Material und Methoden

2.1  Forschungsaufenthalt

↓21

Grundlage des Forschungsvorhabens war ein 6-wöchiger Forschungsaufenthalt in Januar und Februar 2004 im Oman von Prof. Dr. Neitzel und Herrn Abdelkrim Marnich, einem arabisch sprechenden Mitarbeiter (Fotograf und Dokumentationsassistent) des Instituts für Humangenetik.

2.2 Studienpopulation und Gewinnung der DNA

Während des Forschungsaufenthalts suchten Prof. Dr. Neitzel und Herr Marnich 270 Familien, die sich in 15 Krankenhäusern aus 4 Regionen des Omans befanden, auf, von denen die Mundschleimhautproben entnommen und Fragebögen ausgefüllt wurden. Bei 117 Familien konnte die DNA betroffener Trisomie 21 Kinder und beider Eltern erfasst werden. Die Proben und Fragebögen dieser Familien bildeten die Basis für die vorliegende Dissertation. Den Personen wurde mehrere Male mit einem Watteträger über die Wangenschleimhaut gestrichen und die so gewonnenen Epithelzellen in 2 ml große Eppendorf-Gefäße (gefüllt mit 50 mM Tris: pH 8.0, 50 mM EDTA, 50 mM Sucrose, 100 mM NaCl, 10% SDS) gegeben. Außerdem wurde 10 Mitgliedern einer Familie mit mehreren Trisomie 21 Kindern Blut abgenommen und ihre Proben mittels Courier Dienst (DHL) nach Berlin gesendet.

2.3 Isolierung genomischer DNA aus Mundschleimhautzellen

2.3.1  Geräte

↓22

Tab. 3 : Geräte zur Isolierung der DNA

Produktname

Herstellerfirma

Thermomixer

eppendorf

BioRobot® dM48

Qiagen

In Berlin angekommen, wurde aus den Proben die DNA nach folgendem Protokoll extrahiert:
Die Gefäße wurden 15 min in Thermomixer bei 90°C erwärmt und bei 700 rpm gerüttelt, um die Zellen aus der Watte zu lösen. Anschließend wurde das Lysat in 1,5 ml Eppendorf Gefäße pipettiert und in den BioRobot® dM48 der Firma QIAGEN gestellt. Ferner wurde der BioRobot® dM48 mit dem in Tabelle 4 beschriebenen Reaktions-Kit, sowie mit weiteren speziellen Arbeitsplatten und Pipettierspitzen laut Herstellerangaben bestückt.

2.3.2 Verfahren der DNA-Isolierung

Tab. 4 : Fertiges Reaktionssystem (Kit) zur Isolierung genomischer DNA aus Mundschleimhautzellen

Produktname

Herstellerfirma

Menge

MagAttract DNA Blood Mini M 48 KIT:

QIAGEN

MagAttract Suspension B

2x8ml

Puffer ML

3x54ml

Puffer MW1

2x77ml

Puffer MW2

1x87ml

RNare-freies Wasser

1x90ml

↓23

Das angeschlossene Computerprogramm zeigte die Extraktionsschritte und Geschwindigkeit an. Gleichzeitig können 48 verschiedene Proben isoliert werden. Der Hersteller QIAGEN gibt keine Angaben, welche Reagenzien im Reaktions-Kit enthalten sind, erläutert aber das Prinzip der DNA Extraktion:
Magnetische Partikel binden an die DNA, die dann von einem äußeren Magneten gehalten werden. Das Lysat, bestehend aus Puffer, Salzen und eventuellen Watterückständen wird in mehreren Waschschritten entfernt. Nach Entfernung der magnetischen Partikel bleibt die gereinigte DNA in einer Konzentration von circa 5-10 ng in Ethanol präzipitiert übrig.

Abb. 4 : DNA-Extraktion

2.4 Polymerase-Kettenreaktion

2.4.1  Geräte

Tab. 5 : Verwendete Geräte (sofern nicht gesondert unter dem Kapitel 3.5 angegeben)

Gerät

Bezeichnung (Herstellerfirma)

3100 Genetic Analyser

Applied Biosystems / Hitachi

PRC-Geräte

Gene Amp PCR System 2400 und 9600 (Perkin Elmer, Applied Biosystems)

