Schwarz-Muche, Claudia: Molekulare Charakterisierung der -Thalassämie bei Probanden deutscher Herkunft



22

Kapitel 2. Material und Methoden

2.1. Untersuchungsmaterial

2.1.1. Untersuchungsmaterial

2.1.2. Auswahl der Probanden

Tiefgefrorene DNA-Proben oder EDTA-Blut von 214 Probanden deutscher Herkunft mit einer heterozygoten beta-Thalassämie standen als Ausgangsmaterialien zur Verfügung. Vom Blut aller Patienten war eine Hb-Elektrophorese angefertigt und die Diagnose einer heterozygoten beta-Thalassämie gestellt worden. Alle Blutproben sind durch Mikrozytose und Hypochromie mit einem HbA2 > 3,5 gekennzeichnet. In den Familien der Probanden gibt es keine bekannten Vorfahren aus dem Ausland.

2.1.3. Geräte

Spectrophotometer-Ultraspec III (Pharmacia)

Hybaid Thermal Cycler-Omni Gene (MWG Biotech)

Wasserbad UB 12 (Techne)

Tischzentrifuge (Eppendorf)

UV-Transilluminator (Herolab), Video-Dokumentationssystem (Mitsubishi)

Hybaid-Hybridisierungsofen (MWG Biotech)

Heizblock DB 2 A (Techne)

UV-Stratalinker 2400 (Stratagene)

Geleletrophorese- horizontal, vertikal (MWG Biotech)

Film-Entwicklungsgerät (Kodak)

2.1.4. Chemikalien

Proteinase K:

Boehringer Mannheim

PBS

1,7 mmol/l NaCl; 0,064 mmol/l KCl; 0,375 % Tris; pH 7,4

Äthanol:

J. T. Baker

TE-Puffer:

10 mmol/l Tris pH 8,0; 1 mmol/l EDTA

PCR-Puffer:

100 mmol/l Tris pH 8,3; 500 mmol/l KCl; 30 mmol/l MgCl2 ; 0,01 % Gelatine

MgCl2

Roth

10x TBE:

0,9 mol/l Tris Borat; 0,02 mol/l EDTA

Taq:

Perkin Elmer, Pharmacia

Primer:

Pharmacia

dNTPs:

Pharmacia

Agarose:

SEA KEM Biozym

Marker phiX 174 Hae III

Promega

Ethidiumbromid:

Roth


23

NaCl

Roth

Ladepuffer:

15 % Ficoll; 0,05 % Bromphenolblau

Nylonmembran:

Schleicher/Schüll

DIG-Hyb-Mix:

ad 500 ml: 125 ml 20x SSC; 1,65 ml N-Laurylsarkosin; 0,50 ml 20 % SDS; 5 g Casein

20x SSC:

3 mol/l NaCl; 0,3 mol/l Na-Citrat

20x SSPE:

3 mol/l NaCl; 200 mmol/l NaH2 PO4; 20 mmol/l EDTA

TMACl-Wasch-Mix:

3 mol/l TMACl; 50 mmol/l Tris pH 8,0; 0,2 % SDS

Detektionspuffer 1:

0,1 mol/l Maleinsäure; 0,15 % NaCl

Detektions-Wasch-Puffer:

0,3 % Tween 20 in Detektionspuffer 1

Detektionspuffer 2:

10 % Blockingreagenz oder Casein in Detektionspuffer 1 (1:10)

Detektionspuffer 3:

Blockingreagenz

100 mmol/l Tris-HCl, pH 9,5; 100 mmol/l NaCl; 50 mmol/l MgCl2

Boehringer Mannheim

SDS:

Roth

binding & washing buffer:

2x konzentriert: 10 mmol/l Tris-HCl (pH 7,5); 1 mmol/l EDTA; 2 mmol/l NaCl

rothiphorese Gel 40:

Roth

TEMED:

Serva

Ammoniumpersulfat:

Serva

Harnstoff:

Roth

[alpha-35S]dATP:

Du Pont

Kits:

DIG Oligonucleotide 3´-Labeling Kit (Boehringer Mannheim)

 

Dynabeads M-280 Streptavidin (Dynal)

 

T7 Sequenzing TM Kit (Pharmacia)


24

2.2. Methoden

2.2.1. DNA-Extraktion

Aus EDTA-Blut wurden zunächst Leukozyten präpariert: Die Reinigung der Zellen erfolgte durch Zentrifugation (20 min, 3000 U/min) in PBS und Verwerfen des Überstandes. Anschließend wurden die Erythrozyten lysiert (Aqua bidest.) und von den verbleibenden Zellen getrennt (erneute Zentrifugation 30 min bei 3000 U/min).

