2. Material

2.1. Geräte und Hilfsmittel

↓22

ABI PRISM® 7000 Sequence Detection System (TaqMan-PCR-Cycler)

Applied Biosystems, Darmstadt

Blotting Box

Biometra, Göttingen

Brutschrank Heracell

Heraeus, Hanau

Elektrophoresekammer

Biometra, Göttingen

Entwicklungsmaschine X-OMAT 5000RA

Kodak, Stuttgart

Feinwaage MC 210 S

Sartorius, Göttingen

GelBond®PAG Film (21.0 x 21.3cm)

Serva, Heidelberg

Geldokumentationssystem BioDocAnalyze

Biometra, Göttingen

Gene Quant II RNA/DNA CalculatorPharmacia

Biotech, Freiburg

Horizontales Elektrophoresesystem Easy-Cast™

AGS, Heidelberg

Hybridisierungsofen

OV 3Biometra, Göttingen

HypercassetteTM

Amersham Biosciences, Freiburg

HyperfilmTM ECL

Amersham Bioscience, Freiburg

Kamera (Lichtmikroskop) Olympus PM-C35DX

Olympus, Hamburg

Konzentrator T 301

Eppendorf, Hamburg

Leuchtkasten

Roth, Karlsruhe

Lichtmikroskop Olympus BX60

Olympus, Hamburg

Magnetrührer MR3001

Heidolph, Kehlheim

Mikrowellenherd (Modell M 706)

Philips, Hamburg

Mikroplattenreader

Perkin Elmer, Weiterstadt

Mikrotom HM 360

Microm International GmbH, Walldorf

Nitrocellulosemembran Hybond ECL

Amersham International, Bucks, UK

PCR-Thermocycler Gene Amp PCR System 2400

Perkin Elmer, Weiterstadt

Perfect WesternTM (Inkubationsbox)

GenHunter, Nashville, TN, USA

pH-Meter GPHR 1400A

Greisinger, Regenstauf

Pipetten und Pipettenspitzen

Eppendorf, Hamburg

Präzisionsküvette aus Quarzglas SUPRASIL®

Hellma, Mühlheim

Rotationsvibratom VT 1000 S

Leica Microsystem, Nussloch

Schüttelinkubator Thermomixer 5436

Eppendorf, Hamburg

Spacer

Diagen, Hilden

Spektralphotometer Ultraspec® III

Pharmacia, Freiburg

Stereotaktisches Gerät

David Kopf Instruments, Tujunga, USA

Stromversorgungsgerät EPS 3500

Pharmacia, Freiburg

Taumel-Wipptisch WT12

Biometra, Göttingen

TGGE-Gelkammer für Polyacrylamidgele

Diagen, Hilden

Thermomixer 5436

Eppendorf, Hamburg

Thermostat KH-3

Biometra, Göttingen

Tischzentrifuge 5415C und 5417 R

Eppendorf, Hamburg

Trans-Blot-SD-System

Bio-Rad Laboratories, München

Trockenschrank B12

Heraeus, Hanau

UV-Transilluminator TI 1

Biometra, Göttingen

Vakuumzentrifuge Concentrator 5301

Eppendorf, Hamburg

Vortexgerät Genie 2

Scientific Industries, Bohemia, USA

Waage BL 1500 S

Sartorius, Göttingen

2.2. Chemikalien

3-Aminopropyltriethoxysilan

Sigma-Aldrich, Steinheim

Aceton

Merck, Darmstadt

Acrylamid

Sigma-Aldrich, Steinheim

Agarose (ultra pure)

Gibco BRL, Eggenstein

Allantoin

Sigma-Aldrich, Steinheim

Ammoniumhydroxid

Fluka, Buchs, Schweiz

Aprotinin

Fluka, Buchs, Schweiz

APS

Serva, Heidelberg

Aqua-Spüllösung

Delta-Pharma, Pfullingen

Azur B

Sigma-Aldrich, Steinheim

β-Mercaptoethanol

Fluka, Buchs/Schweiz

Borsäure

Merck, Darmstadt

Bromphenolblau

Merck, Darmstadt

BSA

Sigma-Aldrich, Steinheim

chirurgisches Instrumentarium

Aesculap, Tuttlingen

Chloralhydrat

Sigma-Aldrich, Steinheim

Chloroform

Merck, Darmstadt

Citronensäure-Monohydrat

Sigma-Aldrich, Steinheim

Coumarin-Säure

Sigma-Aldrich, Steinheim

DAB

Sigma-Aldrich, Steinheim

Desoxynukleosid-Triphosphate (dNTPs)

