[Seite 32↓]

3 Material und Methoden

3.1 Patientenproben und Zellinien

3.1.1 Patienten

Knochenmark-(KM-)Aspirate (n=155) oder peripheres Blut (n=42) von 131 pädiatrischen Patienten mit Erkrankung an einer akuten lymphoblastischen Leukämie (ALL) (7 prä-prä-B, 70 common, 24 prä-B, 2 B, 2 prä-T, 15 T, 11 My+) wurden auf die Expression der mRNA von IL‑4R und IL‑4RαIT untersucht. 49 Patienten hatten eine ALL-Ersterkrankung, 82 ein erstes oder folgendes ALL-Rezidiv. Von 32 der Patienten wurden KM und PB zum Zeitpunkt der Diagnose, von 10 Patienten ausschließlich Blut zum Zeitpunkt der Diagnose, von 30 Patienten KM-Proben zum Zeitpunkt der Diagnose und in Remission nach chemotherapeutischer Behandlung und von 12 Patienten KM ausschließlich in Remission analysiert. Die Patienten mit ALL-Rezidiv wurden an unterschiedlichen Kliniken in Deutschland, Österreich und der Schweiz im Rahmen der ALL-REZ BFM 87-96 Studien therapiert. Das Untersuchungsmaterial für die molekularbiologischen Untersuchungen dieser Patienten wird regelmäßig an die Studienzentrale in Berlin geschickt. Die Patienten mit ALL-Ersterkrankung wurden im Rahmen der ALL-BFM 90-95 Studien an unserer Klinik behandelt.

3.1.2 Zellinien

Die Expression der IL‑4Rα- und IL‑4RαIT-mRNA wurde in den in der folgenden Tabelle dargestellten humanen Zellinien untersucht, die Funktionsstudien von IL‑4RαIT wurden mit der Maus-Zellinie Ba/F3 durchgeführt.

Name

 

Spezies

Firma

Jurkat

akute T-Zell Leukämie

Mensch

Paesel & Lorei GmbH, Hanau

MOLT4

akute T-Zell Leukämie

Mensch

Raji

Burkitt-Lymphom

Mensch

KM-H2

Hodgkin-Lymphom

Mensch

DSMZ (Deutsche Sammlung für Mikroorganismen und Zellkulturen), Braunschweig

697

prä B-Zell Leukämie

Mensch

REH

prä B-Zell Leukämie

Mensch

Ba/F3

pro B-Zell Leukämie

Maus


[Seite 33↓]

3.2  Material

3.2.1 Chemikalien

Actinomycin D, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Acrylamid-/Bisacrylamid-Stammlösungen:

Rotiphorese® NF-Acrylamid/Bis 30% (29:1)

Carl Roth GmbH & Co., Karlsruhe, D.

Rotiphorese® NF-Acrylamid/Bis 40% (19:1)

Agarose:

NuSieve GTG Agarose

Biozym Diagnostics GmbH, Hessisch Oldendorf, D.

SeaKem GTG Agarose

SeaKem LE Agarose

Ammonium Persulfate, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Borsäure, Merck, Darmstadt, D.

Bromphenolblau, Merck, Darmstadt, D

Chloroform, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Concanavalin A, Boehriger Mannheim GmbH, Mannheim, D.

Dithiothreitol (DTT), Ultra pure, GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.

Essigsäure 100%, Merck, Darmstadt, D.

Ethanol 100% unvergällt, Merck, Darmstadt, D.

Ethidiumbromid, reinst, Serva, Feinbiochemika GmbH, Heidelberg, D.

Ethylenediaminetetraacetic-Acid (EDTA), Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Ficoll separating solution, Density 1.077, Seromed® Biochrom KG, Berlin, D.

Formamid, Merck, Darmstadt, D.

Gel-Mix® Running Mate, TBE Buffer, GIBCO BRL, Life Technologis, GmbH, Eggenstein, D.

Harnstoff kristallin, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

MDE, Gel Solution, FMC BioProducts, Rockland, ME, USA.

Natriumhydroxid, Merck, Darmstadt, D.

Natriumthiosulfat, Merck, Darmstadt, D.

Phenol, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Propidiumjodid, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Sephadex® G-50 Fine, DNA Grade, Pharmacia Biotech, Freiburg, D.

Silbernitrat 0,1%, Merck, Darmstadt, D.

TEMED, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Trizma-Base, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Xylencyanol, Merck, Darmstadt, D.


[Seite 34↓]

3.2.2  Puffer und Lösungen

1x TBE, pH 8,0:

90 mM

Tris-Borat

2,5 mM

EDTA

1x TAE, pH 8,0:

40 mM

Tris-Azetat

1 mM

EDTA

1x Gelladepuffer (Agarose-Gelelektrophorese):

20%

Ficoll

10 mM

Tris-Puffer (pH 7,5)

1 mg/ml

Orange G

SSCP-Ladepuffer:

95%

Formamid

10 mM

NaOH

0,1%

Bromphenolblau

0,1%

Xylencyanol

Lösungen für die Silberfärbung:

Fixierlösung:

50 ml

Ethanol

2,5 ml

Essigsäure

Aqua dest. ad 500 ml

Entwicklerlösung:

1,5%

NaOH

0,01%

Natriumthiosulfat

Stoplösung:

10%

Essigsäure

3.2.3 Gele

Sequenzierung

RNase-Protection-Assay


[Seite 35↓]

SSCP-Analyse

Denaturierendes Top-Gel:

2,5 ml Formamid

2,5 ml 2x MDE

0,5 ml 5x TBE

100 µll APS 10%

20 µl TEMED

3.2.4 Medien für die Zell-/Bakterienkultur

PBS-Dulbecco, Seromed® Biochrom KG, Berlin, D.

RPMI 1640 mit L-Glutamin, PAA Laboratories GmbH, Linz, Österreich.

Foetal Calf Serum, PAA Laboratories GmbH, Linz, Österreich.

Penicillin (10.000 U/ml)/Streptomycin (10.000 µg/ml), Seromed® Biochrom KG, Berlin, D.

LB (Luria-Bertani) Medium, pH 7,0:

1%

Trypton, GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.

0,5%

Hefe-Extrakt, GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.

1%

NaCl

50 µg/ml

Ampicillin, Sigma-Aldrich Chemie GmbH, Deisenhofen, D.

Luria Agar (Miller’s LB-Agar), GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.

SOC-Medium:

2%

Trypton (GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.)

0,5%

Hefe-Extrakt (GIBCO BRL, Life Technologies, GmbH, Eggenstein, D.)

0,05%

NaCl

2,5 mM

KCl

10 mM

MgCl2

20 mM

Glukose

3.2.5 Nukleinsäuren/Nukleotide

1Kb-DNA Ladder, GIBCO BRL, Life Technologis, GmbH, Eggenstein, D.

Deoxynucleoside Triphosphate Set, GIBCO BRL, Life Technologis, GmbH, Eggenstein, D.

Fluorescein RNA Labeling Mix, Boehringer-Mannheim, Mannheim, D.

Hexanukleotidgemisch, 10x konz., Boehringer-Mannheim, Mannheim, D.

Oligonukleotid-Primer, TIB MOLBIOL, Berlin, D.


[Seite 36↓]

3.2.6  Klonierung

Original TA-Cloning® Kit, Invitrogen, Groningen, Niederlande.

Eukaryotic TA Cloning® Kit – Unidirectional, Invitrogen, Groningen, Niederlande.

3.2.7 Zytokine

Murine Interleukin-3

 

Murine Interleukin-3

TEBU GmbH, Frankfurt a. M., D.

Human Interleukin-4

 

3.2.8 Nukleinsäureextraktion

RNeasy Total RNA Kit™

QIAGEN GmbH, Hilden, D.

QIAamp Blood Kit™

Gel Extraction Kit™

PCR Purification Kit™

QIAprep Plasmid Mini Kit™

QIAfilter Plasmid Maxi Kit™

S.N.A.P.TM Total RNA Isolation Kit

Invitrogen, Groningen, Niederlande.

