SDS (Sodium Dodecyl Sulphate) and 2-&#946;-mercatoethanol, protein samples were heated to 95°C for 5 min for denaturation. Samples were driven by constant current of ~25mA for 1 hour.</p>
               <p>
                  <strong>Running Buffer</strong>
               </p>
               <p>
                  <citenumber id="N11DA4" start="120"/>
                  <table frame="none" id="N11DA7" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tri<em color="292526" slant="roman">s</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">3.01g</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycine</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>14.41g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>SDS</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1g</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Dissolve</em> in 1 l water</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>2×Sample buffer</strong>
               </p>
               <p>
                  <table frame="none" id="N11E25" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">65mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>SDS</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>3%(w/v)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycerol</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>30%(v/v)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>&#946;-mercatoethanol</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>5%(w/v)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Bromphenolb</em>lue</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1(w/v)</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N11EB3" label="5.6.3">
               <head>Staining of  SDS-PAG</head>
               <block id="N11EB8" label="5.6.3.1">
                  <head>Commassie Brilliant Blue staining</head>
                  <p>
                     <citenumber id="N11EBF" start="121"/>After el<em color="292526" slant="roman">ectrophoresis, the SDS-PAG was taken out and soaked in staining solution for about 2-3 hours with constant agitation (RT). </em>Then the colored gel was taken out and put into destaining solution with constant agitation. The destaining solution was changed several times till the protein band was clear.</p>
                  <p>
                     <strong>Staining solution</strong>
                  </p>
                  <p>
                     <table frame="none" id="N11ED0" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Coom<em color="292526" slant="roman">assie Brilliant Blue</em>
                                    </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">0.2%</em>
                                    </p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Methanol</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>45%(v/v)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Water</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>45%(v/v)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">Acetic Acid</em>
                                    </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>10%(v/v)</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>
                     <citenumber id="N11F4F" start="122"/>
                     <strong>Destaining solution</strong>
                  </p>
                  <p>
                     <table frame="none" id="N11F58" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Meth<em color="292526" slant="roman">anol</em>
                                    </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">25%(v/v)</em>
                                    </p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Water</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>65%(v/v)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">Acetic A</em>cid</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>10%(v/v)</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <freehead/>
               </block>
               <block id="N11FC3" label="5.6.3.2">
                  <head>Silver staining</head>
                  <p>After electrophoresis, the SDS-PAG was taken out and soaked in  fixing solution (40% ethanol, 10% acetic acid) for 30 mines. Then the gel was put in incubation solution (30% ethanol, 0.2% sodiumthiosulfate, 500mM sodium acetate). Millipore water was used to wash the gel for three times (10 min each time). The gel was soaked in silver solution (0.1% silver nitrate, 0.02% formaldehyde) for 40 min. After shortly washed, the gel was put into developing solution (2.5% sodium carbonate (water free), 0.01% formaldehyde). 50mM EDTA (pH8.0) was used as stop solution when the bands were clear.</p>
               </block>
            </subsection>
            <subsection id="N11FCD" label="5.6.4">
               <head>Western blot</head>
               <p>
                  <citenumber id="N11FD4" start="123"/>To detect specific protein band, western blot was applied in this thesis. After SDS-PAGE, protein in the gel was transfered to a nitrocellulose membrane (Hybond-Amersham) by a semi-dry blotting system (Bio-Rad). The blotting process was carried out according to the manual instruction. After the transfer, the membrane was first blocked with blocking buffer and then incubated with blocking buffer containing the first antibody (4°C overnight or RT 1hour). The membrane was then washed for three times with blocking buffer, each time 10 min with constant agitation). Then blocking buffer with the second antibody was applied to the membrane (4°C overnight or RT 1hour). The membrane was washed for three times with  PBS-Tween solution for two times and once with PBS solution, each time 10 min with constant agitation. After that, the membrane was transferred to detection buffer. BCIP and NTB were added. The membrane was then washed in water to stop the reaction when the bands were clear.</p>
               <p>
                  <strong>Blotting Buffer</strong>
               </p>
               <p>
                  <table frame="none" id="N11FE0" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tr<em color="292526" slant="roman">is</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">48mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Glycine</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>39mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">SDS</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1%</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N1204A" start="124"/>
                  <strong>PBS(Phosphate Buffered Saline)</strong>
               </p>
               <p>
