| ↓35 |
The Arabidopsis thaliana wildtype Col-0 was used in the experiments. In addition, the following genotypes were investigated (Table 2).
Table 2 : Genotypes of the mutants used in the experiment.
|
Mutant |
Accession |
Kind of mutagenesis |
Plant age (d) in Ref. |
Reference |
|
frd3-1 |
Col |
point mutation |
not determined |
Rogers & Guerinot 2002 |
|
pho1-2 |
Col |
EMS |
not determined |
Delhaize & Randall 1995 |
|
rhl1 |
Ws |
T-DNA (Feldmann 1991) |
3 |
Schneider et al. 1997 |
|
rhl2-1 |
Col |
EMS |
3 |
Schneider et al. 1997 |
|
rhl3-1 |
Col |
EMS |
3 |
Schneider et al. 1997 |
|
erh1 |
Ler |
fast neutrons |
3 |
Schneider et al. 1997 |
|
erh3 |
Col |
EMS |
3 |
Schneider et al. 1997 |
|
wer |
Col |
EMS |
4 |
Lee & Schiefelbein 1999 |
|
cpc |
Ws |
T-DNA |
not determined |
Wada et al. 1997 |
|
ttg |
Ler |
EMS |
5-6 |
Galway et al. 1994 |
|
gl2-1 |
Ler |
fast neutrons |
4-5 |
Masucci et al. 1996 |
|
rhd6 |
Col |
T-DNA (Feldmann & Marks 1987) |
5 |
Masucci & Schiefelbein 1996 |
|
trh1 |
Ws |
T-DNA |
3 |
Rigas et al. 2001 |
|
tip1-2 |
Col |
X-ray |
3-5 |
Ryan et al. 1998 |
|
rhd2 |
Col |
EMS |
4 |
Schiefelbein & Somerville 1990 |
|
rhd3 |
Col |
EMS |
4 |
Schiefelbein & Somerville 1990 |
|
rhd4 |
Col |
EMS |
4 |
Schiefelbein & Somerville 1990 |
|
kjk |
Ler |
EMS |
3-4 |
Favery et al. 2001 |
|
csld |
Ws |
T-DNA (Feldmann 1991) |
4-7 |
Wang et al. 2001 |
|
rhd1 |
Col |
EMS |
4 |
Schiefelbein & Somerville 1990 |
|
lrx |
Col |
En-1 (Wisman et al. 1998) |
4 |
Baumberger et al. 2001 |
The GL2-GUS lines were provided by J. Schiefelbein and the CPC-GUS lines by T. Wada.
| ↓36 |
Plants were grown in a growth chamber on agar medium as described by Estelle and Somerville (1987). The medium was composed of (mM): KNO3 (5), Ca(NO3)2 (2), MgSO4 (2), KH2PO4 (2.5), and (µM): MnCl2 (14), H3BO3 (70), ZnSO4 (1), CuSO4 (0.5), Na2MoO4 (0.2), CoCl2 (0.01), NaCl (10), and 40 µM FeEDTA. Sucrose (44 mM) and 5 mM MES (2-[N-morpholino]ethanesulfonic acid) were included, and the pH was adjusted to 5.5. The medium was solidified with 0.6% (w/v) agar for horizontal and 0.8% for vertical culture (Fluka, Taufkirchen, Germany). The seeds of all genotypes were surface-sterilized by immersion in 5% (v/v) NaOCl for 5 min and 96% ethanol for 7 min, followed by four rinses in sterile water. Seeds were placed onto Petri dishes containing agar medium and kept for 3 d at 4°C in the dark, before the plates were transferred to a growth chamber. The rhl, wer, ttg, gl2, cpc, erh, rhd, trh1, lrx, tip1, and kjk mutants were grown at 21°C in continuous light (50µE, Philips TLD Double Flux 115 W/33 RS lamps, Eindhoven, The Netherlands). All other plants were cultivated at 21°C in a 12 h photoperiod with a light intensity of 175 µE (Philips TLD 58W/840 and alternating 58W/830 lamps, Hamburg, Germany).
