|
| [page 26↓] |
Fatty acids and Eicosanoids
Arachidonic acid, linoleic acid, 12-HpETE, 12-HETE, 15-HETE, 13-HODE - Cayman (USA).
Culture reagents
Fetal Calf Serum (FCS), Dulbecco’s Modified Eagles Medium (DMEM), Trypsin/EDTA, Streptomycin/Penicillin – Seromed (Germany); Yeast Nitrogen Base, Yeast extract, Tryptone, Peptone, Agar– Difco (USA).
Separation media
Agarose – Roth (Germany); Silica gel-60 TLC plates – Merck (Germany); Rotiphorese acrylamide Gel 30 – ROTH (Germany); Supesil silica HPLC column – Supelco (Germany), Novapak C18 RPLC column – VDS Optilab (Germany).
Kits
RNeasy Mini Kit and QIAshredder - Qiagen (Germany); Protein Determination kit – Biorad (USA); Chemiluminiscent system - Santa Cruz (Germany); Luciferase Reporter Assay – Promega (Germany); PolyFect Transfection Kit- Qiagen (Germany); Lipofectamine 2000 – Invitrogen (Germany); QuikChange kit – Stratagene (USA); Cell Death detection ELISA – Roche (Germany).
Antibodies
Actin – Sigma (Germany); PPARγ – Cayman (USA); histone H3 and acetyl histone H3 –Upstate, Germany; Bcl-XL – Calbiochem (Germany); Pan acetyl, STAT6, cytochrome c, porin VDAC, Protein A agarose, anti-mouse, anti-rabbit, anti-goat secondary antibodies conjugated with horse radish peroxidase – Santa Cruz (Germany).
RT-PCR reagents
Expand reverse transcriptase – Roche Biochemicals (Germany), Taq DNA Polymerase – AB Technologies (Germany), Pfu Turbo Polymerase – Stratagene (USA), Platinum Taq Polymerase – Invitrogen (Germany).
Caspase substrate and inhibitor
Caspase-3 substrate Ac-DEVD-pNA and inhibitor Z-VAD-FMK – Calbiochem (Germany).
[page 27↓]Enzymes
Proteinase K- Roche Biochemicals (Germany); T4 DNA ligase-Gene Craft (Germany); Terminal deoxynucleotide transferase (TdT)- Pharmacia (Sweden); Restriction enzymes were obtained from NEB (USA).
Radiochemicals
14C-Arachidonic acid (55 mCi/mmol); 3H-Acetyl Coenzyme-A - Amersham (England).
Primers
All primers were purchased from TIB Biomol (Germany).
Sequencing
Automated fluorescent DNA sequencing was performed by SeqLab (Germany).
Other reagents
All organic solvents used in HPLC and GC-MS experiments were of LiChrosolv or SupraSolv quality, all other reagents were of analytical grade and were mainly obtained from Sigma Chemicals (Germany).
LB MEDIUM
|
10 g/L |
Tryptone, |
|
5 g/L |
Yeast extract, |
|
5 g/L |
NaCl. |
The pH was adjusted to 7.2 and autoclaved.
1x TBE
|
10.8 g/L |
Tris base |
|
5.5 g/L |
Boric acid |
|
4 ml |
EDTA (0.5 M) |
|
| [page 28↓] |
A549 cells (DSMZ, Braunschweig, Germany) and HeLa (DSMZ, Braunschweiz, Germany) were cultured in Dulbecco’s Modified Eagle’s medium supplemented with 10 % fetal calf serum. Normal human bronchial epithelial cells (BEAS-2B) (ATCC, Washington D.C., USA) were cultivated in a modified LHC-9 medium with 0.5 ng/ml recombinant epidermal growth factor (EGF), 500 ng/ml hydrocortisone, 0.005 mg/ml insulin, 0.035 mg/ml bovine pituitary extract, 500 nM ethanolamine, 500 nM phosphoethanolamine, 0.01 mg/ml transferrin, 6.5 ng/ml 3,3',5-triiodothyronine, 500 ng/ml epinephrine, 0.1 ng/ml retinoic acid and trace elements as supplied by Clonetics Corporation, USA. Rinm5F, rat insulinoma cells (ATCC, Washington D.C., USA), was cultured in RPMI 1640 medium supplemented with 10 % fetal calf serum. The cells were grown in humidified incubators at 37 0C with 5 % CO2.