3.2.9 Enzyme

3.2.9.1 Restriktionsendonukleasen

BalI

Boehriger Mannheim GmbH, Mannheim, D.

EcoRIBoehriger Mannheim GmbH, Mannheim, D.

SspBI

AccI

PvuI

New England Biolabs GmbH., Schwalbach/Taunus, D.

3.2.9.2 DNA-Polymerasen

AmpliTaq® DNA-Polymerase, Perkin-Elmer, Applied Biosystems GmbH, Weiterstadt, D.

TaKaRa LA Taq DNA-Polymerase, TaKaRa Shuzo Co., LTD, Shiga, Japan.

Expand™ HF PCR System enzyme mix, Boehriger Mannheim GmbH, Mannheim, D.

3.2.9.3 Weitere Enzyme

SuperScript IITM H- Reverse Transkriptase, GIBCO BRL, Life Technologis, GmbH, Eggenstein, D.


[Seite 37↓]

DNase I, RNase-frei, Boehriger Mannheim GmbH, Mannheim, D.

RNase T1, Boehriger Mannheim GmbH, Mannheim, D.

3.2.10 Antikörper

Anti human IL‑4Rα-Antikörper (anti CD124), Klon S456C9, PE-konj., Coulter-Immunotech Diagnostics, Hamburg, D.

Maus-IgG1-PE, B&D, Becton Dickinson, Immunocytometry Systems, San José, CA, USA.

Anti-human IL‑4R polyclonal antibody, R&D Systems GmbH, Wiesbaden, D.

Annexin V/FITC Kit, Bender MedSystems, Wien, Österreich.

3.2.11 Sequenzierung

ThermoSequenaseTM dye terminator cycle sequencing pre-mix kit, Amersham Pharmacia Biotech, Freiburg, D.

3.2.12 RNase-Protection-Assay

RiboQuantTM, RPA-Kit, PharMingen GmbH, Hamburg, D

3.2.13 Zellproliferation

CellTiter 96™ AQueous Non-Radioactive Cell Proliferation Assay, Promega, Madison, USA

3.2.14 Software

ABI PRISM™ DNA Sequencing Analysis Software, PerkinE, Applied Biosystems GmbH, Weiterstadt, D.

GeneScan Analysis-Software Version 1.2.2-1, Perkin-Elmer, Applied Biosystems GmbH, Weiterstadt, D.

WinMDI Version 2.8, Flow Cytometry Application, Joseph Trotter.

CellQuest Version 3.1f, Becton Dickinson, Immunocytometry Systems, San José, CA, USA.

Molecular Analyst® /PC, UV Gel Documentation, Bio-Rad Laboratories, Hercules, Ca, USA.

SPSS for Windows, Release 7.0.

Microsoft® Word 97

Microsoft® Excel 97

3.2.15 Geräte

Brutschränke:
Heraeus Instruments, Berlin, D.


[Seite 38↓]

Durchflußzytometer:
FACScan™ Flowzytometer, B&D, Becton Dickinson, Immunocytometry Systems, San José, CA, USA.

Elektrophoresekammern:
Wide Mini Sub® Cell, Bio-Rad Laboratories GmbH, München, D.

Elektroporator:
Gene Pulser, Bio-Rad Laboratories GmbH, München, D.

Gel-Dokumentationssystem:
Gel Doc 1000TM, Bio-Rad Laboratories GmbH, München, D.

Kamera:
Polaroid CU-5 Nahaufnahme-Kamera, Polaroid, Offenbach/Main, D.

Mikroskope:
Carl Zeiss, Jena, D.

Plattenphotometer:
Dynatech MR5000 Microplate Reader, MTX Lab Systems Inc., Vienna, VA, USA.

Power Supply:
Power Pack P25, Biometra, Göttingen, D.

Schüttelinkubator:
Certomat® R/Certomat® H, B. Braun Biotech International, Melsungen, D.

Sequenzierer:
ABI PrismTM 373 und 377 Automatic Sequencer, Perkin-Elmer, Applied Biosystems GmbH, Weiterstadt, D.

Sterilbank:
LaminAir® HBB 2436, Heraeus Instruments, Berlin, D.

Thermo-Cycler:
DNA-Engine, Peltier Thermal Cycler, Model PTC-200, MJ Research Inc., Watertown, MA, USA.
GeneAmp® PCR System 2400, Perkin-Elmer, Applied Biosystems GmbH, Weiterstadt, D.

Filme:
Land Pack Filme Typ 667 (36 DIN), Polaroid Co., Cambridge, Mass., USA.

UV-Transilluminator:
TFX-20M, Fröbel Labor Technik GmbH, Berlin, D.

Zentrifugen:[Seite 39↓]
Labofuge 400R, Heraeus Instruments, Berlin, D.
Megafuge 1.0, Heraeus Instruments, Berlin, D.

3.3 Statistische Auswertung

Die graphische Darstellung der Werte für sAUC (IL-4RαIT) der Patientengruppen erfolgte in Boxplots. In einem Boxplot sind die Werte einer Gruppe basierend auf der Darstellung von Median, Quartilen und Extremwerten zusammengefaßt. Die Box stellt den interquartilen Bereich dar, der 50% aller Werte enthält, die Linie durch die Box bezeichnet den Median. Die „Antennen“ umfassen den Bereich vom Rand der Box bis zum höchsten bzw. niedrigsten Wert, abgesehen von „Ausreißern“ und „Extremen“. „Ausreißer“ sind als Kreise dargestellt und bezeichnen Werte, deren Abstand vom oberen bzw. unteren Rand der Box 1,5 bis 3 Box-Längen beträgt. „Extreme“ sind mehr als 3 Box-Längen entfernt, und werden als Sternchen dargestellt.

Als statistische Tests wurden der Mann-Whitney-U Test, der Kruskal-Wallis Test und der Wilcoxon-rank Test eingesetzt. Die Berechnungen erfolgten mit der Software SPSS for Windows, Release 7.0. Statistische Auswertungen mit p<0,05 wurde als signifikant gewertet.

3.4 Allgemeine Methoden

3.4.1 Zellkultur

Alle Zellinien wurden in RPMI 1640 mit Glutamin (PAA Laboratories GmbH) unter Zusatz von 10% fetalem Kälberserum (PAA Laboratories GmbH) 100 U/ml Penicillin und 100 µg/ml Streptomycin (Seromed, Biochrom KG) bei 37°C in wassergesättigter Atmosphäre mit 5% CO2 kultiviert.

Das Medium für die Kultivierung der Zellinie Ba/F3 enthielt zusätzlich 5 ng/ml mIL-3 (TEBU).

3.4.2 Isolierung der mononukleären Zellen

Durch Zentrifugation über einen Ficoll-Dichte-Gradienten (Seromed, Biochrom KG, Dichte 1.077 g/ml) wurden die mononukleären Zellen der Knochenmark- und Blut-Proben von Patienten und gesunden Probanden angereichert.

3.4.3 RNA/DNA-Extraktion

Gesamt-RNA und DNA der Proben wurden mit dem RNeasy Total RNA KitTM bzw. dem QIAamp Blood Kit™ (beide von Qiagen) nach den Anweisungen des Herstellers isoliert.


[Seite 40↓]

3.4.4  Polymerase-Ketten-Reaktion (PCR), Reverse Transcription PCR (RT-PCR)

Die Polymerase-Ketten-Reaktion (polymerase chain reaction, PCR) ist eine Technik zur zyklischen Amplifizierung bestimmter DNA-Bereiche. Nach Denaturierung der DNA und damit Trennung der gebildeten Doppelstränge lagert sich bei geeigneten Temperaturen ein Paar spezifischer Oligodes­oxy­nukleotide (Primer), das die nachzuweisenden DNA-Region flankiert, der DNA an (annealing) und initiiert die Synthese des jeweils komplementären DNA-Stranges durch eine thermostabile DNA-Polymerase (Elongation). Weitere Zyklen mit den jeweiligen Schritten Denaturierung, Primer-annealing und Elongation schließen sich an. Da sich idealerweise die synthetisierten DNA-Fragmente mit jedem Zyklus verdoppeln, resultiert eine exponentielle Vermehrung des PCR-Produktes. Nach gelelektrophoretischer Auftrennung stellen sich die PCR-Fragmente als Bande dar. Durch Färbung des Geles mit Ethidiumbromid, einem Farbstoff, der mit DNA interkaliert und bei Licht einer Wellenlänge von 256 nm fluoresziert, können die Banden im UV-Licht sichtbar gemacht werden.