Zentrifuge

Labofuge 400 R

Waage

Sartorius

Mikrowelle

Siemens

↓24

2.4.2 Amplifikationsreaktion

Die Methode der Polymerase-Kettenreaktion [Saiki et al.1988] wurde 1987 von Kary B. Mullis entwickelt. Dieses Verfahren hat die genetischen Analysen revolutioniert, denn es ermöglicht, enzymatisch von bestimmten Nukleotidsequenzen in vitro millionenfache Kopien herzustellen. Dieser als Amplifikation bezeichnete Vorgang macht auch sehr geringe Ausgangsmengen einer Analyse schnell zugänglich. Die Vorgänge bei der Vervielfältigung einer Nukleinsäure mittels PCR ähneln dem Reaktionsablauf der natürlichen Replikation. Dabei synthetisiert eine DNA-Polymerase, ausgehend von Startermolekülen, einen neuen DNA-Strang an einer einzelsträngigen Nukleinsäure-Matrize, der Template-DNA. Bei der PCR werden als Startermoleküle synthetische DNA-Oligonucleotide (Primer) verwendet, die spezifisch an die Template-DNA hybridisieren. Von deren 3’-Ende aus synthetisiert eine hitzestabile DNA-Polymerase den neuen DNA-Doppelstrang. Durch die Wahl des gegenläufig orientierten Oligonukleotid-Primerpaares kann gezielt die DNA-Sequenz zwischen den beiden Primern vervielfältigt werden. Das entscheidende Prinzip ist die zyklische Wiederholung der einzelnen Reaktionsschritte, wodurch die Matrize exponentiell amplifiziert wird.

Tab. 6 : Ansatz für die PCR pro Tube

Name

Menge pro Ansatz

Konzentration

Hersteller

dH2O

11µl

J.T.Baker

Puffer

1,5µl

10-fach

eppendorf

Primer Forward

1µl

10pmol

MWG-Blothech AG

Primer Reverse

1µl

10pmol

MWG-Blothech AG

dnTp’s

0,15µl

10pmol

Rapidozym

Taq-Polymease

0,1µl

5U/ µl

FirePol® Solis Biodyne

DNA

1 µl

50ng

↓25

Die PCR Amplifikation wurde in mehreren Ansätzen unter ansonsten gleichen Bedingungen durchgeführt. Der in Tabelle 6 beschriebene Ansatz unterschied sich lediglich in den Primerpaaren für die verschiedenen zu untersuchenden Marker. Ein PCR-Zyklus durchläuft zunächst die thermische Denaturierung. An die entstandene einzelsträngige DNA hybridisieren danach die Oligonukleotid-Primer (Annealing). Davon ausgehend synthetisiert die DNA-Polymerase schließlich die komplementären Stränge (Extension). Die PCR wurde auf ABI 9600 Cycler ausgeführt, der für bis zu 96 PCR-Probengefäße ausgerüstet ist. Eine automatische Steuerung regelt das zyklische Temperaturprogramm, in dem die jeweilige Temperatur und Zeit pro Reaktionsschritt sowie die Zyklenzahl wie in Tabelle 7 programmiert wurden.

Tab. 7 : Reaktionsschritte des ABI 9600 Cyclers

Reaktionsschritte

Temperatur

Dauer

Zyklen

1

Initiale Denaturierung

94˚C

5min

1x

2a)

Denaturierung

96˚C

10sec

5x mit je minus

1˚C bein Annealing

2b)

Annealing (touch down)

60˚C bis 55˚C

30sec

2c)

Extension

72˚C

30sec

3a)

Denaturierung

96˚C

10sec

25x

3b)

Annealing

55˚C

30sec

3c)

Extension

72˚C

30sec

4

Finale Extension

72˚C

10min

1x

5

Kühlen

4˚C

2.4.3 Verwendete Primer

↓26

Mikrosatelliten oder polymorphe Marker können unterschiedliche Anzahlen von kurzen, aneinander gelagerten Repeat-Einheiten enthalten. Führt man eine PCR mit Primern durch, die solche Repeats begrenzen, entstehen DNA-Fragmente unterschiedlicher Länge. Marker, für die verschieden lange DNA-Fragmente (Allele) bekannt sind, werden als hoch polymorph bezeichnet. Auf jedem Chromosom ist ein solches Allel vorhanden, so dass auf Grund eines diploiden Chromosomensatzes zwei Allele pro Person und im Fall der Trisomie 21 drei Allele pro Person amplifiziert werden können. Diese Allele werden stabil vererbt, das heißt die Länge der Repeats ändert sich fast nie bei der Vererbung von einer Generation auf die nächste; wohl unterscheidet sie sich aber bei nicht verwandten Individuen. Die Wahrscheinlichkeit, dass ein Individuum heterozygot (Het %) für ein Merkmal ist, und weitere Charakteristika der verwendeten Primer werden in den folgenden beiden Tabellen 8 und 9 angegeben.