Transient transfection of DNA was performed in A549 and HeLa cells using Polyfect transfection reagent (Qiagen, Germany). 5x105 cells were seeded into 35 mm tissue culture plates. Next morning, 1.5 µg of plasmid DNA was mixed with 12 µl of Polyfect reagent in 100 µl antibiotic free medium and DNA-liposome complexes were allowed to form at room temperature for 20 minutes. The complexes were gently seeded onto the cells and incubated at normal conditions for 24 h. The cells were used for further experiments at the end of this period. For Rinm5F cells, Lipofectamine 2000 reagent was utilised along with 1 µg of DNA. The cells were cotransfected with 0.1 µg of control plasmid pRSVLACZ to normalise for transfection efficiency by performing β-galactosidase assay.
Stably transfected cells were achieved by transferring transiently transfected cells into medium containing restrictive antibiotic G418 (Invitrogen, Germany). For HeLa cells 800 µg/ml and for Rinm5F cells 700 µg/ml of G418 was used. Individual colonies of G418 cells were separately grown for at least 1 month in the antibiotic. After this period, the cells were transferred and maintained in medium containing half the selective concentration of the antibiotic. The clones expressing highest amount of foreign protein as evidenced from Western blotting were used for further experiments. Sodium selenite (Sigma, Germany) 10 nM was supplemented into the medium in the case of Rinm5F cells transfected with cGPx or PHGPx. Rinm5F stably transfected with cytosolic glutathione peroxidase (cGPx), kind gift from Dr. Tiedge, Hannover, Germany, were cultures in the same culture medium as above supplemented with 350 µg/ml G418 (Invitrogen) and 10 nM sodium selenite.
|
| [page 29↓] |
Plasmids wt E1A, mCBP and mRb were kind gifts of Dr. A. Hecht, Freiburg, Germany. wt E1A consists of 2 domains which bind to CBP and Rb proteins and inhibit their actions. Plasmid mCBP is the E1A protein from which the CBP binding domain has been mutated and in the mRb protein the Rb binding domain has been mutated (Hecht et al., 2000).
PPARγ dominant negative plasmid was a kind gift from Prof. V.K.K. Chattejee, Oxford University, UK. The plasmid contained the complete PPARγ tagged with FLAG in which leu468 was mutated to Ala and Glu471 was mutated to Ala (Adams et al., 1997). The mutant protein retains the ligand and DNA binding activity but has no transactivating activity because of impaired binding to the coactivators like CBP and steroid receptor coactivator-1.
FADD dominant negative vector was a kind gift from Dr. M.L. Schmitz, Heidelberg, Gemany. In this plasmid death effector domain (N terminal 80 amino acids) truncated FADD protein was expressed which even though could bind to the death receptors, could not propagate the signal by its inability to bind to caspase-8 (Hofmann et al., 2001).
PHGPx overexpression vector was a kind gift from Prof. R. Brigelius-Flóhe, Potsdam, Germany. The complete PHGPx gene along with the regulatory 3’UTR was cloned into pcDNA3 (Brigelius-Flóhe et al., 1997).
Other plasmid were constructed in the laboratory by cloning required fragments and all the fragments and the cloning procedure was confirmed by DNA sequencing (SeqLab, Germany).
Peroxisome prolifator response element (PPRE) was PCR amplified and cloned in pGL3 basic vector (Promega) at the Kpn 1 and Hind III sites.