Der Aufschluß der Leukozyten erfolgte mit 50 µl Proteinase K (10 mg/ml, 4-16 h im Wasserbad bei 37 °C). Im Anschluß wurden die Proteine durch Zugabe von 3 mol/l NaCl ausgefällt. Die DNA-Fällung erfolgte mit 100 %igem, die DNA-Waschung mit 70 %igem Äthanol. Nach Lösung der DNA in TE-Puffer konnte ihre Menge und Reinheit am Spektrophotometer bestimmt werden [Sambrook et al., 1989].

2.2.2. PCR

2.2.2.1. Prinzip der Methode

Die Polymerasekettenreaktion ermöglicht die Produktion einer enormen Anzahl spezifischer DNA-Sequenzen. Dazu bedient sich die DNA-Polymerase der Einzelstrang-DNA als Matrize zur Synthese eines neuen, komplementären Stranges. Diese Einzelstrang-DNA erzeugt man, indem doppelsträngige DNA nahe dem Siedepunkt erhitzt wird (1. Schritt: Denaturierung). Zusätzlich benötigt die DNA-Polymerase ein kurzes doppelsträngiges DNA-Stück, um mit der Synthese beginnen zu können, den sogenannten Primer. Im zweiten Schritt (Primer-Annealing) hybridisieren die Primer, die die jeweils interessierenden DNA-Abschnitte von beiden Seiten begrenzen, mit jeweils komplementären Basensequenzen. Während des Extensionsschrittes ergänzt die hitzebeständige Taq-Polymerase die fehlenden Stücke komplementär zur Vorlage (Syntheserichtung 5´rarr 3´). Im Ergebnis sind 2 identische DNA-Doppelstränge entstanden, die im 2. Zyklus wieder durch Hitze gespalten werden. Der Prozeß beginnt von Neuem über ca. 30 Zyklen (Saiki et al., 1985).

2.2.2.2. Primerauswahl

Die Primer wurden so gewählt, das der gesamte kodierende Bereich des beta-Globingens, die Region des Promotors, die 5´- und 3´-UTR, das 1. Intron und ein Teil des 2. Introns amplifiziert werden konnten [Lawn et al., 1980]. Diese Sequenz umfaßt erstens die in der Literatur veröffentlichten Mutationen, zweitens werden in diesem Bereich Mutationen vermutet, die noch nicht identifiziert, aber den Phänotyp einer beta-Thalassämie auslösen können. Folgende Primer kamen zur Anwendung:

Primer 1

5´ TATGCTTACCAAGCTGTGATTCCA 3´

-24mer

Primer 2

5´ CCCCTTCCTATGACATGAACTTAA 3´

-24mer

Beide Primer lassen ein Amplifikat entstehen, das aus 863 bp besteht und die Sequenz des gesamten Promotors, der 5´ UTR, des 1. und 2. Exons, des 1. Introns sowie 72 Nukleotide des 2. Introns enthält.


25

Primer 3

5´ ACAATGTATCATGCCTCTTTGCAC 3´

-24mer

Primer 4

5´ TCCCAAGGTTTGAACTAGCTCTTC 3´

-24mer

Dieses Primerpaar läßt ein Amplifikat mit 623 bp entstehen und beinhaltet 259 Nukleotide des 2. Introns, das anschließende Exon 3 und ca. 100 bp über die 3´ UTR hinaus. Die verbleibenden 519 Nukleotide des 2. Introns zwischen Primer 2 und 3 bleiben unberücksichtigt, da in diesem nicht-kodierenden Bereich keine phänotypisch relevanten Mutationen erwartet werden.