Tab. 8 : Übersicht und Reihenfolge der verwendeten Primer des Chromosoms 14

Name

Primer-Sequenz in 5’-3’-Richtung

Lokalisation

Polymorphismen

Marshfield

(cM)

NCBI

(Kbp)

Zyto-

genetisch

HET (%)

Nucleotid

Repeats

Fragment

(bp)

D14S72 F

ACTATGGAGACTTACAGGAATAATG

9,36

20

14q 11.1-2

82.9

di-

257-271

D14S72 R

GCAATCTATGAGTCTGCAATGAAG

D14S990 F

GTCCACTTGGTCATGGAAAC

14,6

22,6

14q 11.1

85.0

di-

135-161

D14S990 R

AAGTTGCACTGTGACTGGG

D14S1280 F

AAGGCAACTGGATGTTTCAA

25,87

25,7

k.A.

k.A.

tetra-

289-301

D14S1280 R

TCAGGTGGACAGATGTACTCC

D14S70 F

CAATTTGCTAGTTTGGCAAC

40,11

33,5

14q 12-13

77.3

di-

212

D14S70 R

AGCTAATGACTTAGACACGTTG

D14S63 F

TTTACTCTCACTGCCCTG

40,11

63,7

14q 23-24

78.5

di-

145

D14S63 R

AATGGTCCAGTCTGCC

D14S68 F

GTTAACCTTGCAGGAGAGGT

95,89

87,7

14q 24.3-31

89.2

di-

k.A.

D14S68 R

GATAGTTGGTGGGTATATGGTG

Quellen: Human Genome Database (HDG), National Center for Biotechnology Infortmation (NCBI) und das Marschfield Center

Tab. 9 : Übersicht und Reihenfolge der verwendeten Primer des Chromosoms 21

Primer-Sequenz in 5’-3’-Richtung

Lokalisation

Polymorphismen

Marshfield

(cM)

NCBI

(Kbp)

Zyto-

genetisch

HET (%)

Nucleotid

Repeats

Fragment

(bp)

D21S215 F

GCTGACGTGACAGTTGTGAG

Centromer

Centromer

21q11.11

67.9

di-

168-180

D21S215 R

TCTAAAACAGTGTGTCTAGC

D21S369 F

ATGGCCTTGGCTAAATGCTG

Centromer

13678

21q11.11

70.0

di-

173-201

D21S369 R

CTAAGCTGATATGGTAAGTACA

D21S1432 F

CTTAGAGGGACAGAACTAATAGGC

2,99

16265

21q11.11

k.A.

tetra-

127-155

D21S1432 R

AGCCTATTGTGGGTTTGTGA

D21S1899 F

ACTGCATTATTCACAATAGCGAAG

9,72

18989

21q11.2

86

di-

153-187

D21S1899 R

CATGCTACAGGTTCATACACAGAG

D21S1414 F

GGCACCCAGTAAAAAATTACT

9,72

19476

21q11.2

87.5

tetra-

291

D21S1414 R

CTGTCTGTCTGTCTGTCTATC

D21S1437 F

ATGTACATGTGTCTGGGAAGG

13,05

20569

21q21.1

78.45

tetra-

119-143

D21S1437 R

TTCTCTACATATTTACTGCCAACA

D21S1914 F

CATTGGGCCTTCTGTCAAAT

19,39

24544

21q21.2-3

86.23

di-

203-223

D21S1914 R

CTGAACCAGGGCATGT

D21S1258 F

CGTTTCAATATAGACCAGATAAAGG

24,73

27741

21q22.11

73.34

di-

139-157

D21S1258 R

AGGTCAACTGCCAAAATCTAAG

D21S1909 F

CTGTGATTGTGTTTTCCATTTAGCA

28,48

31453

21q22.11-13

85,59

di-

232-250

D21S1909 R

TTCCACACTGAGTCAAGAGCAGG

D21S1888 F

AGGCAGGAGAATCACTTGAA

31,26

31775

21q22.11-13

11-13

86.14

di-

262-287

D21S1888 R

AGAAAGACATTCCATCGCT

D21S1898 F

GCAGGAACACTCAGTCTCTTCAG

31,26

33529

k.A.