12/15-LOX was amplified from rat cDNA by PCR and cloned into mammalian expression vector pcDNA3 (Invitrogen) at the BamHI and XhoI sites and into pET15b bacterial expression vector (Novagen) at the Nde I and Xho I sites.
|
| [page 30↓] |
Cells were lysed directly on the plates by the addition of protein lysis buffer containing 50 mM Pipes/HCl (pH 6.5), 2 mM EDTA, 0.1% Chaps, 20 µg/ml Leupeptin, 10 µg/ml Pepstatin A,10 µg/ml Aprotinin , 5 mM DTT and 1 mM PMSF (Cell Technologies, USA). The cells were scraped and lysed by freezing and thawing 3 times. The mixture was centrifuged at 10,000xg at 4 0C for 15 minutes to remove the cell debris. Protein concentration was determined using a modified Lowry‘s method ( BioRad, germany).
10% SDS Polyacrylamide gel was prepared according to the following recipe. For the separating gel of 10 ml volume: 4 ml of distilled water, 2.5 of 1.5 M Tris-HCl (pH 8.8), 3.3 ml of 30% Polyacrylamide mix (37.5:1 ratio of mono and bis acrylamide) (Roth, Germany), 100 µl of 10% SDS, 100 µl 10% ammonium persulphate (APS) and 15 µl N,N, N’,N’ tetramethylethylenediamine (TEMED). For 5 ml of stacking gel: 3.4 ml of distilled water, 630 µl of 1 M Tris-HCl (pH 6.8), 830 µl 30% Polyacrylamide mix, 50 µl 10% SDS, 50 µl 10% APS and 5 µl TEMED. The gel was cast in MiniProtean III apparatus (BioRad, Germany). The protein samples were mixed with SDS sample solution (Rotiload, Roth, Germany) and boiled for 5 minutes for complete denaturation. This mixture was loaded onto the gel and electrophoresed Immunoblotting was performed utilising the semi dry transfer method. Nitrocellulose membrane (Schleisser and Schuell, Germany) and 6 layers of Whatman 3 paper were cut exactly to the size of the gel and soaked in transfer buffer along with the gel. A stack was made with 3 sheets on the top and bottom of the gel and membrane and placed in between the graphite plates of the transfer apparatus (Biometra, Germany). Transfer was performed at 0.8 mA/cm2 current for 1 hour. The efficiency of the transfer was confirmed by staining the membrane with a 0.1% solution (containing 1% acetic acid) of Ponceau S (Sigma, Germany). The excess stain was washed with water. After visualisation of the protein, the blot was completely washed off the stain with water and put into blocking solution (5% nonfat milk powder in PBS containing 0.05% Tween 20) for 1 h at room temperature. The blots were then incubated in the blocking solution containing 1:500 – 1:1000 dilution of the primary antibody for 1h at RT. After washing in wash solution (PBS containing 0.05% Tween 20) for 10 minutes, the blot was incubated with the secondary antibody (against the species of the primary antibody and linked to horse radish peroxidase) [page 31↓](1:5000 dilution) for 1 h at RT. After 3 washes of 5 minutes each with wash buffer, the specific bands were developed using Chemiluminiscent system (Santa Cruz, Germany). Equal volumes of solution A and B were mixed and the blot was incubated in this solution for 1 minute. The blot was immediately exposed to an X-Ray film in dark for varying periods of time ranging from 5 sec to 2 min and automatically developed. The specific bands were scanned and quantified densitometrically using TINA version 2.09g. All immunoblots, were sequentially incubated with anti-β-actin as control, and specific signals adjusted in relation to the expression of this house-keeping gene.
Cells were washed with ice cold PBS, scraped and pelleted at 10,000xg, 4 0C. The pellet was resuspended in 400µl of hypotonic buffer (10 mM HEPES, pH 7.9; 1.5 mM MgCl2; 10 mM KCl) and incubated on ice for 15 minutes and simultaneously lysed with the addition of 100µl of 2.5% NP40. Nuclei were pelleted for 1 minute at 2000xg. The nuclear pellet was resuspended in protein lysis buffer (Dignam et al., 1983).