2.2.2.3. PCR-Optimierung

Die 100 µl PCR-Reaktionsgemische enthielten selbst gefertigten PCR-Puffer mit 3 mmol/l MgCl2; 0,2 mmol/l je dNTP, 30 pmol je Primer, 2 U Taq Polymerase und 1µg extrahierte DNA des jeweiligen Probanden. Nach Anfertigung der Reaktionsgemische wurden die jeweiligen Proben im Thermal Cycler folgenden Bedingungen unterzogen:

I.

initiale Denaturierung

10´

95°


II.

30 Zyklen mit je

30´´

95°

(Denaturierung)



45´´

60°

(Anlagerung der Primer)



1´15´´

72°

(Extension)

III.

abschließende Extension

10´

72°


Diese Bedingungen garantierten die Amplifikation der spezifischen Sequenzen sowie eine hohe quantitative Ausbeute. Zur Optimierung der PCR-Reaktion mußten eine Reihe kritischer Parameter beachtet werden: Primerlänge und -sequenz, Annealing- und Denaturierungstemperaturen, Zykluszeiten und die Magnesiumkonzentration. Dabei stellt die Titration der Magnesiumkonzentration eine wichtige Optimierungsstrategie dar, da das Vorhandensein freier Magnesium-Ionen essentiell für die Funktionsfähigkeit der Taq-Polymerase ist. Die Konzentration der freien Magnesiumkonzentrationen beeinflußt die Anlagerung des Primers, die Schmelztemperatur des PCR-Produktes sowie die Produktspezifität [Scheinert et al., 1995].

2.2.2.4. Agarosegelelektrophorese

Die Auftrennung der DNA-Fragmente nach ihrer Größe erfolgte in einem 1,5 %igem Agarosegel, welches 0,5 µg/ml Ethidiumbromid enthielt, um die Amplifikate unter UV-Bestrahlung sichtbar zu machen. Dazu wurden 8 µl Amplifikat unter Zusatz von 2 µl Ladepuffer gegen einen Größenmarker (phiX 174 HAE III) aufgetragen, um sicherzustellen, daß die spezifische Sequenz amplifiziert wurde. Zur Dokumentation wurden die Gele in UV-Durchleuchtung fotografiert (s. Abb. 6).

2.2.3. Allel-spezifische Oligonukleotid-Hybridisierung

2.2.3.1. Prinzip der Methode

Wenn kurze Oligonukleotide an komplementäre DNA-Sequenzen binden, dann verhindert eine einzige Fehlpaarung die thermische Stabilität des Doppelstranges im Vergleich zur Stabilität des perfekt gepaarten Doppelstranges. Diesen Umstand kann man sich mit markierten Oligonukleotid-Sonden zur Diagnostik von Punktmutationen nutzbar machen. Diese Sonden werden als Allel-spezifische Oligonukleotide bezeichnet. Dabei


26

bindet eine Wildtyp (Wt)-Sonde nur an eine korrekte, nicht mutierte Sequenz und eine Mutations (M)-Sonde nur an eine mutierte, aber nicht an die Wildtypsequenz [Saiki et al. 1986; Wink & Wehrle, 1994].

Zunächst erfolgt die Amplifikation eines genomischen DNA-Fragmentes durch die PCR, welches anschließend hitzedenaturiert und im einzelsträngigen Zustand auf eine Nylonmembran aufgetropft wird (Dot-Blotting). Mittels UV-Bestrahlung wird die einzelsträngige DNA auf der Membran fixiert und kann nun mit den entsprechenden Oligonukleotid-Sonden hybridisiert werden. Um die Anlagerung der Oligonukleotide sichtbar zu machen, werden sie vorher Digoxigenin (DIG)-markiert. Nach Hybridisierung erfolgt die Waschung der Membranen unter definierten Bedingungen (Temperatur, Salzkonzentration). Dadurch bleiben nur solche Hybride stabil auf der Membran fixiert, die 100 %ig komplementär zueinander sind.

Ein Oligonukleotid mit der Wildtypsequenz gibt ein Signal mit homozygot normalen und heterozygoten DNA-Proben. Dahingegen gibt ein Oligonukleotid mit einer mutierten Sequenz ein Signal mit homozygot mutierten, aber auch mit heterozygoten DNA-Proben. Somit ermöglicht eine parallele Hybridisierung mit Wildtyp- und mutierter Sonde eine eindeutige Bestimmung des Genotyps an dieser Stelle. Durch den gezielten Einsatz von Sonden, die eine Mutation des beta-Globingens tragen, kann ein Screening der Proben auf häufige beta-Thalassämiemutationen mittels ASO erfolgen.