Die Umschreibung von RNA in komplementäre DNA (cDNA) gibt die Möglichkeit, durch Amplifizierung von cDNA-Fragmenten mit der Methode der PCR indirekt auch RNA-Bereiche nachzuweisen.

Die Reaktionsansätze und -bedingungen der in dieser Arbeit durchgeführten PCR’s und RT‑PCR’s sind im speziellen Methodenteil ab Abschnitt 3.5 beschrieben. Die in den unterschiedlichen PCR-Ansätzen verwendeten Primer (TIB MOLBIOL, Berlin) und ihre Sequenzen sind in der Tabelle 1 aufgeführt.


[Seite 41↓]

Tab. 1: Positionen und Sequenzen der verwendeten Primer: Die Zahlen bezeichnen die Position des 5‘-Nukleatids des Primers in der mRNA-Sequenz des IL‑4Rα gemäß der von Idzerda et al. veröffentlicheten Sequenz[122].

Primer, Position

5’

Sequenz

3’

IL‑4R 16 up

GGCGCGCAGATAATTAAAGATT

IL‑4R 125 up

ATCACTTGAGATCAGGAGTTCGA

IL‑4R 617 up

CCCCCTGACAATTACCTGT

IL‑4R 767 down

TGTAGGAAATCCCAGACTTC

IL‑4R 950 up

AAGAAAGAATGGTGGGATCAGAT

IL‑4R 1030 up

ACAGTGGGAGAAGCGGTC

IL‑4R 1074 down

GGGCACTTGGCTGGTTCCT

IL‑4R 1089IT* down

CAATTCTTCCAGTGTCTGAG

IL‑4R 1118 down

CCAGAAAACAGGGCAAGAG

IL‑4R 1242 up

TCAGCGTGGTGCGATGTGT

IL‑4R 1384 down

CACAATGCCCTCCCTTCC

IL‑4R 1619 up

CTGACTTGCACAGAGACGC

IL‑4R 2246 down

TTGGCATGTCCTCTACCTT

IL‑4R 2582 down

AGGGGCAGGATGGAAGGAT

IL‑4R 2792 down

GGGCCAATCACCTTCATACCAT

IL‑4R 3065 down

TCGGCTTCTAGTTCAGTGAGA

GAPDH up[123]

GCAGGGGGGAGCCAAAAGGG

GAPDH down[123]

TGCCAGCCCCAGCGTCAAAG

β-Actin up[124]

CCTTCCTGGGCATGGAGTCCT

β-Actin down[124]

AATCTCATCTTGTTTTCTGCG

IL-15 up

TGTCTTCATTTTGGGCTGTTTCA

IL-15 down

TCCTCCAGTTCCTCACATTCTTTG

IL-7 up

CCCGCAGACCATGTTCCATG

IL-7down

GAGGATGCAGCTAAAGTTCG

IL-7R up

CTCCAGAGATCAATAATAGCTC

IL-7R down

TTGTCGCTCACGGTAAGTTCA

γC up

AAAACTGCAGAATCTGGTGATCCC

γC down

GGTGGGAATTCGGGGCATCGTC

βC up

TGCGCAGAAAGTGGGAGGAGAAGA

βC down

GCCTTCTCTCCACTTCCACG

T7#

TAATACGACTCACTATAGGG

pCR®3.1 Reverse#

TAGAAGGCACAGTCGAGG

*Primer zur spezifischen Amplifikation ausschließlich von IL‑4RαIT, überspannt Exon x.
#Primer zur Sequenzierung von pCR®3.1/IL‑4Rα und pCR®3.1/IL‑4RαIT, im Kit zum Vektor von der Firma Invitrogen mitgeliefert.


[Seite 42↓]

3.4.4.1  cDNA-Synthese

Die Reaktion der reversen Transkription zur Generierung von komplementärer DNA (cDNA) wurde bei 37°C für 45 min und anschließender Hitzeinaktivierung der Reversen Transkriptase bei 94°C für 5 min in folgendem Ansatz durchgeführt:

ca. 1 µg

RNA

4 µl

First Strand Buffer (5x konz.), GIBCO BRL

5 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1 µl

DTT (100 mM), GIBCO BRL

2 µl

Hexanukleotide (50 mM), Boehringer Mannheim

2 µl

SuperScript IITM H- Reverse Transkriptase (200 U/µl), GIBCO BRL

 

H2O ad 20 µl

3.4.4.2 Agarose-Gelelektrophorese

10 µl-Aliquots eines jeden PCR-Produktes wurden nach elektrophoretischer Auftrennung in mit Ethidiumbromid (200 µg/l) gefärbten 0,6-3%igen Agarose-Gelen (NuSieve GTG:SeaKem GTG (2:1) für 3%ige Gele, SeaKem LE für 0,6-2%ige Gele, Biozym Diagnostics GmbH) analysiert.

3.4.5  Aufreinigung von PCR-Produkten

Aufreinigungen von PCR-Produkten wurden mit dem PCR Purification Kit (Qiagen) nach den Anweisungen des Herstellers durchgeführt. Die Amplifikate der aus Agarose-Gelen herausgeschnittenen Banden wurden mit dem Gel Extraction Kit (Qiagen) aufgereinigt.

3.4.6 Sequenzierungen

3.4.6.1 Cycle-Sequencing

Die PCR-Produkte bzw. Plasmide wurden mit dem „ThermoSequenaseTM dye terminator cycle sequencing pre-mix kit“ (Amersham) sequenziert. Die Methode des Cycle Sequencing basiert auf dem Prinzip der PCR, wobei allerdings im Unterschied zur PCR nur ein Primer eingesetzt wird. Durch den Einsatz einer hitzestabilen DNA-Polymerase können durch wiederholte Zyklen von Hitzedenaturierung des Templates, Primer-Anlagerung und Elongation größere Mengen von Produkt erzielt werden als bei Sequenzierungen mit hitzeempfindlichen Polymerasen wie z. B. der T7 Sequenase, die nur einen einzigen Polymerisierungsschritt erlauben.

Der Einbau eines Didesoxynukleotids (ddNTP) in den DNA-Strang verhindert eine weitere Polymerisierung, so daß es an dieser Stelle zum Kettenabbruch kommt. Die vier verschiedenen ddNTPs sind jeweils mit unterschiedlichen Fluoreszenzfarbstoffen markiert. Nach gelelektrophoretischer Auftrennung, die die Fragmente nach ihrer Größe separiert, [Seite 43↓]können die Farben von einem geeigneten Detektor erkannt werden und jedem Fragment kann ein bestimmtes Nukleotid zugeordnet werden. Die Gelelektrophorese, Detektion und Analyse der Sequenzierungen wurden mit dem automatischen Sequenzierer ABI PrismTM 377 (PE, Applied Biosystems, Weiterstadt) durchgeführt.

Cycle-Sequencing-Ansatz

Plasmid-Sequenzierung:

ca. 500 ng

Plasmid

5 pmol

Primer

4 µl

ThermoSequenaseTM dye terminator pre-mix, Amersham

 

H2O ad 10 µl

Direkte Sequenzierung eines PCR-Produktes:

ca. 200 ng

PCR-Produkt

5 pmol

Primer

2 µl

ThermoSequenaseTM dye terminator pre-mix, Amersham

 

H2O ad 10 µl

Reaktionsbedingungen

initiale Denaturierung:

94°C

2 min

 

Annealing:

55°C

15 sec

 

Elongation:

65°C

30 sec

25 Zyklen

Denaturierung:

94°C

15 sec

 

Die Cycle-Sequencing-Reaktionen wurden im Thermocycler GeneAmp® PCR System 2400 (PE, Applied Biosystems) durchgeführt. Durch Zentrifugation über Sephadex-Säulen (Sephadex G50, Pharmacia Biotech ) wurden die Produkte von den überschüssigen Primer- und Nukleotid-Resten abgetrennt und in einer Vakuumzentrifuge getrocknet. Die Pellets wurden in 4 µl Ladepuffer gelöst und nach Denaturierung für 2 min bei 94°C auf Eis gestellt. 2 µl der Probe wurden für die weitere Analyse auf das Gel geladen.