Cells were washed twice with PBS, trypsinised and the cell pellet was collected. The pellet was resuspended in 5 volumes of homogenisation buffer (20 mM HEPES 7.5, 1.5 mM MgCl2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF and 250 mM Sucrose) and homogenised for 5 minutes using a tight fitting dounce homogeniser. The whole procedure was carried out at 4 0C. The effectivity of the procedure was checked by trypan blue exclusion test. Nuclei and cell debris were pelleted at 2,000xg. Mitochondria were pelleted by centrifugation at 10,000xg for 30 minutes at 4 0C. The pellet was resuspended in protein lysis buffer (3.5.1). The supernatant was further centrifuged at 100,000xg for 45 minutes at 4 0C. The supernatant was used as the cytosolic extract. Protein concentration was determined both in the mitochondrial and cytosolic fractions. Equal amounts of protein were used for further experiments.
Immunoprecipitaions were performed by incubating the protein extracts with 2 µg of the primary antibody for 1 hour at 4 0C. The immune complexes were incubated with protein-A agarose (Santa Cruz) for 1 hour at 4 0C. The beads were spun down (2500xg, 2 min, 40C), [page 32↓]washed 3 times with RIPA buffer (1% nonidet P40, 0.5% deoxycholate, and 0.1% SDS in PBS) and the immune complex released by boiling in SDS sample solution and electrophoresed. The proteins were eluted from the beads with elution buffer (1% SDS in 0.1 M NaHCO3) when subsequent immunoprecipitations or reactions were to be performed.
Formaldehyde was added to the cells at a final concentration of 1% and incubated for 20 minutes at room temperature. The reaction was stopped by the addition of glycine to a final concentration of 0.125M. The cells were washed with cold PBS and harvested. The nuclear extract was prepared according to Dignam et al., 1983 and sonicated at maximal power for 30 seconds twice to shear the genomic DNA. Immunoprecipitations were performed with various antibodies. Crosslinking was reversed in the immunoprecipitated complexes by the addition of NaCl to a final concentration of 200 mM and incubation at 65 0C for 6 hours. The DNA was purified by proteinase K treatment (150µg/ml) for 1 h followed by phenol/chloroform extraction and precipitation by ethanol. The presence of specific promoter were detected by PCR with specifc primers. The extract aliquoted prior to the immunoprecipitaions was used to prepare control input genomic DNA, which was also used for PCR analysis. For Western blotting, protein was directly denatured by electrophoresis sample buffer and applied to SDS-PAGE.
Total RNA was prepared using RNAsy kit fom Qiagen, Germany. Cells were washed with PBS 3 times and lysed in 350 µl RNA lysis buffer and sonicated at maximum wattage for 30 seconds. The lysate was mixed with equal volumes of 70 % ethanol and loaded onto the column. The column was spun at maximum speed for 15 seconds at RT. The column was washed with RW1 and PR1 buffer and RNA was eluted in 30 µl Rnase free water by centrifugation and stored at –80 0C.
Reverse transcription was performed using 5 µg of RNA which was denatured at 65 0C for 10 minutes and to which reaction buffer, 1,5 mM MgCl2,1 mM dNTPs, 20 mM DTT, 50 pmoles of (dT)18 primer and 1 µl of AMV reverse transciptase (Roche, Germany) was added. The reaction was performed at 42 0C for 1h. 1/20th of the resultant cDNA was used in the subsequent PCR reaction. PCR was performed with 5 pmoles of forward and reverse primer, [page 33↓]200 µM of each dNTP and 1 U of Taq polymerase. For quantitative PCR, 25 cycles were used and for normal PCR 35 cycles were used. β -actin primers were used to perform control reactions to quantitate the product formed. Genomic PCR was performed using 10 ng of genomic DNA as template. Negative and positive controls were used with each set of PCR reaction. The primers and reaction conditions are listed below.