2.2.3.2. Markierung der Oligonukleotide

Die Markierung der Oligonukleotide mit Digoxigenin-ddUTP wurde mit dem DIG Oligonucleotide 3´-End-Labeling Kit von Boehringer durchgeführt.

Für jede beta-Thalassämiemutation wurde je ein mutiertes und je ein Wildtyp-Oligonukleotid am 3´-Ende markiert. Das markierte Oligonukleotid lag dann in einer Konzentration von 1 pmol/µl vor. Um die Effizienz der Markierung zu testen, wurden Verdünnungsreihen (1 µg/µl; 100 pg/µl; 10 pg/µl; 1pg/µl; 0,1 pg/µl; 10 fg/µl) der markierten Oligonukleotide angefertigt und auf die Nylonmembran getropft. Die Detektion erfolgte wie unter 2.2.3.6. beschrieben. Folgende Sonden kamen zum Einsatz:



NS 39 Wt

5´ CCCTTGGACC C AGAGGTTCT 3´

NS 39 M

5´ CCCTTGGACC T AGAGGTTCT 3´



IVS1-1 Wt

5´ TGGGCAG G TTGGTATCAAGG 3´

IVS1-1 M

5´ TGGGCAG A TTGGTATCAAGG 3´



IVS1-6 Wt

5´ TGGGCAGGTTGG T ATCAAGG 3´

IVS1-6 M

5´ TGGGCAGGTTGG C ATCAAGG 3´



IVS1-110 Wt

5´ CTGCCTATT G GTCTATTTTC 3´

IVS1-110 M

5´ CTGCCTATT A GTCTATTTTC 3´



IVS2-1 Wt

5´ AACTTCAGG G TGAGTCTATG 3´

IVS2-1 M

5´ AACTTCAGG A TGAGTCTATG 3´



IVS2-745 Wt

5´ ACAATCCAG C TACCATTCTG 3´

IVS2-745 M

5´ ACAATCCAG G TACCATTCTG 3´



IVS1-5 Wt

5´ TGGGCAGGTTG G TATCAAGG 3´

IVS1-5 M

5´ TGGGCAGGTTG C TATCAAGG 3´

IVS1-5 M

5´ TGGGCAGGTTG T TATCAAGG 3´



FS 8/9 Wt

5´ GAG GAG AAG TCT GCC GTT AC 3´

FS 8/9 M

5´ GAG GAG AAG GTC TGC CGT TA 3´



-87 Wt

5´ TGGAGCCACAC C CTAGGGTT 3´

-87 M

5´ TGGAGCCACAC T CTAGGGTT 3´




27

2.2.3.3. Blotting

Jeder Probanden-DNA wird genau ein Feld auf der Nylonmembran zugeordnet. 2 µl Amplifikat reichen aus, um ein starkes Signal zu erhalten. Für die Hybridisierung werden je ein Mutationsfilter und ein Wildtypfilter benötigt. Neben der Probanden-DNA wurden auf dem Mutations- und Wildtypfilter entsprechende Positiv- und Negativkontrollen getropft. Eine Positivkontrolle für den Mutationsfilter ist ein Patient, der homozygot für die zu untersuchende Mutation ist, die Negativkontrolle kann eine beliebige Wildtyp-DNA sein. Für den Wildtypfilter gelten die Kontrollen im umgekehrten Sinn.

Die Amplifikate wurden 3 min bei 95° denaturiert, auf Eis gestellt und anschließend auf beide Filter aufgetragen. Nach Benetzung der Filter mit 20x SSC konnte die DNA mittels UV-Bestrahlung auf den Filtern fixiert werden.