3.4.6.2 Polyacrylamid-Gelelektrophorese

Die Produkte wurden in einem Polyacrylamid-Gel (5% Acrylamid:Bisacrylamid (29:1), 7 M Harnstoff) im ABI PrismTM 377 aufgetrennt und analysiert.

3.4.7 Restriktionsverdaue

Verdaue mit Restriktionsendonukleasen wurden unter den entsprechenden Puffer­bedingungen mit je ca. 1‑2 U Enzym pro µg DNA bei 37°C für 1‑4 Stunden durchgeführt.


[Seite 44↓]

3.4.8  Single Stranded Conformational Polymorphism (SSCP) Analyse

Die SSCP-Analyse beruht auf dem Prinzip, daß einzelsträngige DNA-Fragmente in einem nicht-denaturierenden Milieu entsprechend ihrer Primärstruktur sekundäre Konformationen annehmen, die das Laufverhalten in einem hochauflösenden Polyacrylamid-Gel beein­flussen, so daß mit dieser Methode bei geeigneten Versuchsbedingungen Punkt­mutationen detektiert werden können. Durch eine initiale Hitze-Denaturierung in Formamid werden die Doppelstränge eines PCR-Produktes in Einzelstränge getrennt. Diese bilden dann bei Auftrennung im nicht-denaturierenden Gel entsprechend ihren Laufeigenschaften ein spezifisches Bandenmuster, das mittels einer hochsensitiven Silberfärbung sichtbar gemacht werden kann.

Die Methode der SSCP wurde in der vorliegenden Arbeit angewandt, um die bei der kompetitiven PCR von IL‑4Rα/IL‑4RαIT (siehe Abschnitt 3.5.1 und Abb. 11) auftretende zusätzlichen Bande als Heteroduplexe zu identifizieren (siehe auch Abschnitt 3.5.3 und Abb. 18).

Zur Durchführung der SSCP wurden 5 µl der aus dem Gel extrahierten Amplifikate mit 15 µl SSCP-Ladepuffer gemischt, nach Denaturierung über 10 Minuten sofort auf Eis gestellt und auf ein 0,7x MDE-Gel geladen. Die Elektrophorese erfolgte in 0,5x TBE als Laufpuffer bei einer elektrischen Leistung von 4 Watt während der ersten 15 Minuten, anschließend über einen Zeitraum von 15-18 Stunden bei 2 Watt. Um die Banden nach Abschluß der Elektrophorese durch eine Silberfärbung sichtbar zu machen, wurde das Gel zunächst fixiert, anschließend in 0,1% Silbernitrat 10 Minuten inkubiert, gewaschen und in der Entwicklerlösung geschwenkt bis die Banden sichtbar wurden. Die Entwicklung wurde in 10% Essigsäure gestoppt.

3.4.9 Durchflußzytometrie

Die Durchflußzytometrie ist ein Meßverfahren zur Untersuchung von Partikeln wie z.B. Zellen in wässriger Suspension. Die Zellen werden im Durchflußzytometer in einem Flüssigkeitsstrom wie in einer Perlenkette aufgereiht durch eine Meßkammer geleitet und dort dem Meßpunkt, dem Kreuzungspunkt mit einem Laserstrahl zugeführt. Das an der Zelle entstehende Streulicht wird in verschiedenen Winkeln ausgewertet. Das im Engwinkel gemessene Streulicht (forward scatter) ist ein Maß für die Größe der Zellen, während das seitwärts im rechten Winkel gemessene Streulicht die Zellgranularität bestimmt. Zusätzlich kann die Fluoreszenz der Zellen gemessen werden. Dazu werden die Zellen entweder direkt mit Fluorochromen angefärbt (z.B. Propidiumjodid als Kernfarbstoff) oder sie werden mit Fluoreszenz-markierten Antikörpern beladen. Die verwendeten Fluoreszenzfarbstoffe [Seite 45↓]müssen ihr Absorptions­maximum im Bereich der Wellenlänge des Lasers haben, das Emissionsspektrum hängt von der Art des eingesetzten Farbstoffes ab. Der Einsatz von Farbstoffen mit unterschiedlichem Emissionsspektrum macht die simultane Messung mehrerer Antikörper bzw. die Kombination von Antikörpermarkierung mit der direkten Färbung der Zellen möglich.

Die in dieser Arbeit durchgeführten durchflußzytometrischen Messungen wurden mit dem FacScan der Firma Becton-Dickinson durchgeführt.

3.4.10 Klonierung

3.4.10.1  Unidirektionales TA-Cloning

Das Prinzip des TA-Cloning (Original TA-Cloning®, Eukaryotic TA Cloning® Kit - Unidirectional, Invitrogen) beruht auf der Eigenschaft der Taq-Polymerase, an das 3‘-Ende jedes bei der PCR-Amplifikation entstehenden Stranges ein einzelnes A-Nukleotid anzufügen. Der Vektor ist bereits linearisiert und mit jeweils einem T-Nukleotid-Überhang an seinen 3‘-Enden versehen. Dadurch werden „sticky ends“ passend zu den 3‘A-Überhängen der PCR-Produkte geschaffen und die Selbstligation des Vektors verhindert.

Der TA-Cloning-Vektor pCR3.1™-Uni (Eukaryotic TA Cloning® Kit - Unidirectional, Invitrogen) ist ein eukaryontischen Expressionsvektor, der zusätzlich die gerichtete Klonierung von PCR-Produkten ermöglicht. Für diesen Zweck trägt das eine 5‘-Ende des Vektors keine Phosphatgruppe, was eine Ligation mit einem Ende eines DNA-Stranges, der ebenfalls keine 5‘-Phosphatgruppe trägt, verhindert. Durch vorhergehende Phosphorylierung eines der beiden Primer, die bei der PCR zur Herstellung des Inserts eingesetzt werden, kann das Insert jedoch in der gewünschten Orientierung in den Vektor eingebaut werden (Abb. 7).

Abb. 7: Schematische Darstellung des unidirektionalen TA-Cloning-Vektors für die gerichtete Ligation des PCR-Produktes mit dem Vektor. Da die Ligase ein phosphoryliertes 5‘-Ende für die Ligation benötigt, ist bei Dephosphorylierung eines Armes des Vektors und Phosphorylierung eines der beiden Enden des PCR-Produktes die Ligation nur in einer Richtung möglich.

Die Phosphorylierung eines Primers und die anschließende Ligation der Inserts mit dem Vektor erfolgten nach den Anweisungen des Herstellers der eingesetzten TA-Cloning®-Kits.


[Seite 46↓]

3.4.10.2  Phosphorylierung eines Primers

0,1 nmol

Primer IL‑4R 125 up

1 µl

10x Kinase Puffer

1 µl

ATP (10 mM)

1 µl

T4-Polynukleotid-Kinase (10 U/µl)

 

H2O ad 10 µl

Der Ansatz wurde für 40 min bei 37°C inkubiert. Anschließend wurde die Kinase für 5 min bei 94°C inaktiviert, der Ansatz auf Eis gestellt und sofort in der PCR weiterverwendet.

3.4.10.3  Transformation kompetenter E. coli

Kompetente Zellen des E. coli-Stammes TOP10F‘ (One ShotTM, Invitrogen) wurden mit den fertigen Ligationsansätzen transformiert.