STAT6 element of 15-LOX-1 gene:
5‘ gtggggtggtggggggtgaaag 3‘
5‘ ctcctcacctctcatcccactgc 3‘
94 0C 3min; 94 0C 30 s, 55 0C 30 s, 72 0C 30 s for 35 cycles; 72 0C for 7 min, 4 0C.
15-LOX-1 promoter (1 kb):
5‘ aagctaattcactctggtggggtgg 3‘
5‘ aagatgtttcgctccttctggagg 3’
94 0C 3min; 94 0C 30 s, 55 0C 30 s, 72 0C 1 min for 35 cycles; 72 0C for 7 min, 4 0C.
Human Peroxisomal Fatty Acyl Coenzyme A Oxidase Gene containing PPRE:
5‘ CggaagcttCGCGACGACCAGCTGGC 3‘
5‘ ggcagatctTACGTTGACGTGAGGTCGG 3‘
94 0C 3min; 94 0C 30 s, 60 0C 30 s, 72 0C 2.5 min for 35 cycles; 72 0C for 7 min, 4 0C.
Rat 12/15 lipoxygenase gene:
5’ cgacatatgtgtctaccgcatccgc 3’
5’ tggctcgagtcagatggccacgctgtt 3’
94 0C 3 min; 94 0C 1 min, 55 0C 1 min, 72 0C 2 min, 35 cycles; 72 0C 7 min; 4 0C.
15-LOX-1 cDNA :
5' GGGGCTGGCCGACCTCGCTATC 3'
5' TCCTGTGCGGGGCAGCTGGAGC 3'
94 0C 3 min; 94 0C 1 min, 72 0C 1 min, 35 cycles; 72 0C 7 min; 4 0C
The PCR mixture was mixed with DNA loading buffer and electrophoresed in 2% agarose gel in 1x TBE at 7 volts/cm of gel. DNA was visualised under UV after staining the gel with 0.5 µg/ml of ethidium bromide.
Double stranded oligonucleotide containing the transcription factor binding element was used as probe in the gel shift assays. The assays were performed with nuclear extracts. The oligonucleotide was made double stranded by heating the mixture of the two strands at 94 0C for 5 minutes and then was allowed to cool down slowly to RT. The probe was labelled with a γ32P ATP (sp. activity 3000 Ci/mmol) using T4 polynucleotide kinase at 37 0C for 30 minutes. Protein was incubated with 30,000 cpm of labelled oligonucleotide in a buffer containing 10 µM Tris pH 7.5; 1 mM EDTA; 100 mM NaCl; 5 % glycerol along with 1 µg of Poly dIdC [page 34↓](Roche, Germany) for 20 minutes at RT in the presence or absence of various competing oligonucleotide sequnces (Schreiber et al., 1989). The reaction mixture was electrophoresed on a 6% PAGE in 1xTBE and visualised by autoradiography.
The cells were washed twice with ice-cold PBS and lysed with 100 µl luciferase lysis buffer (Promega, Germany). The lysis was completed by freezing and thawing 3 times and after centrifugation the supernatant was utilised for assay of luciferase and β -galactosidase. Luciferase assay was performed by vortexing 5 µl of the extract with 50 µl of luciferase assay solution (Promega, germany) and the bioluminescence was measured by scintillation counting.
For quantification of β -galactosidase activity, 50 µl of the extract was incubated at 370C for 10 min, then 100 µl of pre-warmed 4 mg/ml o-nitrophenyl para -D-galactopyranoside (ONPG) in 0.1 M sodium phosphate buffer (pH 7.5) was added. After a suitable time of reaction, 300 µl of 1 M Na2CO3 was added, and the absorbance at 420 nm of the solution was measured with a spectrophotometer. The β -galactosidase activity was expressed as ONPG unit (1 unit: the activity producing 1 mmol o-nitrophenol per minute, normalised against the inoculated cell number). The β -galactosidase activity was determined as the average value from triplicate dishes under the same transfection conditions.