Promega, Madison, USA

DMSO

Fluka, Buchs, Schweiz

DTT

Sigma-Aldrich, Steinheim

EDTA

Merck, Darmstadt

Essigsäure

Merck, Darmstadt

Ethanol (vergällt und unvergällt)

Merck, Darmstadt

Ether zur Narkose ASID®

ASID Bonz, Böblingen

Ethidiumbromid

Merck, Darmstadt

Formaldehyd (37%ige Lösung)

Riedel-de Haën, Seelze

Formamid

Fluka, Buchs, Schweiz

Glycerin

Merck, Darmstadt

Glycin

ICN Biomedicals, Aurora, USA

Glycogen

Boehringer, Mannheim

Heparin

Sigma-Aldrich, Steinheim

Isopropanol

Merck, Darmstadt

Kaliumchlorid

Roth, Karlruhe

Kaliumferrizyanid

Sigma-Aldrich, Steinheim

Kupfernitrat

Sigma-Aldrich, Steinheim

Leupeptin

Serva, Heidelberg

Luminol

Fluka, Buchs, Schweiz

Magermilchpulver

Roth, Karlsruhe

Magnesiumchlorid

Merck, Darmstadt

Mayers Hämalaun

Merck, Darmstadt

Methylenblau

Sigma-Aldrich, Steinheim

Methylgrün

Sigma-Aldrich, Steinheim

Natriumacetat

Merck, Darmstadt

Natriumcacodylat

Sigma, St. Louis, USA

Natriumcarbonat

Fluka, Buchs, Schweiz

Natriumchlorid

Merck, Darmstadt

Natriumhydroxid

Merck, Darmstadt

Natriumtetraborat

Sigma-Aldrich, Steinheim

Natriumthiosulfat

Sigma-Aldrich, Steinheim

Oligo-d(T)-Primer

Promega, Mannheim

Paraformaldehyd

Merck, Darmstadt

PBS-Lösung

Gibco, Paisley, Schottland

Pepstatin A

Fluka, Buchs, Schweiz

Permount Mounting Medium

EMS, Fort Washington, USA

Ponceau-Rot

Sigma-Aldrich, Steinheim

Pyridin

Sigma-Aldrich, Steinheim

Roti-Phenol/Chloroform-Lösung

Roth, Karlsruhe

Salpetersäure (65%)

Merck, Darmstadt

Salzsäure (37%, rauchend)

Merck, Darmstadt

Sigmacote®

Sigma, St. Louis, USA

SDS

Roth, Karlsruhe

Silan

Sigma-Aldrich, Steinheim

Silbernitrat

Merck, Darmstadt

TEMED

Serva, Heidelberg

Tris

Serva, Heidelberg

Triton X-100

Sigma, St. Louis, USA

Tween 20

Fluka, Buchs, Schweiz

Wasserstoffperoxid

Merck, Darmstadt

Xylencyanol

Merck, Darmstadt

2.3. Häufig verwendete Lösungen

↓23

Bezeichnung

Zusammensetzung

Blotting-Transferpuffer

0,04M Tris, 0306M Glycin
20% (v/v) Ethanol, 0,1% SDS

Boratpuffer (pH 8,5)

20mM Borsäure
50mM Natriumtetraborat

Coumarinsäure Stammlösung

90mM Coumarinsäure (in DMSO)

DNA-Probenpuffer (für Agarosegele)

0,1% (w/v) Bromphenolblau
10mM EDTA (pH 8,0)
60% (v/v) Glycerin
100mM Tris-HCl (pH 8,0)

DNA-Probepuffer (für Polyacrylamidgele)

0,1% (w/v) Bromphenolblau
10mM EDTA (pH 8,0)
60% (v/v) Glycerin
100mM Tris-HCl (pH 8,0)
0,1% (w/v) Xylencyanol

ECL-Lösung 1

2,5mM Luminol,
0,4mM p-Coumarsäure
100mM Tris-HCl (pH 8,5)

ECL-Lösung 2

100mM Tris-HCl (pH 8,5)

1% Essigsäurelösung

5ml 100% Essigsäure
ad 500ml Bidest-H2O

Fixierungslösung II

(4% Paraformaldehydlösung, pH 7,4)

4% (w/v) Paraformaldehyd
0,1% Natriumcacodylat
0,9% (w/v) Natriumchlorid

Heparinlösung

0,17% (v/v) Heparin in 1x PBS

Kupfer-Silber-Lösung
(DeOlmos Kupfersilberfärbung

1,5g Silbernitrat,
3ml 0,5%ige Kupfernitratlösung,
15ml 0,1%ige Allantoinlösung,
9ml Boratpuffer, 17ml Ethanol,
9ml Pyridin