Die Zellen wurden auf Eis aufgetaut und mit 2 µl β-Mercaptoethanol und 1-2 µl des Ligations­ansatzes gemischt. Nach Inkubation für 30 min auf Eis wurden die Zellen für 30 sec einem Hitzeschock bei 42°C ausgesetzt, kurz auf Eis abgekühlt und dann für 60 min in 250 µl SOC-Medium bei 37°C und 225 UpM auf einem Rotations-Schüttler geschüttelt. Anschließend wurden je 50 µl und 250 µl des Ansatzes auf Luria-Agar-Platten mit Ampicillin ausgestrichen und über Nacht bei 37°C inkubiert.

3.4.10.4  Plasmidpräparationen

Für die Plasmid-Minipräparationen wurde je eine Kolonie einer Übernachtplatte gepickt und in 2 ml Ampicillin-LB-Medium für ca. 16 h bei 37°C geschüttelt. Die Isolierung der Plasmide wurde mit dem QIAprep Plasmid Mini Kit (Qiagen) nach den Anweisungen des Herstellers durchgeführt. Die Bakterien werden nach alkalischer Lyse über Säulen mit einer DNA-bindenden Silica-Matrix aufgereinigt.

Plasmidpräparationen mit ausreichender Reinheit und Menge für die nachfolgenden Transfektionen wurden mit dem QIAfilter Plasmid Maxi Kit (Qiagen) nach den Angaben des Herstellers durchgeführt.


[Seite 47↓]

3.5  Identifizierung und Charakterisierung der IL‑4Rα Splice-Variante (IL‑4RαIT)

3.5.1  PCR

Für die Identifizierung und die folgende Sequenzierung der IL‑4RαIT wurde eine PCR mit dem Primerpaar IL‑4R 617 up/IL‑4R 1118 down (Tab. 1) durchgeführt.

Reaktionsansatz

ca. 1 µl

cDNA-Mix

3 µl

PCR-Buffer (10x konz.), PERKIN ELMER

0,1 µl

AmpliTaq® DNA-Polymerase (5 U/µl), PERKIN ELMER

3 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1,5 µl

je Primer IL‑4R 617 up/IL‑4R 1118 down (10 µM), TIB MOLBIOL

 

H2O ad 30 µl

Reaktionsbedingungen

initiale Denaturierung:

94°C

5 min

 

Annealing:

58°C

45 sec

 

Elongation:

72°C

60 sec

30 Zyklen

Denaturierung:

94°C

60 sec

 

abschließende Elongation:

72°C

10 min

 

Bei der Untersuchung der Patientenproben wurden die gleichen Reaktionsbedingungen verwendet. Der Reaktionsansatz enthielt aber zusätzlich 0,15 µl je β-Actin-spezifischem Primer als interne Kontrolle.

3.5.2 Sequenzierung

Nach Agarose-Gelelektrophorese wurden die Banden für den IL‑4Rα und die IL‑4RαIT aus dem Gel herausgeschnitten, die Amplifikate aufgereinigt und nach der in Abschnitt 3.4.5 beschriebene Methode direkt sequenziert.

3.5.3  SSCP

Zur Identifizierung der Heteroduplexe wurden die Banden von IL‑4R und IL‑4RIT und die Heteroduplex-Bande nach elektrophoretischer Auftrennung in einem Agarose-Gel einzeln aus dem Gel herausgeschnitten, aufgereinigt und in einer SSCP-Analyse das Laufverhalten der Einzelstränge ermittelt.


[Seite 48↓]

3.5.4  Quantitative Analyse

Mit Hilfe eines Gel-Dokumentationssystems (Gel Doc 1000TM) und der Molecular Analyst® Software (beide von Bio-Rad Laboratories) konnte die Intensität der Banden dokumentiert und analysiert werden. Für jede Probe wurde ein Profil erstellt, bei dem die Fläche unter der Kurve (AUC) eines jeden Peaks der Intensität der dazugehörigen Bande entspricht ( Abb. 19 ). Die AUC’s der Peaks von IL‑4Rα und IL‑4RαIT wurden bestimmt, und als Maß für die Expression der Splice-Variante im Verhältnis zum IL‑4Rα wurde eine standardisierte AUC für die Splice-Variante (sAUC(IL‑4RαIT)) nach der Formel

sAUC(IL‑4RαIT) = in % berechnet.

3.5.5 Identifizierung der Grenzen des alternativ gespleißten Exons

3.5.5.1 PCR

Zur Identifizierung der Grenzen des alternativ gespleißten Exons wurde eine Intron-überspannende PCR mit DNA aus mononukleären Zellen peripheren Blutes eines gesunden Probanden durchgeführt. Die verwendeten Primerpaare waren IL‑4R 950 up/IL‑4R 1074 down für das Intron upstream des alternativ gespleißten Exons und IL‑4R 1030 up/IL‑4R 1118 down (Tab. 1)für das Intron downstream davon. Es gelang, die gesamten Introns unter den folgenden PCR-Bedingungen zu amplifizieren.

Reaktionsansatz

ca. 0,1 µl

buffy coat DNA

3 µl

LA PCR-Buffer II (Mg2+ plus, 10x konz.), TaKaRa Shuzo Co., LTD.

0,3 µl

TaKaRa LA Taq DNA-Polymerase (5 U/µl), TaKaRa Shuzo Co., LTD.

6 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1 µl

je Primer

IL‑4R 1030 up/IL‑4R 1118 down bzw.

  

IL‑4R 950 up/IL‑4R 1074 down, (10 µM) TIB MOLBIOL

 

H2O ad 30 µl

 

Reaktionsbedingungen

initiale Denaturierung:

94°C

5 min

 

Annealing:

60°C

45 sec

 

Elongation:

72°C

3 min

35 Zyklen

Denaturierung:

94°C

60 sec

 

abschließende Elongation:

72°C

10 min

 

Die Länge der PCR-Produkte betrug ca. 1500 bp für das Intron oberhalb und ca. 1800 bp für das Intron unterhalb des alternativ gespleißten Exons.


[Seite 49↓]

3.5.5.2  Sequenzierung

Die Produkte wurden wie oben beschrieben aufgereinigt und je etwa 400 bp der 5’- und der 3’-Enden der Amplifikate wurden direkt sequenziert.

3.5.6 mRNA-Stabilitäts-Test

Zur Bestimmung der mRNA-Stabilitäten von IL‑4R und IL‑4RIT wurden mononukleäre Zellen peripheren Blutes eines gesunden Probanden in 5 Portionen (Nr. 1-5) zu je 1x107 Zellen geteilt. Aus Portion Nr. 1 wurde sofort RNA gewonnen, Nr. 2 und 3 wurden am zweiten Tag und Nr. 4 und 5 am vierten Tag nach Abnahme aufgearbeitet. Die Zellen aus den Portionen 2-5 wurden bis zur Aufarbeitung in 4 ml RPMI-Medium bei Zimmertemperatur aufbewahrt. Die Portionen 2 und 4 enthielten zusätzlich 10 µg/ml Actinomycin D (Sigma-Aldrich) zur Hemmung der Transkription.

3.5.6.1 Kompetitive RT-PCR

Um das Verhältnis der Expression von IL‑4Rα- zu IL‑4RαIT-mRNA zu bestimmen, wurde eine kompetitive RT-PCR wie im Abschnitt 3.5.1 beschrieben durchgeführt.

3.5.6.2 Semiquantitative RT-PCR

Die Expression der einzelnen Transkripte von IL‑4Rα und IL‑4RαIT wurde mit semiquan­titativen RT-PCRs mit jeweils für die einzelnen Transkripte spezifischen Primern in folgenden Ansätzen durchgeführt.