The specified DNA was amplified by PCR. 100 pmoles of this DNA was end labelled with biotin16-dUTP using terminal deoxynucleotide transferase (TdT) enzyme (Pharmacia, Germany). The end labelled DNA was purified by ethanol precipitation and bound to streptavidin-coated magnetic beads (Roche, Germany). 100 µl of the beads were washed 3 times with 100 µl of DNA binding buffer (10 µM Tris pH 7.5; 1 mM EDTA; 100 mM NaCl ) and each time the beads were collected using magnetic particle collector (Dynabeads, Sweden). The biotin labelled DNA was mixed with the bead with at least 2 volumes of DNA [page 35↓]binding buffer. The mixture was kept at 4 OC with vigorous shaking for 10 minutes. The magnetic particles were collected and washed 3 times with DNA wash buffer (10 µM Tris pH 7.5; 1 mM EDTA; 1 M NaCl). The beads were further washed 3 times with 100 µl of protein binding buffer (10 µM Tris pH 7.5; 1 mM EDTA; 100 mM NaCl; 5 % glycerol). The beads were incubated with 100 µg of protein in protein binding buffer containing 10 µg of Poly dIdC. The incubation was performed under continuous shaking at 4 0C for 1h. The beads were once again collected and washed 3 times with protein binding buffer. The specifically bound proteins were eluted using protein binding buffer containing 2 M NaCl. The solution was desalted by overnight dialysis against PBS at 4 0C and electrophoresed on SDS-PAGE.
Filter binding assays were performed as described (Ogryzko et al., 1996) with minor modifications. 3.3 mg/ml of histones (Sigma) were acetylated in a reaction buffer containing 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 % glycerol, 1mM PMSF. (3H) acetyl CoA (Amersham, UK) and 6 µg of protein extract for 30-60 minutes at 30 0C. The reaction mixture was spotted onto P81 phosphocellulose paper (Upstate Biotechnology, USA) and washed for 30 minutes with 0.2 M carbonate buffer (pH 9.2). The filter paper was dried and used for liquid scintillation counting. Similar experiments were performed using non-radioactive acetyl-CoA.. The reaction mixture was denatured and loaded onto a SDS PAGE. The Western blot was probed with anti-acetylhistone H3 antibodies and developed using Chemiluminiscent detection system.
Cell Death Detection ELISA kit (Roche Biochemicals, Germany) was also used to quantify the apoptosis in cells. The cells were lysed by a hypotonic solution and the cytoplasmic extract was incubated with anti-histone and anti-DNA antibodies. The complexes bound to the ELISA plate were quantified using horse raddish peroxidase enzyme and DTNB reagent. 104 cells were plated on 96-well plates in DMEM medium. Effectors or inhibitors of apoptosis were added, and apoptotic cell death was determined after 72 hours with above mentioned ELISA kit.
For the annexin-V assay, cells grown on glass coverslips were washed with PBS and incubated for 15 minutes at room temperature with a solution of annexin-V fluos and propidium iodide (Roche Biochemicals, Germany). Cells were then washed twice with PBS and observed under a fluorescence microscope. Normal cells do not get stained at all, while [page 36↓]apoptotic cells are stained green (annexin-V fluos) and necrotic cells red (propidium iodide). Fluorescence microscopy was performed with a BX-40 Olympus microscope witha mercury lamp, appropriate filter set and automatic photomicrography attachment. A minimum of 200 cells were counted.