Laemmli-Puffer

2ml 0,625 M Tris/HCl (pH 6,8),
0,2g SDS, 5ml Glycerin
0,5ml β-Mercaptoethanol,
0,1ml Bromphenolblau,
ad 10ml Bidest-H2O

10 x Laufgelpuffer
(für Blotting-Elektrophorese)

72g Glycerin,
15,15g Tris, 5g SDS,
ad 500ml Bidest-H2O

Luminol Stammlösung

250mM Luminol (in DMSO)

Lysepuffer, pH 7,6 (Extraktionspuffer)

50mM Tris, 166mM KCL
5mM EDTA, 1% Triton X-100

Magermilchlösung

2,5g Magermilchpulver ad
50ml TBS-T

Natriumcarbonatlösung 0,3M

59,36g Na2 CO2, 0,968ml Formalin,
ad 2000ml Bidest-H2O

PAGE-Laufpuffer

90ml 10 x TBE-Puffer, 50ml Glycerin,
ad 1000ml Bidest-H2O

PAGE-Lösung

12,6g Glycerin,
18ml 10x TBE-Puffer (pH 8,3),
25ml 40% Acrylamid,
147ml Bidest-H2O

PCR-H2O

Bidest-H2O autoklaviert

Polyacrylamidgel-Elektrophorese-Puffer

5% (v/v) Glycerin, 0,9x TBE

10x Polyacrylamidgel-Elektrophorese-Puffer
(Western Blot)

0,192M Glycin, 0,1% SDS,
25mM Tris-HCl (pH 8,1)

5x Reaktionspuffer
(DNase I-Behandlung und Reverse Transkription)

50mM DTT, 0,375M Kaliumchlorid,
15mM Magnesiumchlorid,
0,25M Tris-HCl (pH 8,3)

Reduktionslösung (DeOlmos Kupfersilberfärbung)

0,007% (w/v) Citronensäure,
10% (v/v) Ethanol,
0,04% (v/v) Formaldehyd

2 % Salpetersäure

15ml 65% Salpetersäure,
ad 500ml Bidest-H2O

4 x Sammmelgelpuffer, pH 6,8

30,3g Tris, 2g SDS,
ad 500ml Bidest-H2O

Silberdiaminlösung (DeOlmos Kupfersilberfärbung)

0,13M Ammoniumhydroxid
0,1% (w/v) Natriumhydroxid
10% (w/v) Silbernitrat

0,2% Silbernitratlösung

0,6g Silbernitrat,
ad 300ml Bidest-H2O

Strippingpuffer

0,1M β-Mercaptoethanol,
0,2% (w/v) SDS,
62,5mM Tris-HCl (pH 6,8)

10 x TAE-Puffer, pH 7,7

10mM EDTA (pH 8,0),
2,3% (v/v) Essigsäure, 0,5M Tris

10 x TBE-Puffer, pH 8,3

1M Borsäure,20mM EDTA, 0,5M Tris

10 x TBS

0,1M Tris-HCl (pH 7,4),
1,5M Natriumchlorid

0,1 % TBS-Tween

100ml 1x TBS,1ml Tween 20,
ad 1000ml Bidest-H2O

4 x Trenngelpuffer

90,8g Tris, 2g SDS,
ad 500ml Bidest-H2O

Wasserstoffperoxid-Methanol-Lösung
(TUNEL-Färbung)

75% (v/v) Methanol,
0,75% (v/v) Wasserstoffperoxid

2.4. Kits

ABC Kit

Vector Laboratories, Peterborough, England

ApopTag® In Situ Apoptosis Detection Kit

Oncor Appligene, Heidelberg

Bicinchoninic Acid Kit

Interchim, Cedex, Frankreich

RNAClean™

AGS, Heidelberg

2.5. Enzyme

AmpliTaq® DNA Polymerase

Perkin Elmer, Weiterstadt

DNase I, RNase-frei

Boehringer, Mannheim

M-MLV-Reverse Transkriptase

Promega, Mannheim

Rnasin® Ribonuclease Inhibitor

Promega, Mannheim

2.6. Antikörper

↓24

Akt (polyklonaler Kaninchen-Antikörper)

Cell Signaling, New England Biolabs GmbH, Frankfurt

p-Akt (polyklonaler Kaninchen-Antikörper)

Cell Signaling, New England Biolabs GmbH, Frankfurt

Caspase-3 Antikörper

Cell Signaling, New England Biolabs GmbH, Frankfurt

p-MAPK (polyklonaler Kaninchen-Antikörper) (p-ERK1/2)

Cell Signaling, New England Biolabs GmbH, Frankfurt

MAPK (monoklonaler Maus-Antikörper) (ERK1/2 )

Cell Signaling, New England Biolabs GmbH, Frankfurt

Fas (monoklonaler Maus-Antikörper)

Transduction Laboratories, Heidelberg

2.7. Oligonukleotide

2.7.1. Oligonukleotide für die reverse Transkription

Bezeichnung

Bezugsquelle

Oligo(dT)15 Primer

Promega, Mannheim

2.7.2. Oligonukleotide für die semiquantitative PCR

Die verwendeten, synthetischen Oligonukleotide wurden vom Biochemisch-Technologischen Zentrum (BioTeZ) in Berlin-Buch bezogen.