64

di-

215-235

D21S1898 R

GCTCCATTAACATTTTAGGCACG

D21S1910 F

TTCTCTGGAATAAACGTGG

31,26

33870

21q22.12

94

di-

194-266

D21S1910 R

CACGGCAAAGTAGTATTTAATG

D21S1445 F

TTGTGAGAAGCAAACTGTGG

31,26

34296

k.A.

k.A.

di-

266-312

D21S1445 R

ATAATAGATGGCAAACAAATAGTTG

D21S1895 F

AGTCCTACTGATAAACTGTGGGC

33,84

35271

21q22.11-13

11-13

82.01

di-

224-282

D21S1895 R

CTGTCTCATAAGAACCTACCTGG

D21S1252 F

TCTGTCTTTGTCTCACTATCTG

35,45

36747

21q22.11-13

11-13

80.36

di-

231-251

D21S1252 R

GCAATGCTCTGTGGCT

D21S167 F

TCCTTCCATGTACTCTGCA

38,65

37116

21q22.2

82.1

di-

156-160

D21S167 R

TGCCCTGAAGCACATGTGT

D21S2055 F

AACAGAACCAATAGGCTATCTATC

40,49

40112

k.A

k.A

k.A.

117-193

D21S2055 R

TACAGTAAATCACTTGGTAGGAGA

D21S1411 F

AAAGCATTGGCCTCCATG

51,49

43054

k.A

93.3

tetra-

109

D21S1411 R

TTAATATGGACCTGCTAGAATTTGG

D21S1890 F

GGTCTGACCACAGATTTCC

52,50

43704

k.A

88.0

di-

143-173

D21S1890 R

AAAAACACTCTGAACGATTAAGG

D21S1903 F

GCTTGCTGAACTCACCTG

53,64

44997

k.A

83.5

di-

225-265

D21S1903 R

GCCTCCCAAAGTGCTC

D21S1446 F

ATGTACGATACGTAATACTTGACAA

57,77

46894

21q22.3

k.A.

tetra-

209-223

D21S1446 R

GTCCCAAAGGACCTGCTC

Quellen: Human Genome Database (HDG), National Center for Biotechnology Infortmation (NCBI) und das Marschfield Center

2.5 Qualitative DNA-Überprüfung

↓27

Tab. 10 : Geräte für die Herstellung des Agarose-Gels und die Gelelektrophorese

Geräte

Bezeichnung (Herstellerfirma)

Elektrophoresekammer

Horizon™ 11-14, Bethesda Research Laboratories

Life Technologies Inc.

Spannungsgerät

Electrophoresis Power Supply ST606T, Gibeco BRL

Life Technologies Inc.

UV-Tisch

Herolab

Kamera

Herolab

2.5.1 Vorbereitung des Agarose-Gels

Nach erfolgter PCR wurde die amplifizierte DNA auf einem 2 %igen Agarose-Gel überprüft. Die in Tabelle 11 genannten Reagenzien wurden in der Mikrowelle bei 360 W circa 10 Minuten erhitzt, bis die Agarose vollständig gelöst war. Dann wurde das Gel in etwa 5 mm Dicke auf ein sauberes Glas gegossen und zwei 24-zähnige Kämme eingelegt, die nach dem Aushärten gezogen werden konnten. Diese Arbeitsschritte erfolgten unter einem Abzug und mit Verwendung von Latexhandschuhen, da Ethidiumbromid mutagen und toxisch ist.

↓28

Tab. 11 : Reagenzien des 2%igen Agarosegels

Reagenzien

Menge

Hersteller

Agarosepulver

2g

Merck

TBE Puffer

100ml

Biochrom AG

Ethidiumbromid

50µl

Sigma

2.5.2 Gelelektrophorese

Nach dem Erstarren des Gels wurde es in die Elektrophoresekammer gelegt, die an einem Spannungsgerät angeschlosssen ist. Das Puffer-Reservoir wurde mit 1x TBE gefüllt, so dass das Gel gerade vollständig mit Puffer bedeckt war. Dort wurden je 5 µl PCR-Produkt und 3 µl Ladepuffer [10 mmol EDTA, 40% Sucrose, Bromphenolblau (Merck)] in die Taschen pipettiert; sowie in die letzte Tasche 5 µl Kb-Leiter aufgetragen. Zur Orientierung, wie weit die DNA-Stränge bereits gelaufen sind, dient der Ladepuffer. Die DNA wandert auf Grund ihrer negativen Ladung in Richtung Anode, so dass sich die Geltaschen auf der Kathodenseite befinden müssen. Das Ethidiumbromid wandert in die entgegengesetzte Richtung zur Anode. Beim Aufeinandertreffen dieser Moleküle bindet sich Ethidiumbromid interkalierend zwischen die Basen der DNA – was durch seine fluoreszierenden Eigenschaften die DNA unter UV-Licht sichtbar macht. Das Gel lief 10 min bei 180 V und wurde nach dem Lauf unter Durchleuchtung von 302 nm ultraviolettem Licht auf einem Polaroid 667 Film aufgenommen.