TUNEL assay was performed by washing paraformaldehyde-fixed (4% paraformaldehyde in PBS for 30 minutes at RT) cells on coverslip 3 times with PBS and then permeabilized using 0.5% saponin at room temperature for 30 min. After washing with TdT buffer cells were incubated with 0.5 µM biotin dUTP, 150 U /ml TdT in 30 µl TdT buffer (Roche Biochemicals, Germany) in a humidified chamber at 37 0C for 30 minutes. After washing twice with PBS, the cells were incubated with 1:1000 solution in PBS of streptavidin-conjugated horse radish peroxidase (GIBCO, Germany) for 10 minutes at room temperature. Coverslips were then washed for 30 minutes with 3 washes of PBS. The colour was developed with True Blue (KPL Labs, Germany) peroxidase substrate, and coverslips were observed under a light microscope. Apoptotic cells were stained blue.
Caspase-3 assay was performed using Ac-DEVD-pNA as substrate. Cells were lysed with lysis buffer (50 mM HEPES, pH7.4, 100 mM NaCl, 0.1 % CHAPS, 1 mM DTT, 100 µM EDTA) and centrifuged at 10,000xg for 10 min. 100 µg of protein were incubated with 200 µM solution of Ac-DEVD-pNA (Calbiochem, Germany) in reaction buffer (lysis buffer with 10 mM DTT and 10% glycerol) at 37 0C. The development of yellow colour at 405 nm indicated caspase-3 activity. The reaction was monitored periodically for 3-4 hours. The rate of reaction was calculated as difference in the absorbance at 405 nm per unit time. The results were represented as fold increase in caspase-3 activity over the control reactions. Z-VAD-FMK (Calbiochem, Germany) was used as inhibitor of caspase-3 at a concentration of 100 µM an hour prior to standard treatment.
Labelled fatty acids as ligands to PPARγ were detected by immunoprecipitating the PPARγ in pre-treated cells and then detecting the fatty acid attached to it by radio-TLC. Cells (1x 106) were incubated with 0.25 µCi of [14C]-arachidonic acid [sp. act. 55 mCi/mmol] (Amersham, Germany) for 24 hours. After the incorporation of the radioactive arachidonic acid (AA), cells [page 37↓]were washed and treated according to experimental set-up. Cell lysate was prepared and immunoprecipitated with anti-PPARγ antibody in 1 ml RIPA buffer for 1 hour at 4 0C. The immune complexes were allowed to bind to protein A agarose (Santa Cruz) for 1 hour. The beads were spun down, washed 3 times with RIPA buffer and resuspended in 200 µl of PBS. This solution was acidified with HCl to pH 3.5 and lipids were extracted 3 times with ethyl acetate. After drying under nitrogen stream the sample was reconstituted in ethyl acetate and loaded onto a Silica TLC plate (Merck, Germany) and developed with hexane:ether:acetic acid (50: 50 : 0.1 v/v) as solvent system. For quantitation, the TLC plate was scanned on radio-TLC scanner (Berthold Instruments, Germany). AA, 5-, 12- and 15-HETEs and various prostaglandins were run on the side as standards.
Purified proteins or cell extracts in PBS were incubated with arachidonic acid (100µM) the reaction was allowed to proceed at 37 0C for 20 minutes. Reduction of hydroperoxy fatty acids to their corresponding hydroxy derivatives was achieved by the addition of a molar excess of sodium borohydride. The reaction mixture was acidified to pH 3.5 and lipids were extracted with an equal volume of ethyl acetate. Straight phase HPLC analysis was performed on a Supelco-SIL column (250 x 4.6 mm, 5 µm) using n-hexane: 2-propanol: acetic acid (100:2:0.1, by vol.) as mobile phase at a flow rate of 1 ml/min. reverse phase HPLC was performed on a Novapak C18 reverse phase column and 80 : 20, acteonitrile : water as the running buffer. Conjugated dienes were detected and quantified at 235 nm using a diode array detector (Shimadzu).