2.2.3.4. Hybridisierung

Die Filter mit dem fixierten einzelsträngigen Amplifikat wurden im Hybaid Hybridisierungsofen (MWG) kontinuierlich mit 20 ml/100 cm2 DIG-Hyb-Mix umspült. Die Prähybridisierung erfolgte bei 65° für 1-2 h und hat den Vorteil, daß unspezifische DNA auf dem Filter geblockt und ein unsauberer Hintergrund vermieden wird. Im Anschluß wurde der DIG-Hyb-Mix durch 10 ml Hybridisierungslösung ersetzt, die 5 pmol markiertes Oligonukleotid/ml Hyb-Mix enthielt. Über Nacht hybridisierte der Mutationsfilter mit dem mutierten Oligonukleotid, der Wildtypfilter mit dem Wildtyp-Oligonukleotid bei einer empirisch ermittelten Temperatur zwischen 65° und 68° (s. Tab. 6).

2.2.3.5. Waschen der Filter

Nach der Hybridisierung wurden die Filter jeweils 2x 5 min bei Raumtemperatur in 2x SSPE/0,1 SDS, danach 1x 20 min in TMACl-Waschmix unter empirisch ermittelten Temperaturen gewaschen. Die 3. Waschung muß unter äußerst stringenten Bedingungen erfolgen, um nur die stabilen Hybride auf der Membran zu belassen, die den Erhalt eines eindeutigen Signals gewährleisten.

Tab. 6 zeigt die empirisch eruierten Hybridisierungs- und Waschtemperaturen in Abhängigkeit von der Mutation im beta-Globingen.

Tab. 6: Empirisch ermittelte Hybridisierungs- und Waschtemperaturen für ASO-Filter.




Mutation im beta-Globingen

Hybridisierungstemperatur in °C

Waschtemperatur in °C

in °C


M + Wt-Filter

M-Filter

Wt-Filter









NS 39

65

68

68

IVS1-1 G rarr A

65

68

65

IVS1-6 T rarr C

65

68

68

IVS1-110 G rarr A

65

58

62

IVS2-1 G rarr A

65

62

65

IVS2-745 C rarr G

65

62

65

IVS1-5 G rarr C

65

65

65

IVS1-5 G rarr T

65

65

65

FS 8/9 +G

65 (Wt); 68 (M)

65

65

-87 C rarr T

65

62

62






28

2.2.3.6. Detektion

2.2.3.6.1. Prinzip der Detektion

Nukleinsäuremoleküle können durch den Einbau eines Digoxigenin (DIG)-markierten Nukleotids nicht-radioaktiv gekennzeichnet werden. In diesem Fall werden Oligonukleotide an ihrem 3´-Ende unter Nutzung einer terminalen Transferase durch Inkorporation eines DIG-markierten Didesoxyuridin-Triphosphats (DIG-ddUTP) enzymatisch markiert. Die Detektion des DIG-Haptens erfolgt unter Verwendung hochmolekularer Konjugate aus DIG-spezifischen Antikörperfragmenten und Alkalischer Phosphatase (AP) als signalerzeugende enzymatische Komponente. Letztendlich geschieht die Detektion des Indikatormoleküls Alkalische Phosphatase über ein Chemilumineszens-System, welches die Sichtbarmachung der Hybride auf einem konventionellen Röntgenfilm ermöglicht.

Die Detektion erfolgte nach dem Protokoll des 3´-End Labeling Kit von Boehringer Mannheim und gilt für 10 cm x 10 cm Filter:

Während dieser Schritte muß auf eine gleichmäßige Umspülung der Filter geachtet werden. Die Lumineszens-Reaktion erfolgte durch Inkubation der Filter bei 37° über einen Zeitraum von 15 Minuten. Zuletzt wurde ein Film ca. 15-20 min exponiert, anschließend entwickelt und ausgewertet.


29

2.2.4. Sequenzierung

2.2.4.1. Sequenzierung nach der Didesoxymethode

Abb. 3: Sequenzierung nach der Didesoxymethode, modifiziert nach Wink & Wehrle, 1994.

Diese Methode, deren Anwendung sich besonders durch ihre Verbindungsmöglichkeit mit der PCR empfiehlt, wurde 1977 erstmals von Sanger et al. beschrieben. Als Ausgangsmaterialien dienen ein Stück einzelsträngige DNA (Template) und ein kurzer, komplementärer Primer. Dabei liegt der Hybridisierungsbereich des Primers in unmittelbarer Nachbarschaft zu der zu analysierenden Sequenz. In Gegenwart von DNA-Polymerase und Nukleotiden erfolgt nun unter Verlängerung des Primers an dessen 3´-Ende die Synthese des komplementären DNA-Stranges.