2.6 Analyse der Fragmente

2.6.1  Reagenzien

↓29

Formamid 99,5%

Amresco

ROX Size Standard

Genescan® 400HD

Applied Biosystems

Laufpuffer mit 3% Polymer (Kathode):

1 ml 10 x Fragmentanalysepuffer

4,3 g 7%iges Genescan Polymer

4 g Harnstoff

steriles Wasser ad 10 ml

ABI

ABI

Anodenpuffer mit 2% Polymer

5 ml 10 X Fragmentanalysepuffer,

14,1 g 7%iges Genescan Polymer

steriles Wasser ad 10ml

ABI

ABI

Bestückung des Sequenzierers:

Anode 7,5 ml Anodenpuffer

1. Position: 1 ml Laufpuffer

2. Position: 1 ml aqua dest.

3. Position: 0,75 ml aqua dest.

4. Position: 0,5 ml 0,3 M Na OH

5. Position: 0,5 ml 1 M HCL

2.6.2 Denaturierung

Je nach Stärke der Bande in der vorausgegangenen Gelelektrophorese wurde von jedem der amplifizierten Nukleotidrepeats 1-2 µl für die weitere Vorbereitung verwendet. Zu jeder Probe wurden 9 µl Formamid und 0,3 µl ROX Size Standard 400HD hinzugefügt und die gesamte Mixtur bei 3-4 min bei 96°C denaturiert. Um eine mögliche Wiederanlagerung zu verhindern, wurden die Proben bis zum Beladen des Sequenzers auf Eis gelagert. Die restliche DNA wurde für eventuelle Wiederholungsläufe eingefroren und wieder verwendet.

2.6.3 Kapillar-Elektrophorese

↓30

Die Analyse der PCR-Produkte erfolgte mit Hilfe des ABI 3100 Genescan-Sequenzierers, der zur Sequenz- und Fragmentanalyse verwendet wird. Dabei werden die zu analysierenden
DNA-Fragmente über ihre Größe und ihre Fluoreszenzmarkierung identifiziert. Vor dem Lauf des Sequenzers wurden die denaturierten Proben zusammen mit den Reagenzien im Abschnitt 3.6.1. versehen und eine Kalibrierung der Schrittmotoren vorgenommen. Dieser ist mit Genescan-Kapillaren mit 75µm Innendurchmesser und einer Halterung für 384 Proben versehen. Mit Hilfe einer angelegten Spannung wandern die DNA-Fragmente durch die mit Polymer-Gel gefüllten Kapillaren. Ein Argonlaser, der über ein Spiegelsystem auf das Gel gelenkt wird, regt den Fluoreszenzfarbstoff an. Dabei erfolgt die elektrophoretische Auftrennung nach der Größe der Fragmente.

Die Fluoreszenzemission wird an einem Spektrograph in die Spektralfarben aufgebrochen. Diese Spektralfarben werden auf eine CCD-Sensor Oberfläche geleitet, wo sie spezifisch detektiert werden. Das System erlaubt die simultane Detektion verschiedener Fluoreszenzfarbstoffe. Während der Elektrophorese werden die Daten durch einen Computer digital erfasst. Ein angeschlossener Power Macintosh 7200, auf dem die zugehörige Software ABI PRISM 3100 Collection installiert ist, steuert den Sequenzierer auf Grund der folgenden Voreinstellungen:

Länge bis zum Detektor

30 cm

Injektionszeit

10 s

Injektionsspannung

7,0 kV

Laufspannung

13,0 kV

Lauftemperatur

30°C

Laufzeit

18 min

↓31

Zusätzlich zu der untersuchten Probe wird in jeder Spur ein Längenstandard geladen (ROX Size Standard 400HD), der eine eigene Fluoreszenzmarkierung trägt. Mit Hilfe des internen Längenstandards können die Größen der untersuchten DNA-Fragmente bis auf 1bp genau berechnet werden.