                  <table frame="none" id="N12053" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaC<em color="292526" slant="roman">l</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">150mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Na2HPO4</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>16mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">NaH2PO4</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1.8mM</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>PBS-Tween</strong>
               </p>
               <p>
                  <citenumber id="N120C3" start="125"/>PBS buffer with 0.05% Tween (v/v)</p>
               <p>
                  <strong>Blocking Buffer</strong>
               </p>
               <p>7% Milkpowder in PBS-Tween solution</p>
               <p>
                  <citenumber id="N120D2" start="126"/>
                  <strong>Detection Buffer</strong>
               </p>
               <p>
                  <table frame="none" id="N120DB" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris · <em color="292526" slant="roman">HCl</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">100mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>100mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">MgCl2</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>50mM</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N12144" label="5.6.5">
               <head>In gel tryptic digestion</head>
               <p>After Commassie Brilliant Blue staining or Silver staining, the band of target protein was cut out and sliced into 1mm× 1mm pieces. The pieces was collect in 1.5ml cup and sequentially washed with <em color="292526" slant="roman">50mM</em> NH<sub>4</sub>HCO<sub>3</sub>, 50mM NH<sub>4</sub>HCO<sub>3</sub> and 25%ACN, 25% ACN, 50% ACN. Every wash lasted for half an hour and the supernatant was discarded. The pieces were lyophilized for 1 hour.</p>
               <p>
                  <citenumber id="N1215F" start="127"/>The volume of the pieces was estimated and same volume of trypsinase solution (4µg in 100µl digestion buffer) was added. Then same amount of digestion buffer (50mM-100mM  NH<sub>4</sub>HCO<sub>3</sub>) was added. The tube was kept in 37°C overnight.</p>
               <p>The peptides of the digestion were extracted two times with 100 mM NH<sub>4</sub>HCO<sub>3</sub> and one time with 40%ACN. Each extraction lasted for 1 hour and the extraction solutions volume were same as the volume of the pieces.</p>
               <p>All the extraction fraction was collected and lyophilized afterwards.</p>
               </subsection>
               <subsection id="N12176" label="5.6.6">
				<head>Purification with Ni-NTA column</head>
               <p><citenumber id="N1217C" start="128"/>Cells were harvested at 2,500 rpm for 5min and the pellet was resuspended in Buffer B (100ml cell culture in 1ml Buffer B). The suspension was centrifugated at 10,000g for 30min and the precipitation was discarded. The lysate supernatant was then loaded in the equilibrated column. The column was then washed two times with 3CV (column volume) Buffer C. Target protein was then washed off by adding 3 times  0.5 CV Buffer E.</p>
               <p>
                  <strong>Buffer B</strong>
               </p>
               <p>
                  <citenumber id="N12188" start="129"/>
                  <table frame="none" id="N1218B" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Ure<em color="292526" slant="roman">a</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">8M</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaH2PO4</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1M</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Tris&#8729;</em>Cl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.01M, pH8.0</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>Buffer C</strong>
               </p>
               <p>
                  <table frame="none" id="N121FB" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Ur<em color="292526" slant="roman">ea</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">8M</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaH2PO4</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1M</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Tris&#8729;Cl</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.01M, pH6.3</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N12265" start="130"/>
                  <strong>Buffer E</strong>
               </p>
               <p>
                  <table frame="none" id="N1226E" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Urea</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">8M</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaH2PO4</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.1M</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">Tris&#8729;Cl</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>0.01M, pH4.5</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N122D2" label="5.6.7">
               <head>Purification with Strep-tactin column</head>
               <p>Cells were harvested at 2,500 rpm for 5min and the pellet was resuspended in Buffer W (100ml cell culture in 1ml Buffer W). Cells were then broken by sonication. The suspension was centrifugated at 40,000g for 45 min. The supernatant was then collected and loaded in the equilibrated column. The column was then washed for 5 times with 1 CV (column volume) Buffer W.  Target protein was then washed off by adding 6 times 0.5 CV Buffer E.</p>
               <p>
                  <citenumber id="N122DC" start="131"/>For regeneration of the column, the column was washed three times with 5CV Buffer R. When the column turned red, the column was overlaid with 2 ml Buffer R and kept in 4ºC for storage.</p>
               <p>
                  <strong>Buffer W </strong>(washing buffer): </p>
               <p>
                  <table frame="none" id="N122E8" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tr<em color="292526" slant="roman">is&#8729;Cl</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">100 mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>150 mM</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">EDT</em>A</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 mM  pH 8</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <citenumber id="N12352" start="132"/>
                  <strong>Buffer E </strong>(elution buffer): </p>
               <p>
                  <table frame="none" id="N1235B" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tris&#8729;Cl </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>100 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>150 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>desthiobiotin</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>2.5 mM, pH 8</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
               <p>