[Seite 50↓]

Reaktionsansatz für IL‑4R α

ca. 1 µl

cDNA-Mix

3 µl

PCR-Buffer (10x konz.), PERKIN ELMER

0,1 µl

AmpliTaq® DNA-Polymerase (5 U/µl), PERKIN ELMER

3 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1 µl

je Primer IL‑4R 1030 up/IL‑4R 1384 down (10 µM)

 

H2O ad 30 µl

Reaktionsansatz für IL‑4R α IT

ca. 1 µl

cDNA-Mix

3 µl

PCR-Buffer (10x konz.), PERKIN ELMER

0,1 µl

AmpliTaqâ DNA-Polymerase (5 U/µl), PERKIN ELMER

3 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1,5 µl

je Primer IL‑4R 617 up/IL‑4R 1089IT down (10 µM)

 

H2O ad 30 µl

Reaktionsansatz für GAPDH

ca. 1 µl

cDNA-Mix, 1:1 bis 1:100 verdünnt

3 µl

PCR-Buffer (10x konz.), PERKIN ELMER

0,1 µl

AmpliTaqâ DNA-Polymerase (5 U/µl), PERKIN ELMER

3 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1, 5 µl

je Primer GAPDH up/down (10 µM)

 

H2O ad 30 µl

Reaktionsbedingungen für IL‑4R α , IL‑4R α IT und GAPDH

initiale Denaturierung:

94°C

5 min

 

Annealing:

59°C

30 sec

 

Elongation:

72°C

45 sec

30 Zyklen

Denaturierung:

94°C

60 sec

 

abschließende Elongation:

72°C

10 min

 

3.6 Klonierung von IL‑4Rα- und IL‑4RαIT-cDNA

3.6.1 PCR zur Herstellung der Inserts

Die gesamten kodierenden Bereiche des IL‑4Rα und der IL‑4RαIT wurden mit einer sogenannten nested PCR amplifiziert. Hierbei wird ein PCR-Produkt als template in einem weiteren PCR-Ansatz eingesetzt und mit intern (nested) gelegenen Primern amplifiziert. Dadurch werden die Ausbeute erhöht und gleichzeitig im externen PCR-Ansatz entstandene unspezifische Produkte durch den Einsatz der nested gelegenen Primer im internen Ansatz nicht weiter amplifiziert.

Die externe PCR wurde mit dem Primerpaar IL‑4R 16 up/IL‑4R 3065 down (Tab. 1)durchgeführt.


[Seite 51↓]

3.6.1.1  Externe PCR

Reaktionsansatz

ca. 0,1 µg

buffy coat cDNA

3 µl

Expand™ HF Puffer (Mg2+ plus, 10x konz.), Boehriger Mannheim

0,75 µ

Expand™ HF PCR System enzyme mix (3,5 U/µl), Boehriger Mannheim

6 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1 µl

je Primer IL‑4R 16 up/IL‑4R 3065 down (10 µM) TIB MOLBIOL

 

H2O ad 30 µl

Reaktionsbedingungen

initiale Denaturierung:

94°C

2 min

 

Annealing:

58°C

30 sec

 

Elongation:

68°C

3 min

10 Zyklen

Denaturierung:

94°C

30 sec

 
    

Annealing:

58°C

30 sec

 

Elongation:

68°C

3 min+20 sec/Zyklus

20 Zyklen

Denaturierung:

94°C

30 sec

 

abschließende Elongation:

72°C

7 min

 

Für die interne PCR wurde das Produkt der externen PCR 1:104 verdünnt und mit dem Primerpaar IL‑4R 125 up/IL‑4R 2793 down (Tab. 1) amplifiziert. Um eine anschließende gerichtete Klonierung in den Vektor pCR3.1TM-Uni zu ermöglichen, wurde der Sense-Primer IL‑4R 125 up zuvor phosphoryliert (siehe 3.4.10.1.)


[Seite 52↓]

3.6.1.2  Interne PCR

Reaktionsansatz

1 µl

Produkt der externen PCR, 1:104 verdünnt

3 µl

Expand™ HF Puffer (Mg2+ plus, 10x konz.), Boehriger Mannheim

0,5 µ

Expand™ HF PCR System enzyme mix (3,5 U/µl), Boehriger Mannheim

6 µl

dNTP-Mix (je 2 mM), GIBCO BRL

1 µl

je Primer IL‑4R 125 up (phosph.)/IL‑4R 2793 down, (10 µM), TIB MOLBIOL

 

H2O ad 30 µl

Reaktionsbedingungen

initiale Denaturierung:

94°C

2 min

 

Annealing:

64°C

30 sec

 

Elongation:

68°C

3 min

10 Zyklen

Denaturierung:

94°C

30 sec

 
    

Annealing:

64°C

30 sec

 

Elongation:

68°C

3 min+20 sec/Zyklus

20 Zyklen

Denaturierung:

94°C

30 sec

 

abschließende Elongation:

72°C

7 min

 

Die Amplifikationsprodukte der internen PCR wurden in dem eukaryontischen Expressions­vektor pCR3.1™-Uni kloniert.

3.6.2 Ligation

Zur Klonierung wurden die Amplifikationsprodukte der IL‑4Rα- und IL‑4RαIT-cDNA zunächst mit dem Vektor pCR3.1™-Uni ligiert. Gewöhnlich wird in der Ligation ein molares Verhältnis von Vektor zu Insert von 1:1 bis 1:2 empfohlen. Für eine größere Effizienz der Ligation kann laut Hersteller bei langen Inserts der Einsatz einer größeren Menge PCR-Produkt in Relation zum Vektor nötig sein. Da trotz der nested-PCR die Ausbeute an PCR-Produkt relativ gering war, wurden zur Anreicherung die gewünschten Produkte mehrerer Ansätze aufgereinigt und in einem kleineren Volumen H2O aufgenommen. Dieses Produkt wurde nach Zugabe von PCR-Puffer, dNTPs und Taq-Polymerase nochmals für 15 min bei 72°C inkubiert, um einen ausreichenden 3‘-A-Überhang der Produkte und damit eine hohe Ligationseffizienz zu gewährleisten.

2 µl

Vektor (pCR3.1TM-Uni), 30 ng/µl, Invitrogen

x µl

PCR-Produkt (ca. 100 ng)

1 µ

10x Ligationspuffer, Invitrogen

1 µl

T4 DNA-Ligase (4 U/µl), Invitrogen

 

H2O ad 10 µl

Die Ligation fand bei 14°C über Nacht statt.


[Seite 53↓]

3.6.3  Transformation kompetenter E. coli-Stämme

Kompetente E. coli-Bakterien wurden wie im Abschnitt 3.4.10.3 beschrieben mit den Ligations­ansätzen transformiert. Die Kolonien der Übernachtplatten wurden in je 2 ml LB‑Ampicillin-Medium für ca. 16 h weiter kultiviert. Je 1 µl dieser Zellsuspensionen wurde mit 100 µl H2O verdünnt und 1 µl davon als template in eine PCR eingesetzt, um zu kontrollieren, ob ein Insert und ob die IL‑4Rα- oder IL‑4RαIT‑cDNA in die Klone integriert wurde. Die PCR wurde mit dem Primerpaar IL‑4R 617 up/IL‑4R 1118 down (Tab. 1) unter den im Abschnitt 3.5.1 beschriebenen Konditionen durchgeführt. Aus den Kulturen, deren Klone das gewünschte Insert integriert hatten, wurden die Plasmide wie in Abschnitt 3.4.10.4 beschrieben extrahiert.

3.6.4 Sequenzierung

Zur Kontrolle der korrekten Sequenz wurden die Inserts der Vektoren nach der im Abschnitt 3.4.5 beschriebenen Methode mit den in der Tabelle 1 aufgelisteten IL‑4Rα-Primern sequenziert.

3.6.5  Herstellung von pCR3.1/IL‑4Rα mit korrektem Insert

Da trotz Einsatzes einer DNA-Polymerase mit proofreading-Aktivität kein Klon von pCR3.1/IL‑4Rα mit fehlerfreiem Insert erhalten werden konnte, wurden die korrekten Bereiche zweier Vektoren mit Fehlern an jeweils unterschiedlichen Positionen des Inserts miteinander ligiert: Der Klon Nr. 24 hatte Fehler in seiner Basensequenz an den Positionen 487 und 887, der Klon Nr. 17 an Position 2001. Die Restriktionsendonuklease SspBI schneidet im Insert an Position 1785, AccI an Position 2185. Beide Enzyme schneiden an keinen weiteren Stellen im Vektor. Durch Verdau beider Klone mit beiden Restriktionsenzymen konnte der Bereich im Klon 17, der den Fehler an Position 2001 enthielt, herausgeschnitten und durch Ligation mit dem homologen, fehlerlosen Abschnitt aus Klon 24 ausgetauscht werden.