For investigation of root hair patterning, differential cytoplasmic staining, and analysis of GUS plants, twelve-day-old plants were transferred to fresh agar medium (control plants), medium without FeEDTA and with 100 µM 3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine sulphonate (FerroZine®, Serva, Heidelberg, Germany; Fe plants), or without P (P plants). Five plants were placed per Petri dish. The lower concentration of K due to the absence of KH2PO4 in the P medium was compensated for by the addition of 2.5 mM KCl. Plants were analyzed 7 days after transplantation. The Mutants from the root hair developmental pathway were analyzed after 9 days. The medium containing phosphite was obtained by replacing KH2PO4 with a freshly prepared filter-sterilized stock solution of potassium phosphite (Fluka, Taufkirchen, Germany) after autoclaving.
For the split-root experiments, the Col-0 wildtype and the frd3 1 and pho1 2 mutants were sown and transplanted to fresh control medium as described above. The root system of 25dayold plants was then washed in Fe- or P-free nutrient solution and was divided into two nearly equal parts. One-half of the root system was grown on Fe- or P-deficient agar medium and the other half on sufficient medium (+/Fe or +/P plants). Two plants were placed per Petri dish. As controls, plant roots were split on divided plates containing medium either with or without Fe or P (+/+ or -/- plants). Root hair patterning was investigated two and seven days after splitting. The root system of the frd3 1 mutant was split on +/Fe, +/+Fe and /Fe plates, the pho1 2 mutant on +/P, +/+P and /P media. Both mutants were analyzed after seven days.
| ↓37 |
For ICP, per2 and Col-0 plants were cultured on Petri dishes and in aerated liquid culture. The liquid culture medium was composed of (mM): KNO3 (3), MgSO4 (0.5), CaCl2 (1.5), K2SO4 (1.5), NaH2PO4 (0.5), (µM): H3BO3 (25), MnSO4 (1), ZnSO4 (0.5), (NH4)6Mo7O24 (0.05), CuSO4 (0.3), and 40 µM FeEDTA. Plants were precultured for 32 d; the culture medium was changed weekly. The plants were then grown for one week in medium without NaH2PO4 (P) and control medium (+P). One-half of the plants were replenished with 0.5 mM NaH2PO4 and harvested after two days. Five plants were used per genotype and treatment. The climate conditions were 21°C and a 10 h photoperiod at 300 µE (Planstar 400W Osram, Munich, Germany).
Plant material for DNA analysis, crossings, and production of seeds was grown in potting soil (GS-90 fein, Einheitserde-Werkverband, Sinntal-Jossa, Germany) mixed with vermiculite in a 1:1 ratio and supplemented with Lizentan® Combigranulat (Bayer, Monheim, Germany) according to the manufacturer’s instructions. Light conditions were a 12 h photoperiod with alternating Master HPI-T+ and SON-T Green Power lamps (400 W, Philips, Hamburg, Germany).
Root hair patterns were analyzed in cross-sections of 10 root apical segments collected from 10 different plants per genotype and treatment. The apical first cm of the root tip was excised, washed in 0.5 µM CaSO4 and fixed in a 3% agarose solution. Hand-cut sections from the root hair zone were stained with 0.05% toluidine blue (Hoyer Merck, Darmstadt, Germany) in 10 mM natrium acetate pH or 0.1% Calcofluor White Fluorescent Brighterner 28 (Sigma, Munich, Germany) (http://www.lsa.umich.edu/mcdb1/faculty/schiefel/lab/protocols.html). One cell layer each was analyzed using a Zeiss Axioskop2 plus microscope (Zeiss, Jena, Germany). The number of cortical and epidermal cells and root hairs in H and N position as well as branched root hairs was counted in five sections per root segment. In csld mutant, root hair frequency was estimated in apical segments of 20 roots in the 2nd mm behind the apex under the Stemi 2000-CS stereomicroscope (Zeiss, Jena, Germany) in the dark field by counting the bulges. Statistical significance of differences between mean values was determined using Students ttest. Two experimental repetitions were not significantly different and were, therefore, combined into one value. Micrographs and dark field photos were recorded with a Nikon Coolpix 990 digital camera. Photographs of whole plants were taken with a Nikon D 70 mirror reflex camera.