The hepoxilin synthase A3 activity was measured by incubating the purified protein or cell lysate with 20 µM 12(S)-HpETE in a volume of 200 µl for 30 minutes at 37 OC and measuring the formation of hepoxilins using GC-MS or HPLC. The reaction was stopped by acidification with 1N HCl to pH 3.0 The reaction mixture was allowed to incubate at room temperature in acidic conditions for 15 minutes before extracting the lipids twice with 3 volumes of ethyl acetate. The lipid fractions were extracted with ethyl acetate, evaporated to dryness under nitrogen, reconstituted in n-Hexane and analysed with GC-MS.
|
| [page 38↓] |
The lipids were converted to their methyl esters by the addition of 300 µl ethereal diazomethane for 5 min. Thereafter the samples were evaporated to dryness, 30µl N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA) were added and the mixture was derivatised by heating at 60oC for 30 min. Gas chromatography-mass spectrometry (GC-MS) was performed by means of a Varian Saturn 4D GC-MS-MS system equipped with a Supelco DB5-MS column (30 m x 0.25 mm; 0.25 µM df). The temperature program was started at 150oC increasing to 250oC within 10 min with a rate of 10oC/min. The temp. of injector and transfer line were 230oC and 220oC respectively.
Protein was incubated with 100 µM AA at 37OC for 30 minutes. The reaction was stopped and the lipids were extracted by the addition of ether-methanol-1M citrate (135:15:1, v/v). The organic phase was evaporated and the residue was taken into 100 µl ethyl acetate and derivatised by the addition of 9-Anthryldiazomethane (100 µg/reaction) (Reynaud et al., 1994). The reaction mixture was stirred at room temperature for one hour. The ethyl acetate was then evaporated, the residue was reconstituted in the solvent system and the lipids were loaded onto a Novapk C18 (250 x 46 mm; 5 µm particle size) reverse phase column. Acetonitrile-methanol-water (90:6:4 v/v) was used as mobile phase. The eluate was uv-monitored using a Shimadzu diode-array detector set at 254 nm and fluorescence-monitored (excitation 254 nm, emission 400nm) using a Shimadzu fluorescence detector.
Total RNA was extracted from Rinm5F cells using RNeasy kit and reverse transcribed using AMV reverse transcriptase enzyme. The reaction was performed at 42 0C for 45 minutes using a dT18 primer. Complete 12/15-LOX gene was amplified with Pfu Polymerase and 200 µM dNTPs using primers as mentioned above. A small aliquot of the reaction was used for instant PCR cloning using TOPO TA cloning kit. The ligation was performed for 5 minutes and then E. coli DH5a was transformed with 2 µl of the ligation reaction using heat shock. The mixture was plated onto LB ampicillin plates and the white colonies were grown in 3 ml LB (80 µg/ml ampicillin), plasmid prepared and were screened for the presence of the insert using restriction enzymes. The positive clones were sequenced from both directions using M13 forward and reverse primers and automated fluorescent sequencing. The entire sequence [page 39↓]was compared with the published rat 12/15-LOX sequence (Accession number. NM_031010) using the Blast server (www.ncbi.nlm.nih.gov/Blast).
The 12/15-LOX gene insert was cloned into the Nde I and Xho I sites in PET 15b vector (Novagen). The positive colonies were screened and purified. For overexpression experiments, E. coli BL21 DE3 cells were transformed with the plasmid. A 3 ml overnight culture was established from a single colony. Next morning, a 10 ml culture was cultivated in LB (80µg/ml ampicillin and 37 µg/ml chloramphenicol). The cells were grown till O.D. 0.6 and then the recombinant protein production was induced by the addition of 1 µM IPTG for 3 h at 37 0C. The bacteria was pelleted by centrifugation and resuspended in PBS. Lysis was performed by sonication. The lysate was used for all further experiments.
All experiments were repeated at least three times and the representative pictures have been shown. The data were presented as mean ± SD. Statistical comparisons between groups were made using Student’s t test for paired observations. Significance was achieved at the p<0.05 level. All calculations were performed at www. graphpad.com.
| © Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme. | ||
| DiML DTD Version 3.0 | Zertifizierter Dokumentenserver der Humboldt-Universität zu Berlin | HTML generated: 05.02.2004 |