Die Produkte des Restriktionsverdaus wurden auf einem 1%igen Agarose-Gel elektrophoretisch aufgetrennt. Das kurze Fragment (=400 bp) aus Klon Nr. 24 und das lange Fragment (≈7270 bp) aus Klon Nr. 17 wurden aus dem Gel herausgeschnitten, mit dem QiAquick Gel Extraction Kit (Qiagen) aufgereinigt und religiert. Die erneute Sequenzierung dieses Vektors zeigte dann eine korrekte Basensequenz, so daß er in die folgenden Versuche eingesetzt wurde.


[Seite 54↓]

3.6.6  Plasmidpräparationen (Maxipreps)

Von den Klonen mit den korrekten IL‑4Rα- bzw. IL‑4RαIT-Inserts wurden wie in Abschnitt 3.4.10.4 beschrieben Maxipräparationen des Vektors hergestellt.

3.7 Transfektion der Zellinie Ba/F3

Zellen der pro-B-Zellinie Ba/F3 der Maus wurden mit PBS gewaschen und anschließend zu einer Konzentration von 1x107 vitalen Zellen in RPMI resuspendiert. Je 0,8 ml Zellsuspension wurden mit ca. 50 µg mit PvuI linearisiertem Vektor (pCR3.1/IL‑4R, pCR3.1/IL‑4RIT, pCR3.1) nach 5-minütiger Inkubation auf Eis bei 300 V und 950 µF in einem Elektroporator (Gene Pulser, Bio-Rad Laboratories) elektroporiert. Die Zellen wurden in je 20 ml Ba/F3-Medium (s.o.) für 48 h kultiviert und anschließend die stabil transfizierten Zellen unter Zugabe von Geneticin® (G418) (Invitrogen) in einer Konzentration von 800 µg/ml in 24-Loch-Platten für ca. 2-3 Wochen selektioniert. Um homogene, rezeptortragende Klone der mit pCR3.1™-Uni-IL‑4R bzw. pCR3.1™-Uni-IL‑4RIT transfizierten Zellen zu erhalten, wurden die stabil transfizierten Zellen auf eine Konzentration von ca. 10 Zellen/ml eingestellt und in 96-Loch-Platten mit je 100 µl Zellsuspension pro well kultivert. Die aus einer Einzelzelle entstandenen Klone wurden weiter expandiert und auf die Expression des IL‑4Rα/IL‑4RαIT bzw. deren mRNA mit Durchflußzytometrie, RT-PCR und RNase-Protection-Assay überprüft. 21 mit pCR3.1™-Uni-IL‑4R und 18 mit pCR3.1™-Uni-IL4RIT transfizierte Klone, die durchflußzytometrisch den Rezeptor auf der Zelloberfläche und in der RT-PCR den gesamten kodierenden Bereich der IL‑4R- bzw. IL‑4RIT-mRNA exprimierten, wurden in den folgenden Experimenten weiter untersucht. Die mit dem leeren Vektor pCR3.1™-Uni stabil transfizierten Zellen wurden ohne weitere Klonierung als negative Kontrolle eingesetzt.

3.8 Durchflußzytometrische Untersuchung der Expression von IL‑4R und IL‑4RIT

Je 5x105Zellen wurden in 100 µl PBS mit 20 µg Maus IgG (Sigma) zur Blockade unspezifischer Bindungen für 20 min und anschließend nach Zugabe von 20 µl PE-konjugiertem monoklonalem anti-human IL‑4Rα-Antikörper (anti CD124, Immunotech) bzw. 5 µl der passenden PE-konjugierten Isotyp-Kontrolle (Becton-Dickinson) für weitere 20 min bei 4°C inkubiert. Nach Waschen der Zellen in PBS wurden die Proben im Durchflußzytometer (FACScan, Becton-Dickinson) gemessen und die Ergebnisse mit der CellQuest-Software (Becton-Dickinson) und zur weiteren Bearbeitung unter Windows mit dem dem Programm WinMDI Version 2.8 ausgewertet.


[Seite 55↓]

3.9  Proliferations-Assays

3.9.1 Prinzip des MTS Zell-Proliferations-Test

Das Tetrazoliumsalz MTS (Owen’s Reagenz) wird bei Zugabe von PMS (Phenazin-Methosulfat) als Elektronendonator durch die mitochondrialen Dehydrogenasen lebender Zellen zu einem wasserlöslichen Formazan reduziert, dessen Entstehung sich colorimetrisch durch sein Absorptionsmaximum bei 490 nm bestimmen läßt und zu der Zahl der lebenden Zellen in der Kultur proportional ist. Mit dem MTS Zell-Proliferations-Test (CellTiter 96™ AQueousNon-Radioactive Cell Proliferation Assay, Promega, Madison, USA) wurde in der vorliegenden Arbeit die Fähigkeit der mit IL‑4Rα bzw. IL‑4RαIT transfizierten Zellen gemessen, unter Stimulation mit humanem und murinem IL‑4 zu proliferieren.

3.9.2 Durchführung des MTS Zell-Proliferations-Test

Je 2 x 104 Zellen/well wurden in 100 µl Medium ohne bzw. nach Zugabe unterschiedlicher Konzentrationen von humanem oder murinem IL‑4 in 96-well‑Platten bei 37°C inkubiert. Nach 42 bis 48 h wurden den Zellen pro well 20 µl einer Lösung aus 2 mg/ml MTS und 0,92 mg/ml PMS zugesetzt, und nach weiterer Inkubation der Platten für ca. 4-6 h bei 37°C die Entstehung des Formazans in einem Plattenphotometer mit einem Meßfilter von 490 nm und einem Referenzfilter von 720 nm gemessen. Die gemessenen Absorptionen (optische Dichte, O.D.) von jeweils 3 wells desselben Ansatzes wurden gemittelt und durch Subtraktion der gemittelten Absorption von wells mit Medium und MTS/PMS aber ohne Zellen korrigiert.

3.9.3 Proliferation nach Zugabe von spezifischem Antikörper gegen hIL‑4Rα

Je 2 x 104 Zellen/well wurden in 100 µl Medium ohne und mit 0,5 µg/ml polyklonalem Antikörper gegen humanen IL‑4R (R&D Systems) für 1 h bei Zimmertemperatur inkubiert. Nach 42 h Wachstum dieser Zellen bei 37°C unter unterschiedlichen Konzentra­tionen von humanem oder murinem IL‑4 wurde wie oben beschrieben die Proliferation gemessen.

3.10 Durchflußzytometrische Detektion apoptotischer Zellen

Während früher Stadien der Apoptose erscheint Phosphatidylserin (PS) auf der Außenseite der Zellmembran. Durch den Einsatz fluoreszenzmarkierter PS-bindende Proteine wie z.B. Annexin V-FITC können Zellen in diesem Stadium durchflußzytometrisch detektiert werden. Außerdem verliert die Zelle während der Apoptose zunehmend die Barrierefunktion ihrer Zellmembran, so daß der DNA-Farbstoff Propidiumjodid von der Zelle aufgenommen wird. [Seite 56↓]Apoptotische Zellen lassen sich daher mäßig, tote Zellen dagegen stark mit Propidiumjodid anfärben, während der Farbstoff in vitale Zellen nicht eindringt.

Zur Bestimmung des Anteils apoptotischer Zellen nach Stimulation der mit IL‑4Rα, IL‑4RαIT oder dem leeren Vektor transfizierten Zellklone mit IL‑4 wurden 1 x 106 Zellen/well in 1 ml Medium in 24-well-Platten je unter Zusatz von 4 ng/ml hIL‑4 oder mIL‑4 bzw. ohne Interleukin für 42 h bei 37°C inkubiert. Anschließend wurden die Zellen gewaschen, je 1,5 x 105 Zellen in 100 µl Calcium-Puffer resuspendiert und nach Zugabe von Annexin V‑FITC (Bender MedSystems) für 20 min im Dunkeln auf Eis inkubiert. Die Zellen wurden nochmals gewaschen, Propidiumjodid hinzugefügt und sofort im Durchfluß­zytometer gemessen.