| ↓38 |
For the detection of GUS activity, the roots were submerged in substrate solution consisting of 100 µM sodium phosphate, pH 7.0, containing 0.1% Triton-X-100, 1 mM X-Gluc (5-brom-4-chloro-3-indolyl-β-D-glucopyranoside), 10 mM EDTA, and 1 mM K3Fe(CN)6. The reaction time of the GL2-GUS plants was 60 min. CPC-GUS plants were stained for 7 h.
To localize GUS activity in H and N cells, microtome sections of plastic-embedded tissues were prepared. The embedding procedure was conducted at 4°C. Stained roots were fixed overnight in 50 mM sodium phosphate, pH 7.0, containing 2% glutaraldhyde. After rinsing in the respective buffer for 15 min, the tissue was dehydrated in a graded ethanol series of 10, 20, 40, 60, 80, 90, and 95% (v/v) for 10 min each and two times in 100% ethanol for 30 min. The tissue was infiltrated with pure LR White (London Resin Co. Ltd., London, GB) followed by one change of LR White for 1 h each and one change overnight. The root segments were placed into gelatine capsules (Plano, Wetzlar, Germany) and polymerized at 60°C for 14 h. Transverse sections (4 µm) cut with a Microm HM 355 microtome using 45° glass knives were mounted on slides and covered with Roti®-Histokitt (Roth, Karlsruhe, Germany). Sections were examined in a Zeiss Axiophot photomicroscope by bright-field microscopy and photographed with a Nikon D1 digital camera. The images were processed with Adobe Photoshop software to enhance the differential signals detected in epidermal cells. The patterning of GUS activity was investigated with images of four sections per root and six roots per genotype and treatment.
For detection of the differential cytoplasmic staining, wildtype roots were embedded and cut as described above and stained with toluidine blue.
| ↓39 |
For cryo-SEM root tips were fixed on the probe plate with carbon adhesive and frozen in liquid nitrogen at 175°C. After sublimation at 95°C in an Oxford-Cryochamber/Transfersystem CTS 1500C roots were observed in a Hitachi S3200N scanning electron microscope.
The ferric-chelate reductase activity was measured with intact roots in the growth medium described above without sucrose and agar containing 0.5 mM FeEDTA and 0.5 mM FerroZine®. Five individual experiments with 10 plants per treatment (+/+Fe, /Fe, +/Fe) were conducted.
For the mutant screening and analysis, seeds were sown directly on medium without P and analyzed after 14 days. Mutants were screened that do not develop root hairs on P-deficient medium but form normal root hairs after transfer to P-sufficient medium. The roots were observed in the dark field with the Stemi 2000-CS stereomicroscope (Zeiss, Jena, Germany). A population of 39,266 EMS-mutagenized M2 plants (Col-0, Lehle seeds) and 31,326 M2 plants from a TDNA mutant population (Ws, 1st 49 of 100 Feldmann pools, NASC stock code N3115, set N2606-N2628) were screened. Two-hundred-five M3 lines of putative mutants from the EMS screening and 13 M3 lines of putative mutants from the TDNA screening were re-analyzed for the described phenotype. About 100 plants per line were investigated.
| ↓40 |
The per2 mutant was backcrossed to Col-0, and mapping populations with C24, Cvi, Ler, and Nd were prepared. Double mutants were generated with gl2-1 and erh3. Reziprocal crosses were made. From five 5week-old plants of each genotype, all secondary inflorescences were excised, and the meristem of the primary inflorescence and flowers with white petals was removed. From 5-6 remaining buds, all anthers were removed. After two days, unwantedly fertilized flowers were removed and the absence of anthers in remaining flowers was checked. The stigma was pollinated with anthers from the respective father genotype. F1 plants were self-pollinated to obtain F2 progeny. Phenotypical analysis of double mutants was conducted with about 800 F2 plants.