2.6.4 Rohdatenverarbeitung

Mit Hilfe des Programms „ABI Prism® GeneScan Analysis Software 3.7“, das auf einem angeschlossenen Rechner installiert ist, können die Rohdaten weiterverarbeitet werden. Der Sequenzierer bearbeitet maximal vier Fluoreszenzfarbstoffe, so dass neben den drei Primer- Farbstoffen ein weiterer für die Längenstandards (ROX Size Standard 400HD) verwendet wurde. Dieser weist folgende farbstoffmarkierte Oligonukleotide auf: 50, 60, 90, 100, 120, 150, 160, 180, 190, 200, 220, 240, 260, 280, 290, 300, 320, 340, 360, 380 und 400 bp. Wenn man diese Werte den dazugehörigen Peaks der Rohdaten zuordnet, kann die folgende Eichkurve erstellt werden, die für die gesamten Rohdaten eine Längenzuordnung ermöglicht.

Abb. 5 : Eichkurve des GeneScan-400HD Size Standard

↓32

Abhängig von der Größe der zu erwartenden Nukleotidsequenzen und von den eingesetzten Fluoreszenzfarbstoffen, wurden im Rahmen der Voreinstellungen des Programms verschiedene Parameter für die Softwareanalyse eingestellt. Zur Markierung der DNA-Stränge wurden 6-Carboxyfluoreszein (6-FAM) sowie seine beiden Derivate Hexachloro-6-Carboxyfluoreszein (HEX) und Tetrachloro-6-Carboxyfluoreszein (TET) verwendet.

Tab. 12 : Absorbtions- und Emissionsmaxima der verwendeten Farbstoffe:

Farbstoffe

TET

6-FAM

HEX

Absorbtionsmaximum (nm)

519

495

537

Emissionsmaximum (nm)

539

521

556

2.6.5 Auswertung am Beispiel

↓33

Nachfolgend wird am Beispiel des Markers D21S215 (hier TET markiert) eine Auswertung erläutert. In einer neuen Datei wird die Eichkurve des Längenstandards voreingestellt (ROX ist rot). Dann werden die analysierten Rohdaten geöffnet und der Bereich vergrößert, in dem die Signale erwartet werden (hier zwischen 160 und 180 bp). Sollten die Signale schwach sein, kann die Y-Achse in größeren Intervallen gezeigt werden. Umgekehrt gilt dies auch bei sehr starken Signalen. Die Veränderung der Skala hat keinen Einfluss auf die Auswertung und dient nur den Gründen der Anschaulichkeit. Als weiterer Schritt muss ein Allel definiert werden.

Abb. 6 : : Beispielauswertung Index mit Trisomie 21

Im Beispiel oben besteht ein Allel aus zwei kleinen Vor-Peaks, dem tatsächlichen Allel-Peak, der durch Anklicken grün ausgefüllt wird und einem Nach-Peak. Die einzige Abweichung bildet das zweite Allel des Index. Es hat keine Vor-Peaks, weil es dicht nach dem ersten Allel folgt. Dieses Auswertungsmuster kehrt in anderen analysierten Daten des gleichen Markers wieder und muss nur bei einem anderen Marker neu definiert werden. Höhe und Fläche der Peaks gibt das Programm in einer Tabelle gesondert an.

↓34

An der Allelverteilung im Beispiel ist deutlich zu erkennen, dass das Index-Kind trisom für das Chromosom 21 ist. Der Vater hat das Allel 167 und die Mutter das Allel 169 an das Kind weitervererbt. Da die Eltern beide das Allel 173 besitzen ist hieraus noch nicht zu ersehen, wer von beiden das überzählige Chromosom 21 vererbt hat. Diese Frage lässt sich jedoch auf Grund der Konstellation weiterer Marker klären.

2.7 Methylentetrahydrofolat-Reduktase Polymorphismus

2.7.1  Personenauswahl

Wie auch bei der Mikrosatellitenanalyse wurden die 117 Mütter mit einem Down Syndrom Kind auf den Polymorphismus hin untersucht. Zusätzlich zu den innerfamiliären Untersuchungen, dienten die Ergebnisse der Väter als Kontrollen.

2.7.2 Geräte und Reagenzien

Die verwendeten Geräte werden wie in Kapitel 3.5. beschrieben eingesetzt. Die Reagenzien sind, sofern nicht anders in Tabelle 13 erwähnt, vom Hersteller Applied Biosystems.