3.11 RNase-Protection-Assay

Der RNase-Protection-Assay (RPA) basiert auf dem Prinzip, daß einzelsträngige RNA von RNasen verdaut wird, während doppelsträngige RNA-RNA-Hybride vor dem Verdau durch bestimmte RNasen geschützt sind. Durch Hybridisierung der RNA mit RNA-Sonden, die Sequenzen enthalten, die zu der nachzuweisenden RNA komplementär sind, wird bei dem nachfolgenden RNase-Verdau der hybridisierte Bereich der Sonden vor dem Angriff der RNasen bewahrt, und kann anschließend gelelektrophoretisch aufgetrennt und detektiert werden. Da die Sonden auch Sequenzen enthalten, die zu der nachzuweisenden RNA nicht komplementär sind und daher während der RNase-Behandlung verdaut werden, sind die unverdaute Sonde und der beim RNase-Verdau „geschützte“ Bereich in ihrer Länge voneinander zu unterscheiden. Unter Einsatz Fluorescein-markierter RNA-Sonden wurde ein nicht radioaktiver RPA etabliert, bei dem ohne weitere Hybridisierungsschritte nach Gelelektrophorese die Sonden direkt detektiert werden konnten (Abb. 8 und Abb. 9).


[Seite 57↓]

Abb. 8: Prinzip des RNase-Protection-Assays (Erläuterung siehe Text)

Abb. 9: Entstehung der beiden Fragmente von 310 und 75 nt bei RNase-Protektion der Sonde durch IL‑4RαIT-mRNA. Der Bereich der Sonde, der der Sequenz des „Exon x“ komplementär ist, bindet nicht an die IL‑4RαIT-mRNA und wird daher von der RNase verdaut (siehe auch Abb. 10)

3.11.1 In vitro-Transkription der Fluorescein-markierten RNA-Sonde

Die im RPA eingesetzte Sonde ist einem Bereich der IL‑4R-mRNA komplementär, der das alternativ gespleißte Exon enthält. Damit ist mit derselben Sonde ein Nachweis und die Unterscheidung der IL‑4R- und der IL4RIT-mRNA möglich. Zur Herstellung der Sonde wurde ausgehend von dem Plasmid pCR3.1TM-Uni-IL‑4R als template das geeignete Fragment mit dem Primerpaar IL4R 950 up/IL4R 1384 down amplifiziert. Um eine gerichtete Ligation in [Seite 58↓]den Vektor pCR3.1TM-Uni zu ermöglichen, wurde der Primer IL‑4R 1384 down zuvor phosphoryliert.

Reaktionsansatz

1 µl

pCR3.1TM-Uni-IL‑4R (Plasmidpräparation 1:100 verdünnt)

3 µl

PCR-Buffer (10x konz.), PERKIN ELMER

0,1 µl

AmpliTaq® DNA-Polymerase (5 U/µl), PERKIN ELMER

3 µl

dNTP-Mix (je 2 mM), GIBCO, BRL

1 µl

je Primer IL‑4R 950 up/IL‑4R 1384 down (phosph.) (10 µM), TIB MOLBIOL

 

H2O ad 30 µl

Reaktionsbedingungen

initiale Denaturierung:

94°C

5 min

 

Annealing:

60°C

45 sec

 

Elongation:

72°C

60 sec

30 Zyklen

Denaturierung:

94°C

60 sec

 

abschließende Elongation:

72°C

10 min

 

Dieses Fragment wurde in den Vektor pCR3.1TM-Uni so gerichtet einkloniert, daß bei vom T7-Promoter des Vektors ausgehender Transkription eine zur IL‑4Rα-mRNA komple­mentäre Sequenz entsteht. Anschließend wurde der Vektor mit der Restriktions­endonuklease EcoRI linearisiert und nach Phenol/Chloroform-Extraktion und Ethanol-Fällung in die in-vitro-Transkriptioneingesetzt.

In der in-vitro-Transkription wird das in den Reaktionsansatz gegebene Fluorescein-12-dUTP von der RNA-Polymerase in das Transkript eingebaut.

Reaktionsansatz in-vitro-Transkription

ca. 1 µg

linearisierte Plasmid-DNA

2 µl

Fluorescein RNA Labeling Mix (je 10 mM ATP, GTP und CTP, 6,5 mM UTP, 3,5 mM Fluorescein-12-UTP), Boehringer-Mannheim

2 µl

10x Transkriptionspuffer, Boehringer-Mannheim

2 µl

T7 RNA-Polymerase (10 U/µl), Boehringer-Mannheim

 

H2O ad 30 µl

Der Ansatz wurde für 2 h bei 37°C inkubiert.

Zur Entfernung der template-DNA wurde der Ansatz nach Zugabe von 2 µl DNase I, RNase-frei (10 U/µl) (Boehringer-Mannheim) für weitere 15 min bei 37°C inkubiert und anschließend die Reaktion mit 2 µl 0,2 M EDTA, pH 8,0 auf Eis gestoppt.

Die nicht eingebauten Nukleotide wurden durch Zentrifugation über eine Sephadex G50-Säule (Pharmacia Biotech) abgetrennt und das aufgereinigte Transkript 1:100 in RPA-Hybridisierungspuffer (PharMingen) verdünnt.


[Seite 59↓]

3.11.2  RNase Protection

Ca. 70 µg RNA wurden in einer Vakuum-Zentrifuge getrocknet, in 9 µl RPA-Hybridisierungs­puffer gelöst und zusammen mit 1 µl der verdünnten Fluorescein-markierten IL‑4R-Sonde nach kurzer Denaturierung bei 90°C für 12-16 h bei 50°C inkubiert.

Je Probe wurden 100 µl RNase-Reaktionsgemisch (RNase-Puffer, 125 U RNase T1 und 8 ng RNase A) dazugegeben und bei 30°C für 45 min inkubiert. Mit einem anschließenden Verdau der RNase mit Proteinase K (12 µg in 18 µl Proteinase K-Puffer) für 15 min bei 37°C wurde die Reaktion gestoppt.

Nach Fällung der Proben in Ethanol wurden die Pellets in Formamid-Ladepuffer gelöst, nach kurzer Denaturierung auf Eis gestellt und anschließend zur Analyse auf ein denaturierendes 6%iges Polyacrylamid-Gel (7,5 ml Acrylamid/Bisacrylamid (19:1, 40%), 5 ml 10x TBE, 24 g Harnstoff, H2O ad 50 ml, 300 µl Ammoniumpersulfat (10%), 40 µl TEMED) aufgetragen.

Als Größenmarker wurden die unverdaute IL‑4Rα-Sonde von 481 nt und ein weiteres in vitro-Transkript von 193 nt, hergestellt nach Linearisierung des pCR3.1/IL‑4Rα-Vektors mit BalI, eingesetzt (Abb. 10).

Abb. 10: Schematische Darstellung der RPA-Sonde. Nach Schneiden des Vektors mit EcoRI kann ein Fragment von 481 nt in vitro-transkribiert werden. Das durch die IL‑4Rα-mRNA geschützte Fragment hat nach Hybridisierung und RNase-Verdau eine Länge von 435 nt, von der IL‑4RαIT-mRNA werden zwei Fragmente von 310 und 75 nt Länge geschützt (siehe auch Abb. 9). Wird der Vektor mit der Restriktionsendonuklease BalI geschnitten, entsteht nach in vitro-Transkription ein Fragment von 193 nt. Dieses und das 481 nt lange Fragment wurden als Größenmarker eingesetzt.

3.11.3 Gene Scan

Die Proben wurden in der Gelelektrophorese-Kammer eines ABI PrismTM 373 Automatic Sequencer(PE, Applied Biosystems, Weiterstadt) aufgetrennt und mit der GeneScan Analysis-Software Version 1.2.2-1 (PE, Applied Biosystems) ausgewertet.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
04.01.2005