Low resolution mapping of the per2 mutation was performed by linkage analysis with the SNP marker set described by Törjek et al. (2003). One-hundred-thirteen F2 plants from a mapping population with C24, which displayed the per2 root hair phenotype, were analyzed with the markers MASC03658, MASC02577, MASC06086, MASC05857, MASC05386, MASC02947, MASC04279, MASC05045, MASC09219, MASC02820, MASC05208, MASC03154, MASC09207, MASC04317, and MASC04576 spanning the whole genome and with MASC03898, MASC02999, MASC05312, MASC03344, MASC02841, and MASC04516 from the upper arm of chromosome 3. Recombination frequencies were transformed into genetic map distances (D) using the Kosambi function. Fine mapping was performed with 987 F2 plants exhibiting the per2 phenotype from a mapping population with Cvi. Plants that had a recombination event between MASC04279 and MASC02841 were analyzed with a higher marker density in that region. SNPs were obtained from TAIR and by sequence comparisons of intergenic regions from Col-0 and Cvi. The phenotype of the recombinant lines was again checked in the F3.
About 50 mg leaf material were harvested into 12x96 collection microtubes (Qiagen, Hilden, Germany), which were cooled with liquid N2 and disrupted 2 min in the Retsch mill (Retsch, Haan, Germany) at a frequency of 20/s. The powder was mixed with 8 mM Tris, pH 8.0, containing 400 mM NaCl, 40 mM EDTA, and 2% SDS and incubated at 60°C for 20 min. After precipitation with 200 µl 3 M potassium acetate, pH 4.8 at 4°C for 10 min, proteins were removed by centrifugation at 5,600 g for 10 min. The supernatant was transferred to fresh collection microtubes and the DNA was precipitated by mixing with 40 µl 3 M sodium acetate, pH 5.2 for 30 sec. After centrifugation, the DNA pellet was washed with 200 µl 70% ethanol and dried for 10 min at 60°C. The DNA was resolved in 150 µl 10 mM Tris/HCl, pH 8.0, containing 1 mM EDTA and heated for 5 min at 60°C. One µl 100 mg/ml RNase (Marcherey-Nagel, Düren, Germany) was added and incubated at 37°C for 10 min. DNA was precipitated with 15 µl 3 M sodium acetate, pH 5.2, and 300 µl 96% ethanol and washed with 200 µl 70% ethanol. After drying for 20 min at 60°C, the DNA was resolved in 150 µl 10 mM Tris/HCl, pH 8.0, containing 1 mM EDTA. DNA for the fine mapping was isolated with the DNeasy 96 Plant Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The DNA quality was checked by electrophoresis in a 1% agarose gel containing 40 mM Tris/acetate, pH 8.5, 1 mM EDTA, and 0.01 µl/ml ethidiumbromide (Fluka, Taufkirchen, Germany). Ten µl DNA solution were mixed with 5 µl loading buffer composed of 25% glycerin containing xylene cyanol (Sigma, Munich, Germany) and bromphenol blue (Aldrich, Munich, Germany). Electrophoresis was run at 90 mV.
| ↓41 |
SNPs were detected with primer extension using the SNaPshot method. For this, 200-400 bp DNA fragments containing the respective SNP were amplified. Primers were designed using the Primer 3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi#PRIMER_SEQUENCE_INPUT). PCR was conducted in a 12.5 µl reaction mixture containing 1.5 µl of the DNA solution, 10 mM Tris/HCl pH 9.0, 2 mM MgCl2, 0.8 mM dNTPs (Qbiogene, MP Biomedicals, Germany), 0.5 nM primers, and 0.75 U Taq DNApolymerase (OptiTaq, roboklon, Berlin, Germany). The cycling conditions were 94°C for 2 min, 40 cycles of 94°C for 10 s, 55°C for 30 s, 72°C for 1 min, and 2 min termination at 72°C. Five µl of the PCR product was electrophoretically checked in a 2.5% agarose gel as described above.