                  <strong>Buffer R </strong>(regeneration buffer): </p>
               <p>
                  <citenumber id="N123D1" start="133"/>
                  <table frame="none" id="N123D4" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="2">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Tri<em color="292526" slant="roman">s&#8729;Cl</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">100 mM</em>
                                 </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>NaCl</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>150 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>EDTA</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>1 mM </p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">HABA (hydroxy-azophenyl-benzoic acid)</em>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>
                                    <em color="292526" slant="roman">1 mM</em>, pH 8.0</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
         </section>
         <section id="N12458" label="5.7">
            <head>Materials</head>
            <subsection id="N1245D" label="5.7.1">
               <head>Strains</head>
               <p>
                  <table frame="all" id="N12464" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="3">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <colspec colname="3" colnum="3"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Strain</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Marker/Phenotype</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Source</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>E.coli DH5&#945;</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>supE44,(&#934;80lacZ&#916;M15),</p>
                                 <p>hsdR17(r<sub>K</sub>
                                    <sup>-</sup>,m<sub>K</sub>
                                    <sup>+</sup>). recA1,</p>
                                 <p>endA1,gyrA96,thi-1,relA1,</p>
                                 <p>deoR &#916;(lacZYA-argF)U169</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Promega</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii cw15 arg- A</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>cw15, arg7, mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Rochaix &amp;van Dillevijn, 1982</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC1930</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>arg2 mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC645</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pab2 mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC124</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>wild type, mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC125</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>wild type, mt(+)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC621</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>wild type, mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC620</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>wild type, mt(+)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC477</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>bald 1</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC478</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>bald 2 mt(+)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC479</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>bald 2 mt(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC48</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>arg2, mt(+)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. reinhardtii CC32</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pab1, mt(+)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Duke University, USA</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>C. fusiformis</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p/>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Nils Koeger</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>X. laevis</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p/>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>G. Nagel</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N12676" label="5.7.2">
               <head>Plasmids</head>
               <p>
                  <table frame="all" id="N1267D" orient="port" tocentry="1">
                     <tgroup align="left" char="" charoff="50" cols="3">
                        <colspec colname="1" colnum="1"/>
                        <colspec colname="2" colnum="2"/>
                        <colspec colname="3" colnum="3"/>
                        <tbody valign="top">
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Plasmid</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Marker</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Source</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pBluescript II KS(-)</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>lacZ', amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Stratagene</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pSP109</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>zeo<sup>R</sup>, amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Stevens et al 1995</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pSP124S</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>zeo<sup>R</sup>, amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Purton S</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pArg7.8</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>zeo<sup>R</sup>, arg 7</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Debuchy et al 1989</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pSI103</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>, aph VIII</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Sizova I</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pGen-D-Ble</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>zeo<sup>R</sup>, amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Fischer et al 2001</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pGEM-RE</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p> Schiereis T.(Regensburg)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pPhot1</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p> Schiereis T.(Regensburg)</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pBlue Cf FCPcass</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Nils Koeger</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pUCBM20</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Peter Berthold</p>
                              </entry>
                           </row>
                           <row>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>pXX212</p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>amp<sup>R</sup>