↓25

Die Sequenzen der folgenden Oligonukleotide wurden aufgrund von Veröffentlichungen ausgewählt bzw. mittels Software Primerdesign 4.0 selbst entworfen. Die verwendeten Primer erfüllen dabei bestimmte Kriterien:

Name

Sequenz (5‘-3‘)

Genbank Acs.No.

Produkt

Position

Apoptotische Gene

Fas

 

D26112

227bp

 

Sense-Primer

CCGACAACAACTGCTCAGA

  

174-192nt

Antisense-Primer

GCACCTGCACTTGGTATTC

  

412-430nt

Wachstumsfaktoren

BDNF

 

D10938

491bp

 

Sense-Primer

CGACGTCCCTGGCTGACACTTTT

  

2296-2316nt

Antisense-Primer

AGTAAGGGCCCGAACATACGATTGG

  

2762-2786nt

Neurotrophin-3

 

M34643

484bp

 

Sense-Primer

GGTCAGAATTCCAGCCGATGATTGC

  

308-332nt

Antisense-Primer

CAGCGCCAGCCTACGAGTTTGTTGT

  

767-791nt

NGF

 

M36589

491bp

 

Sense-Primer

CTGAACCAATAGCTGCCCGTGTGAC

  

456-480nt

Antisense-Primer

GGCAGCCTGTTTGTCGTCTGTTGTC

  

922-946nt

GDNF

 

L15305

654bp

 

Sense-Primer

CGGGACTCTAAGATGAAGTT

  

38-57nt

Antisense-Primer

CCAGGGTCAGATACATCCAC

  

672-691nt

Zytokine

IL-1

 

NM_031512

335bp

 

Sense-Primer

GACAGAACATAAGCCAACAAG

  

522-542nt

Antisense-Primer

GTCAACTATGTCCCGACCATT

  

836-856nt

IL-10

 

NM_012854

352bp

 

Sense-Primer

CAATAACTGCACCCACTTCC

  

125-144nt

Antisense-Primer

ATTCTTCACCTGCTCCACTGC

  

456-476nt

IL-18

 

NM_019165

398bp

 

Sense-Primer

TGGAGACTTGGAATCAGACC

  

90-109nt

Antisense-Primer

GGCAAGCTAGAAAGTGTCCT

  

468-487nt

Interner Standard (housekeeping gene)

β -Actin

 

V01217

897bp

 

Sense-Primer

CCCTAAGGCCAACCGTGAAAAGATG

  

1663-1687nt

Antisense-Primer

GAACCGCTCATTGCCGATAGTGATG

  

2535-2559nt

2.8. Molekulargewichtsmarker

↓26

PhiX174 DNA/Hae III Marker

Promega, Mannheim

RNA-Molekulargewichtsmarker 0.28–6.58kb

Promega, Mannheim

2.9. Tiere

Als Versuchstiere wurden sieben Tage alte Wistar-Ratten (Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin, BgVV, Berlin) verwendet.

Die Jungtiere befanden sich zu jedem Zeitpunkt bei dem Muttertier, um Stressbedingungen der Versuchstiere zu minimieren und einer Hypothermie vorzubeugen. Die Wurfgröße lag zwischen 10 und 15 Versuchstieren.

2.10. Software und Datenbanken

↓27

Bezeichnung Bezugsquelle bzw. Internetadresse

ABI PRISM® 7000 Sequence Detection System Software

Applied Biosystems, Darmstadt

Adobe® Photoshop® Elements 2.0

Adobe Systems, Unterschleißheim

Assay by Design File Builder 2..0

Applied Biosystems, Darmstadt

BioDocAnalyze

Whatman Biometra, Göttingen

Ensembl Genome Viewer Datenbank

http://www.ensembl.org

GraphPad PRISMTM Version 3.0

GraphPad Software, San Diego, USA

NCBI Datenbank

http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST

Primer Designer 4.0

Scientific&Educational Software, Durham, USA

StarOffice 6.0

Sun Microsystems, Santa Clara, USA

TINA Version 2.09g

Raytest Isotopenmessgeräte, Straubenhardt


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
26.10.2005