2.7.3 Prinzip der Reaktion

↓35

Für die Untersuchung auf die Mutation im MTHFR-Gen wird extrahierte DNA (unter 3.3. beschrieben) benötigt. Mit Hilfe der PCR wird ein Bereich um den möglichen Nucleotidaustausch an Position 677 des MTHFR-Gens von C (Cytosin) nach T (Thymin) amplifiziert und mit einem Restriktionsenzym auf die Mutation hin untersucht. Die detaillierte Vorgehensweise ist in der Tabelle 13 (nach dem Protokoll des Herstellers, Applied Biosystems) beschrieben.

Die Auswertung erfolgt ebenfalls mit dem Programm „ABI Prism® GeneScan Analysis Software 3.7“, wobei jeweils nur ein schwarzer Peak für C (Cytosin), ein roter Peak für T (Thymin) oder beide Peaks gleichzeitig im Fall der Heterozygotie pro Probe auszuwerten ist.

Tab. 13 : SNaP Shot Protokoll

1.) Exo I / Shrimp Alkaline Phosphatase (SAP) clean up

Je 5 µl des unten genannten Reaktionsgemisches werden zu je 5 µl PCR-Produkt gegeben, um ein Ausgangsvolumen von 10 µl zu erhalten.

Reagenzien

Menge 1x

Menge 110x

10x Exo I Puffer

0.50 µl

55.0 µl

10 U/µl Exo I Enzym

0.05 µl

5.5 µl

1 U/µl SAP Enzym

0.50 µl

55.0 µl

dH2O

3.50 µl

385.0 µl

SAP Dephosphorylation Puffer

0.45 µl

49.5 µl

Anschließend wird alles bei 37°C für 60 min, dann bei 72°C für 15 min inkubiert und bis zum nächsten Schritt bei 4°C gekühlt.

2.) SNaP Shot Reaktion

Auf jede Tube der Mikrotiterplatte werden 1.5 µl, der unter Schritt 1 erstellten Mixtur und 3.5 µl des unten beschriebenen Gemisches verteilt.

Reagenzien

Menge 1x

Menge 110x

SNaP Shot Reaktions-Mix

0.625 µl

68.75 µl

677 C-T Primer mix

0.02 µl

2.2 µl

dH2O

2.855 µl

314,05 µl

Die PCR Konditionen zur Programmierung des Cyclers:

96°C

10 sec

50°C

5 sec

} 25 Zyklen

60°C

30 sec

4°C

15 min

3.) Entfernen ungebundener ddNTPs mit SAP

2 µl der folgenden Mischung hinzufügen:

Reagenzien

Menge 1x

Menge 110x

SAP Enzym

0.50 µl

105.0 µl

SAP Dephosphorylation Puffer

0.45 µl

94.5 µl

dH2O

1.05 µl

220.5 µl

Anschließend wird alles bei 37°C für 60 min, dann bei 72°C für 15 min inkubiert und bis zum nächsten Schritt bei 4°C gekühlt.

4.) Proben für den ABI 3700 vorbereiten

Reagenzien

Menge 1x

Menge 110x

HiDi Formamid

9.50 µl

825.0 µl

SAP treated SNaP Produkt

0.3 µl

33 µl

Die Kapillarelektrophorese schließt sich nach dem gleichen Prinzip an, wie unter 3.6.3. beschrieben.

2.8 Interview

↓36

Bei allen Trisomie 21 Fällen sowie deren Kontrollen wurden nur die Mütter mit einem strukturierten Interview befragt. Diese Interviews wurden persönlich durchgeführt und zu Beginn gemäß dem folgenden Text auf einige allgemeine Dinge hingewiesen:

2.8.1  Vorbemerkungen

„Bevor ich einige Fragen stelle, möchte ich auf einige Punkte hinweisen:

Ich bin Doktor und werde Ihre Antworten streng vertraulich behandeln. Dies gilt auch für die anderen Anwesenden. Keiner weiteren Person als die hier Anwesenden werden irgendwelche Informationen über Sie erhalten. Das, was Sie mir mitteilen, dient ausschließlich wissenschaftlichen Zwecken. Das Ziel unserer Untersuchung ist es, etwas über die Entstehung des Down Syndroms im Oman herauszufinden. Alle Daten werden anonymisiert ausgewertet, d.h. Ihr Name wird niemandem mitgeteilt und wird daher auch in keinem Bericht erscheinen.

↓37

Sie können zu jedem Zeitpunkt die Befragung abbrechen.