                                 </p>
                              </entry>
                              <entry morerows="0" rotate="0" valign="top">
                                 <p>Markus Heitzer</p>
                              </entry>
                           </row>
                        </tbody>
                     </tgroup>
                  </table>
               </p>
            </subsection>
            <subsection id="N1282E" label="5.7.3">
               <head>Chemicals, Enzymes and Kits</head>
               <block id="N12833" label="5.7.3.1">
                  <head>Chemicals and Kits</head>
                  <p>
                     <citenumber id="N1283A" start="134"/>
                     <table frame="none" id="N1283D" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Agar</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Amresco</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Agarose</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BD-USA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Ampicillin</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>L-Arginin</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Degussa, Merk</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Bacto-Trypton</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Difco</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Bacto-Yeast-extract</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Difco</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BC Assay</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Uptima, Interchim</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BCIP</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Coomassie Brillient Blue</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Serva</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>dNTP  mixture</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>MBI Fermentas</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Ethidium bromide</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Glass beads</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Braun Biotech</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Gel Extraction Kit</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Macherey Nagel</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">mMESSAGE mMACHINE</em>
                                    </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>
                                       <em color="292526" slant="roman">Ambion</em>
                                    </p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NBT</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Ni-NTA Agarose</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Qiagen</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Ni-NTA spin column</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Qiagen</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Nitrocellulose</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Schleicher&amp;Schuell, Amersham</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NP-40</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>PEG 6000</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Serva</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Plasmid Extraction Kit</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Macherey Nagel</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Ponceau S</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TEMED</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BioRad</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Tween20</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Strep-Tactin agarose</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>IBA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Strep-Tactin AP conjugate</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>IBA </p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Zeocin</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Invitrogen</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>All the other chemicals were purchased from Merck Company.</p>
               </block>
               <block id="N12A9C" label="5.7.3.2">
                  <head>Enzymes and Proteins</head>
                  <p>
                     <table frame="none" id="N12AA3" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Anti-BLE antibody</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Cayla(French)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Anti-Phot1 antibody</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>T. Schiereis(Regensburg)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Anti-GFP antibody</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>M. Fuhrmann(Regensburg)</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BSA</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sigma</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>CIP</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Amersham</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>T4 DNA Ligase</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>MBI Fermentas</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Vent Polymerase</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NEB</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" nameend="2" namest="1" rotate="0" valign="top">
                                    <p>All the restriction enzymes were purchased from MBI Fermentas.</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
               </block>
            </subsection>
            <subsection id="N12B60" label="5.7.4">
               <head>Oligonucleotides</head>
               <p>
                  <citenumber id="N12B67" start="135"/>Oligonucleotides were purchased from Metabion.</p>
               <block id="N12B6B" label="5.7.4.1">
                  <head>Primers for making RNAi construct</head>
                  <p>
                     <table frame="all" id="N12B72" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen1</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCAAGCTTGCAGGGGTGCCAGCTCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen2</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGAATTCATGCGCACCGTGAGCTCC</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen3</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGAATTCAGGTGAGTCGACGAGCAAGCCC</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen4</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGGATCCCCTGCAAATGGAAACGGCGAC</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen5</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGGATCCCCTCAACTACACCAAGGCCGG</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puen6</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCTCTGAGCTTGGCCTTGGCCACCTCCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puh1 </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGGTACCGCTGAGGCTTGACATGATTGGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puh2 </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCCTCGAGCATCCTGCAAATGGAAACGG</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puc1 </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGCGAGCTCGCAGGGGTGCCAGCTCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Puc2(Puen6)</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>AGC TCTGAG CTTGGCCTTGGCCACCTCCT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>The preparation of RNAi construct was shown as in Chapter 3.2.</p>