Es werden vier parallele Reaktionsgemische angesetzt, die alle 4 Desoxyribonukleotid-Triphosphate (dNTPs) und zusätzlich jeweils eines der 4 Didesoxyribonukleotid-Triphosphate (ddATP, ddCTP, ddGTP, ddTTP) enthalten. Die Besonderheit der ddNTPs liegt darin, daß ihnen nicht nur die 2´-OH-Gruppe, sondern auch die 3´-OH-Gruppe fehlt. Diese 3´-OH-Gruppe ist jedoch essentiell für die Verknüpfung mit den 5´-Phosphatgruppen der neu einzubauenden Nukleotide. Demzufolge führt der Einbau eines ddNTP an dieser Stelle zu einem Abbruch der Elongationsreaktion.

Nach Inkubation der 4 Reaktionsansätze befinden sich jetzt in jedem Ansatz eine Reihe von unterschiedlich langen neusynthetisierten DNA-Molekülen, die alle ein gemeinsames 5´-Ende aufweisen, sich aber an ihrem 3´-Ende unterscheiden. Somit kann über die 4 verschiedenen Reaktionsansätze, die je eines der unterschiedlichen ddNTPs enthalten, die gesamte Sequenz der Matrize bestimmt werden [Wink & Wehrle, 1994].

Zur Analyse der Sequenzprodukte müssen die Reaktionsansätze auf ein denaturierendes Polyacrylamidgel (6 %, 7 mol/l Harnstoff) aufgetragen werden. Um die einzelnen Elongationsprodukte später identifizieren zu können, erhalten sie während der eigentlichen Sequenzreaktion (siehe 2.2.4.3.) eine detektierbare Markierung mit [alpha-35 S]dATP. Nach Exposition gegen einen Röntgenfilm werden die Elongationsprodukte sichtbar, die Nukleotidabfolge kann abgelesen werden (s. Abb. 3).


30

2.2.4.2. PCR mit biotinmarkierten Primern

Abb. 4: PCR mit biotinmarkierten Primern, modifiziert nach Wink & Wehrle, 1994.

Zur Erlangung eines einzelsträngigen Templates, welches anschließend direkt sequenziert werden kann, wird die hohe Affinität zwischen Biotin und Streptavidin genutzt. Bei der initialen PCR-Reaktion werden ein Biotin-markierter und ein unmarkierter Primer eingesetzt. Alle Amplifikationsprodukte erhalten am 5´-Ende von einem der beiden DNA-Stränge ein Biotin-Molekül. Die doppelsträngigen PCR-Produkte werden über diese Biotin-Moleküle an Streptavidin-beschichtete Eisenkügelchen (beads) gebunden und können dadurch an einem Magneten immobilisiert werden. Unter denaturierenden Bedingungen werden anschließend die freien Primer und Nukleotide der initialen PCR und der unmarkierte DNA-Gegenstrang durch Waschschritte abgetrennt, so daß nur noch der zu sequenzierende Einzelstrang übrigbleibt (Abb. 4). Alle Vorgänge der Waschprozedur wurden streng nach Protokoll (Dynabeads M-280 Streptavidin) durchgeführt.

2.2.4.3. Sequenzierung einzelsträngiger DNA mit der T7-Polymerase

Nach der Präparation des Einzelstranges kann dieser unmittelbar in der Sequenzreaktion (Didesoxymethode nach Sanger) zum Einsatz kommen [Thein & Hinton, 1991].

Die verwendeten Lösungen wurden dem T7Sequencing TM Kit von Pharmacia entnommen.

1. Anlagerung des Primers (Annealing)

Zu 10 µl Template (bead suspension) wurde 1µl Primer (3 pmol/µl), 2 µl Annealing buffer und 1 µl Aqua bidest. gegeben und nach kurzer Zentrifugation für 10 min bei 60° im Wasserbad inkubiert (verwendete Primer s. Abb. 5). Anschließend blieb das Gemisch ca. 10 min bei Raumtemperatur stehen.