For sequenzing, 500600 bp fragments were amplified. PCR was performed as described above. Sequencing was done by Martin Meixner (Services in Molecular Biology, Berlin, Germany). SNPs were identified by using Sequencher software.
Primers for low resolution mapping were used according to Törjek et al. (2003). Primers (5'→3') for high-resolution mapping are listed in Table 3 and primers for sequencing in Table 4.
| ↓42 |
Table 3 : Primers for SNaPshot analysis
|
Marker |
Forward primer |
Reverse primer |
SNaPshot primer |
|
K13E131 |
acattcgttcatcacaagctcg |
actctccattaggcccatcaagg |
agactctacggttggttgcgga |
|
MVI111 |
catcccggttcataccattc |
caatccacccatttgcttct |
gcgaaaacgcgatgaggaaagtga |
|
MMB121 |
tcccaagctgccataaactc |
caaactagcccccgtcatta |
agcaccaccacgagcaccca |
|
MQC122 |
tcgataaccgatcagggcgt |
acatttgtcgacacccctggagt |
catatgctcgctgtgttctttg |
|
MQC12-12 |
attgcgggagacactgaaat |
gagatgggcatgctaaaacc |
actgaaatcagtgaaggacatt |
|
K10D20-7.162 |
tcttgtgttttcttgtcatcgtg |
ccccagatcccaagtgtgta |
taaccacaaactgttttgagc |
|
K10D20f2 |
agcagctccccacaaattac |
tttcgatagaagctgaaacaaga |
ttacatgtctccatcattgac |
|
F3H11-1r2 |
caaaaatccgcctccttaca |
atgagaatcgcgggataaca |
agaatcgcgggataacaatact |
|
F3H11-7.222 |
ggggaaaatcattgatagtgct |
tgagagtatgggaccattgc |
ttcacgtcgatgataacctat |
|
M0E17-32 |
gctcctcttgggtttatgtgg |
gccattgagattttgatagcac |
tggtatgactttaaggagaag |
|
M0E17-2f2 |
tgattctttaccccaaaactgaa |
cgaaacttggatcagcaaaa |
tgtgattccttggttatctac |
|
MFD222 |
tcttagaaacacgcatcagacc |
cctcggatacataatgcatcagc |
cggatacataatgcatcagcat |
|
MSA62 |
gtatcgcttcaaacccaagtcca |
tgcagaaatgacaagcccct |
cattaacgctctaatattgtt |
|
MIL231 |
agaatgtgaaggcttggtctg |
accgttaccgcatccggttca |
gatgtgcatgaagctagagctat |
|
MKA231 |
ctattctcccactgggtctg |
tggcatgttgatacctgagca |
gacaagggtttccacgaaatgc |
Table 4 : Primers for sequencing
|
Fragment |
Forward primer |
Reverse primer |
|
MQC12 |
gggtgcctttcactgatgtt |
gcattatattggggcttgga |
|
K10D20-7.157as |
gtaaaaattccccgcctagc |
tgtcaatatgtcatcatcatcagaa |
|
K10D20-7.157bs |
tcctctaatgcgaaatgtatgc |
aaaaatggaggacaagccttaac |
|
K10D20-7.16s |
tgtacacaatgcggttgtca |
aaagcatttttgggtctcca |
|
K10D20 |
cgagaacgtggaccgactat |
cgcctcacacagttgcttag |
|
K10D20-2 |
atccgatgtcagtggtgtga |
gacgccatctcattggtttt |
|
F3H11-1 |
gtggccaatgtgggttttac |
tatggcccacaatggttttt |
|
F3H11-2 |
tggattttggctcgagattc |
cgacaacatcatttggcttg |
|
F3H11-7.22s |
tcatgggaatggcattgata |
aaccggaggaggcttaacat |
|
F-F3H11/M0E17 |
cattgtggttgctggttttg |
ttgcattgaatcctccatga |
|
M0E17-1 |
taagccaaaatggaggaacg |
gtacgaggaagcgagcaagt |
|
M0E17-2 |
attcgatgcggttctacgtc |
ttgaatgatcccgagaaagg |
|
M0E17-3 |
cgaagagatcaaaccggaag |
taacgttctcgtcgcttgtg |
|
M0E17-4 |
ctcgaagtgcacgcatgtat |