               </block>
               <block id="N12C77" label="5.7.4.2">
                  <head>Primers for oocyte expressions</head>
                  <p>
                     <citenumber id="N12C7E" start="136"/>
                     <table frame="all" id="N12C81" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>OP5XhoI </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGATGGCAGGGGTGCCAGCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>LOV1-Ser5p</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TGCTTGGTCACAAC<u>A</u>GCCGCTTCCTCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>LOV1-Ser3p</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TGGAGGAAGCGGC<u>T</u>GTTGTGACCAAGCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>LOV2 SER 5</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TGGGCCGCAAC<u>A</u>GCCGCTTCCTGCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>LOV2 SER 3</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TGCAGGAAGCGGC<u>T</u>GTTGCGGCCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Phot1-NotI-5</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>ATAGCGGCCGCGCCGCTGGGCGCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Phot1-NotI-3</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>ATAGCGGCCGCCGCCACCGCCGA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Phot1-3 BamHI</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGATCCTCAGTGGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>P5H8BamHISM</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCCACCACCACCACCACCACCACCACATGGCAGGGGTGCCAGCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>P3EcoRI</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGAATTCTCAGTGGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>C57S mutant was introduced by using two pairs of primers (OP5XhoI and LOV1-Ser3p, LOV1-Ser5p and Phot1-NotI-3) and C250S mutant was introduced by using another two pairs of primers (LOV2 SER5 and Phot1-3 <em>Bam</em>HI, Phot1-NotI-5, LOV2 SER3). Phot1(C57S, C250S) was cloned into pXX20 between <em>Xho</em>I and <em>Bam</em>HI. pGEM-RE-Phot1(C57S, C250S) was made by cloning of PCR-generated Phot1(C57S, C250S) into pGEM-RE . PGEM-RE-Phot1 was constructed by cloning of PCR generated Phot1 into pGEM-RE.</p>
               </block>
               <block id="N12D9B" label="5.7.4.3">
                  <head>Primers used for pLY2-phot1</head>
                  <p>
                     <table frame="all" id="N12DA2" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>PsaD XbaI f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGTCTAGACACACACCTGCCCGTCTGCCTGACA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>ble TEV BamHI r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCGCCCTGGAAGTACAGGTTCTCGTCCTGCTCCTCGGCCACGAAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHI Phot1 f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCGCAGGGGTGCCAGCTCCAGCCAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>EcoRI Phot1 12 His r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGAATTCTCA<link id="DDE_LINK3"/>GTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>XhoI PsaD 3UTR f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGTTCTGGCAGCAGCTGGACCGCCTGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>KpnI PsaD 3UTR r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGTACCGCTGCATGTGCACAGTCACGCTGTCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>PsaD NdeI r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGGGCTTGTTGTGAGTAGCAGTGGGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NdeI ble f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGGCCAGGATGGCCAAGCTGACCA</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>
                     <citenumber id="N12E7E" start="137"/>Plasmid pLY2 was generated by cloning of PCR-produced PsaD promoter-Ble fragment between <em>Xba</em>I and <em>Nde</em>I, and PsaD 3' UTR between <em>Xho</em>I and <em>Kpn</em>I into pBluescriptII KS-. Plasmid pLY2-Phot1 was constructed by cloning PCR-generated  Phot1-12His fragment into pLY2 between BamHI and EcoRI sites.</p>
               </block>
               <block id="N12E8F" label="5.7.4.4">
                  <head>Primers for diatom expressions</head>
                  <p>
                     <table frame="all" id="N12E96" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>DiBLEf </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>ATCAAAACAACCAAAATGGCCAAGCTGACCAGCGCCGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>StrepII Phot1r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TTACTTCTCGAACTGGGGGTGGCTCCAGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>Plasmid pDi-A was constructed by cloning of the PCR-generated <em>Ble-Phot1-Strep tag II</em> into pBlue Cf FCPcass. pLY2-Phot1 was used as templete. DiBLEf and StrepII Phot1r were used to amplify Ble-Phot gene. The vector pBlue Cf FCPcass was digested with <em>Eco</em>RV. The PCR product was cloned into the vector by blunt end cloning.</p>
               </block>
               <block id="N12EF9" label="5.7.4.5">
                  <head>Primers for pLY2-A</head>
                  <p>
                     <citenumber id="N12F00" start="138"/>
                     <table frame="all" id="N12F03" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHIS12Phot1_5</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCCACCACCACCACCACCACCACCACCACCACCACCACGCAGGGGTGCCAGCTCCAGCCAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Phot1_3 XhoI</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGTCAGGTCAGTCAGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>Plasmid pLY2-A was prepared from pLY2-phot1 by exchange of the <em>12His-Phot1 </em>fragment for the<em> Phot1-12 His</em> fragment.</p>
               </block>
               <block id="N12F66" label="5.7.4.6">
                  <head>Primers for pLY2-B</head>
                  <p>