2. Markierungsreaktion (Labelling)

Zu dem Gemisch aus Template/Primer wurden 3µl Labelling Mix A, 1µl [alpha-35S]dATP (12,5 mCi) und 2µl gelöste T7 DNA-Polymerase zu einem totalen Volumen von 20 µl pipettiert. Nach kurzer Zentrifugation blieb der Ansatz nochmals 5 min bei Raumtemperatur stehen.


31

3. Kettenabbruch (Termination)

Zuletzt wurden jeweils 4,5 µl des unter 2. entstandenen Gemisches zu je 2,5 µl A-, C-, G- und T-Mix gegeben, welche die Nukleotide und das entsprechende Didesoxynukleotid-Triphosphat enthielten. Nach einer 5 minütigen Inkubation bei 37° erfolgte die Zugabe von 5 µl Stoplösung.

Ein Aliquot von jeweils 3 µl der 4 Reaktionsansätze konnte nach Denaturierung bei 80° C auf ein 6 %iges Polyacrylamid-Harnstoff-Gel geladen werden, was die elektrophoretische Trennung der einzelnen Elongationsprodukte der Größe nach ermöglichte. Nach einer Laufzeit von ca. 2,5 h bei 40 Watt wurde das Gel getrocknet und gegen einen Röntgenfilm ca. 24 h exponiert.

Abb. 5: Sequenzierprimer.

Oligonukleotid-Bezeichnung

Sequenz

92 anti-sense

5´ AACGGCAGACTTCTCCTCAG 3´

99 anti-sense

5´ TGGTCTCCTTAAACCTGTCT 3´

101 anti-sense

5´ CTTAGGGTTGCCCATAACAG 3´

115 anti-sense

5´ CCCCTTCCTATGACATGAACTTAA 3´

121 anti-sense

5´ GAGCTGTGGGAGGAAGATAA 3´

122 anti-sense

5´ AATATCCCCCAGTTTAGTAG 3´

119 anti-sense

5´ TCCCAAGGTTTGAACTAGCTCTTC 3´

2.2.5. Restriktionsanalyse

Bei diesem Verfahren wird die amplifizierte DNA mit Hilfe spezifischer Restriktionsendonukleasen in definierte Fragmente gespalten. Jedes Restriktionsenzym schneidet die DNA exakt an einer Stelle, die seiner spezifischen Erkennungssequenz entspricht. Mittels Gelelektrophorese kann anschließend die Länge der Fragmente, im Vergleich gegen einen geeigneten Größenmarker, bestimmt werden [Nicholl, 1995].

Restriktionsanalysen können dem Nachweis von Punktmutationen dienen, wenn die Erkennungssequenz des Enzyms durch den Austausch oder den Verlust einer Base verändert wurde. Ein Beispiel für den Basenaustausch mit Verlust der spezifischen Schnittstelle ist die Sichelzellmutation, bei der die Erkennungssequenz CTNAG für des Enzyms DdeI in CTNTG verwandelt ist. Die Folge ist der Verlust des charakteristischen Restriktionsmusters, weil das Enzym die normale Sequenz der Schnittstelle nicht erkennen kann (s. Abb. 16).

Als Beispiel für den Verlust einer Base fungiert die Mutation im Kodon 6, die das Leseraster für die nachfolgenden Nukleotide verschiebt (FS 6 -A). Die Erkennungssequenz CTNAG für das Enzym DdeI ist durch den Verlust des Adenins nicht mehr vorhanden. Dadurch ist diese Mutation schon sehr einfach anhand des veränderten Restriktionsmusters zu erkennen (s. Abb. 7). Eine Sequenzanalyse beweist die Diagnose, da hiermit der Basenverlust direkt nachgewiesen werden kann. Der Restriktionsverdau stellt eine einfache und schnelle Methode dar, die eine Untersuchung von Familien oder Bevölkerungsgruppen, bei denen die Sichelzellmutation bzw. FS 6 -A häufig anzutreffen sind, zuläßt.


[Titelseite] [Abkürzungsverzeichnis] [1] [2] [3] [4] [5] [Bibliographie] [Danksagung] [Selbständigkeitserklärung] [Lebenslauf] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiDi DTD Version 1.1
a subset from ETD-ML Version 1.1
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin

HTML - Version erstellt am:
Thu Aug 12 12:53:43 1999