Selbstverständlich steht es Ihnen völlig frei, bestimmte Antworten zu verweigern. Mir ist es sogar lieber, wenn sie keine Antwort geben, als eine falsche Antwort, was immer auch die Gründe dafür sein mögen.

Ich bin gern bereit, Ihnen auf alle Fragen zu antworten, die sich Ihnen stellen. Ich wäre Ihnen aber sehr dankbar, wenn Sie damit möglichst bis zum Ende des Interviews warten würden.“

2.8.2 Datenbank

↓38

Die Auswertung der Fragebögen erfolgte durch die Erstellung einer Datenbank. Wie unter 3.7.4. Beschrieben erfolgte hier ebenfalls die statistische Auswertung mit SPSS. Da es sich bei dieser Untersuchung um eine Pilotstudie handelt, liegt die Bedeutung der Datenbank nur im Hinblick auf die Generation von Hypothesen für spätere, weiterführende Untersuchungen.

Tab. 14 : Der Fragebogen umfasst die folgenden Variablen:

ID-Nummer

 

Soziodemographische Daten

 

Geburtstag und -ort

 

Geburtsland

 

ethnische Herkunft

 

höchster Schulabschluss

 

Anamnese bisheriger Schwangerschaften

 

Gesamtzahl

 

Für jede einzelne Schwangerschaft:

Ausgang der SS

 

Geschlecht

 

Gewicht

 

Art der Zeugung

 

Fehlbildungen beim Kind

 

gesundheitliche Schwierigkeiten beim Kind

 

etwaige Todesursache

 

Anamnese der Schwangerschaft des Kindes mit Trisomie 21 und Verhütung

 

Tag des Schwangerschaftsendes

 

Schwangerschaftsdauer

 

Besonderheiten zum Konzeptionstermin

 

Etwaige medizinische Unterstützung für das Zustandekommen der Schwangerschaft

 

Frequenz des Geschlechtsverkehrs

 

Art der Antikonzeption

Methoden

 

Zeiträume

 

genaue Anamnese der verschiedenen Verhütungsmethoden

 

Bestehende oder vorangegangene Erkrankungen

 

Erkrankung an und Art der Behandlung von

Hypo-/Hyperthyreose

 

Diabetes mellitus

 

Hypertonus

 

Epilepsien

 

Asthma

 

Leukämien

 

Malignome

 

Mononukleose

 

Zoster

 

Morbilli

 

Herpes labiales / Herpes genitales

 

Toxoplasmose

 

Tropenkrankheiten

 

Lupus erythematodes

 

Rheuma

 

Spondylitis ankylosans

 

Familienanamnese

 

Geschwister

Anzahl der lebend geborenen Geschwister

 

Anzahl der tot geborenen Geschwister

 

Anzahl der Geschwister mit Fehlbildungen

 

Eltern

Alter bzw. Todesalter

 

Erkrankung die zum Tode führte

 

Erkrankung von Familienmitgliedern an

Leukämie

(inkl. Halbgeschwister an)

Morbus Alzheimer

Down Syndrom

anderen Chromosomenanomalien

Verwandtschaftsbezug zum Ehemann

Menstruationsanamnese

Eintritt der Menarche

Unregelmäßigkeiten der Periode

Zyklusdauer

Ovarektomie

Diagnostische und therapeutische Strahlenbehandlungen

Häufigkeit und Zeitpunkt(e)

vor mehr als einem Jahr

während des letzten Jahres

Unmittelbar um den Konzeptionstermin herum

von röntgendiagnostischen Untersuchungen von

Knochen und Weichteilen

Durchleuchtungen

Thoraxuntersuchungen

Abdomenübersicht

Mammografie

Magen-Darm-Passage

Cholezystographie

retrogradem Kontrasteinlauf

Angiokardiographie

IVP

Schilddrüsenszintigrafie

Phlebographie

Arteriographie

Strahlenbehandlungen wegen

dermatologischer Erkrankungen

Polypen

Thymus-Erkrankungen

malignen Tumoren

Sonstigen Erkrankungen

Exogene Noxen

Frequenz und Menge des Konsums von

Kaffe

Tee

Cola

Coffein-Tabletten

Drogen

Zigaretten

Berufsanamnese

Dauer der Beschäftigung

Beschreibung der Tätigkeit

Branche

Kontakte durch Beruf oder Hobby mit

Schwermetallen

Chemikalien

Desinfektionsmitteln

Anästhetika

Sonstiges


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
15.11.2006