                     <table frame="all" id="N12F6D" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NdeIPhot1f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGGCAGGGGTGCCAGCTCCAGCCAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHI TEV BLE f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCGAGAACCTGTACTTCCAGGGCGCCAAGCTGACCAGCGCCGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHI His Phot1 rNS</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>XhoI Ble r </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGTCAGTCCTGCTCCTCGGCCACGAAGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>
                     <citenumber id="N12FF2" start="139"/>Plasmid pLY2-B was constructed from pLY2-phot1 by exchange of the <em>Phot1-12His</em>
                     <em>-TEV-Ble</em> fragment for the <em>Ble-TEV-Phot1-12His </em>fragment.</p>
                  <freehead/>
               </block>
               <block id="N13002" label="5.7.4.7">
                  <head>Primers for pLY2-C</head>
                  <p>
                     <table frame="all" id="N13009" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHI GFP f </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCGCCAAGGGCGAGGAGCTGTTCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>XhoI GFP r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGCTTGTACAGCTCGTCCATGCCGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>EcoRI Phot1f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGAATTCGCAGGGGTGCCAGCTCCAGCCAGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>Plasmid pLY2-C was prepared from pLY2-phot1 by the exchange of the <em>GFP-Phot1</em> fragment for the <em>12His-Phot1 </em>fragment.</p>
               </block>
               <block id="N13081" label="5.7.4.8">
                  <head>Primers for pLY2-D, pLY2-E</head>
                  <p>
                     <citenumber id="N13088" start="140"/>
                     <table frame="all" id="N1308B" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>XhoI HA Phot1f</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCTCGAGATGTACCCCTACGACGTCCCCGACTACGCCGCAGGGGTGCCAGCTCCAGCCAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHI HA Phot1r</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCTCAGGCGTAGTCGGGGACGTCGTAGGGGTAGTAGTTGTCGAACGCCGCGCCGCCGGT</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>Plasmid pLYM-D was constructed from pXX212 by the exchange of the <em>HA-Phot1-12His</em> fragment for the<em> Arg7-luc</em> fragment. Plasmid pLYM-E was constructed from pLY2-Phot1 by the exchange of the <em>12His-Phot1-HA</em> fragment for the<em> Arg7-luc</em> fragment.</p>
               </block>
               <block id="N130F4" label="5.7.4.9">
                  <head>Primers for Chapter 3.4.5.1</head>
                  <p>
                     <table frame="all" id="N130FB" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NdeIStrepIIBLE</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGTGGAGCCACCCCCAGTTCGAGAAGGCCAAGCTGACCAGCGCCGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHIHISLOV2</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCCACCACCACCACCACCACCACCACCACCACCACCACTCGTTCCCGCGTGTGGCGCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>BamHIHISkinase</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGGGATCCCACCACCACCACCACCACCACCACCACCACCACCACACCGCCAACCCCTGGGCGGCCA</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>
                     <citenumber id="N1316B" start="141"/>Plasmid pLY2-SBP was prepared from pLY2-A by the exchange of the <em>Strep-Ble-TEV</em> fragment for the <em>Ble-TEV</em> fragment. Plasmid pLY2-SBL was prepared from pLY2-SBP by exchange the <em>12His-LOV2-kinase</em> fragment for the <em>12His-Phot1</em> fragment. Plasmid pLY2-SBK was prepared from pLY2-SBP by exchange the <em>12His-kinase</em> fragment for the <em>12His-Phot1</em> fragment. </p>
                  <p>Plasmid pLY2-BL was prepared from pLY2-A by the exchange of the 12His-Phot1 fragment for the <em>12His-LOV2-kinase</em> fragment. Plasmid pLY2-BK was prepared from pLY2-A by the exchange of the <em>12His-Phot1 </em>fragment for the <em>12His-kinase</em> fragment. </p>
               </block>
               <block id="N1318E" label="5.7.4.10">
                  <head>Primers for pLY2-OV</head>
                  <p>
                     <table frame="all" id="N13195" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NdeIStrepIIspBLE</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGTGGAGCCACCCCCAGTTCGAGAAGAUCAGCGGCGCCAACGGCGCCATGGCCAAGCTGACCAGCGCCGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>NdeIStrepIISP</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCATATGTGGAGCCACCCCCAGTTCGAGAAGATCAGCGGCGCGAACGGTGCA</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
                  <p>
                     <citenumber id="N131F0" start="142"/>Plasmid pLY2-OV was prepared from pLY2-A by the exchange of <em>Strep-spacer-Ble-TEV</em> fragment for the <em>Ble-TEV</em> fragment. </p>
               </block>
               <block id="N131FB" label="5.7.4.11">
                  <head>Sequencing primers</head>
                  <p>
                     <table frame="all" id="N13202" orient="port" tocentry="1">
                        <tgroup align="left" char="" charoff="50" cols="2">
                           <colspec colname="1" colnum="1"/>
                           <colspec colname="2" colnum="2"/>
                           <tbody valign="top">
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Primers</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>Sequences</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH1</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCAGGGGTGCCAGCTCCAGCCA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH2</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>CGCACGATTGTGGACGACGTGA</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH3</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GGCCTTCTGGAACATGTTCACG</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH4</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGATGAAGACGCTGGACAAGT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH5 </p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>TGCAGCTGGAGAACTACCTGCT</p>
                                 </entry>
                              </row>
                              <row>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>SPH1 reverse</p>
                                 </entry>
                                 <entry morerows="0" rotate="0" valign="top">
                                    <p>GCGCAGGCGGTGGTCGTACTTG</p>
                                 </entry>
                              </row>
                           </tbody>
                        </tgroup>
                     </table>
                  </p>
               </block>
            </subsection>
         </section>
      </chapter></cms:content></cms:document></cms:container>