atccttgattgccgatcttg |
|
MFD22 |
gtgcagcatttgaagggttt |
tcattgctgccattgttgat |
|
MSA6 |
tctcgaacaatgtgtgtttgc |
tgcagaacatgggttaaacg |
|
At3g20500-1 |
gcgtcgcaaaagcctataaa |
caggaccaaatgaatctaaaaaca |
|
At3g20500-2 |
tgaagaaaacattgatgcttga |
catccacggccttacacttg |
|
At3g20500-3 |
ccaggggatctatcgtatgc |
cagccatcatttcatcacctt |
|
At3g20500-4i |
aggctgatctctcgaaggtg |
ccactctggtgacggatctt |
|
At3g20500-5 |
tcacacttacggtgcagttg |
tgtcacattcgttgaaccatc |
|
At3g20510-1 |
tccttttgaacattactcacattagg |
cccagatcgctaaaaaggaa |
|
At3g20510-2 |
agtgttcttgccattgattga |
gcgttatgacaaccgcatt |
|
At3g20510-3 |
tcgctggttatatcagtctcaaa |
ttcagatgagtttcagtcacca |
|
At3g20530-1i |
atcattcttctttttaaggtttcaat |
tttgcatcaatgcagtctttg |
|
At3g20530-1.1 |
tgatcccttttggattcgag |
tgttccggggtttctatctg |
|
At3g20530-2 |
aaagaagcgaggcgtatttg |
gccgcaactttcattcttgt |
|
At3g20530-3 |
gcgcggaacaagaagaag |
acattgctgctactgcaagc |
|
At3g20530-4i |
aggcgagtccattgttcaaa |
gccattgctctatgacaaacc |
|
At3g20555-1 |
tcgtctataatattggcgtacact |
aagccgcttgtaacgtcgta |
|
At3g20590-1 |
tgactttgccagtcagttgg |
tgagatccagcctgaaaacc |
|
At3g20590-2 |
tttctccaccatcaacacga |
gcaaaagttgaaatcaaacacc |
|
At3g20600-1 |
tcaaccaatcagcaaaccaa |
ctgaaaacagccgatccatt |
|
At3g20600-2 |
aagccgctaaacaaccagac |
tttccccatttgaacggtta |
|
At3g20610-1 |
ccggttattgtaccatgccta |
accgcttgaataaccgtctg |
|
At3g20610-2 |
ccacacgtatcaacaactcctc |
cacatgcatcaaaccaaagc |
Anthocyanin absorption of 20-day-old plants from vertical culture was measured. Leaf material (1050 mg from 2-4 plants) was homogenized with a RZR 2020 homogenisator (Heidolph, Schwabach, Germany) in 1.5 ml of a mixture of propanol:HCl:H2O (18:1:81) and extracted in boiling water for 1.5 min. After centrifugation at 16,400 g for 10 min, the extinction of the supernatant was measured at λ = 535 nm in a Novaspect II spectro photometer (Pharmacia, Freiburg, Germany). Four replicas were performed and the experiment repeated once. One representative experiment is shown.
| ↓43 |
For elemental analysis material from roots, shoots, and seeds was dried for 7 d at 60°C and then ground to powder. Material (50-100 mg) was weight into Teflon vessels and 1 ml HNO3 (Suprapur, Merck, Darmstadt, Germany) and 0.5 ml Millipore-quality water were added. The material was digested at 200°C and 15 bar for 1.5 h in a MARS 5 microwave (CEM, Kamp-Lintford, Germany). The volume of the extract was adjusted to 12 ml and Ca, K, Mg, P, S, Fe, B, Cu, Mn, Mo, Co, Ni, and Zn concentrations were measured in an IRIS Advantage Duo ER/S ICP spectroscope (Thermo Jarrell Ash, Franklin, MA, USA).
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 4.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 12.08.2008 |