3 MATERIALS

↓26

3.1  Biological Material

3.1.1  Host Strains (Escherichia coli & Genotype)

XL1-Blue from Stratagene

recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac F’ proAB lacI ZΔM15 Tn10

↓27

XL1-Blue Supercompetent cells

recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F’ proAB lacI Z M15 Tn10 (Tet )]

3.1.2  Cell lines

CV-1 cell line

↓28

COS-7 cell line

3.1.3  Vaccinia virus

Vaccinia virusstrain vTF7-3

3.1.4  Vector DNA

pTM1 vector DNA (Ampr) containing Hemagglutinin (HA) gene (pTM1-HA)– as a gift from Dr. Judith White (Department of Cell Biology, University of Virginia Health System, Charlottesville, VA, USA)

3.1.5  Antibodies

↓29

N2 antibody – as a generous gift from Dr. Judith White

C-HA1 antibody - as a generous gift from Dr. Judith White

FHA2 antibody - as a generous gift from Dr. Leonid Chernomordik (Unit of Lipid Inermediates in Fusion. National Institutes of Health, LCMB, NICHD, Bethesda, MD. USA).

3.2 Oligonucleotides

↓30

The following were the oligonucleotides synthesized for mutations and further cloning of the synthesised mutants into pTM1-HA vector DNA. All were synthesised by Invitek GmbH, Berlin, Germany.

R109G1 (32mer) (BamHI site generated)

5‘ATTATGCCTCCCTTGGATCCCTAGTTGCCTCG 3‘

↓31

R109G2 (33mer)

5‘ACGAGGCAACTAGGGATCCAAGGGAGGCATAAT 3‘

R109E1 (30 mer) (xhoI site generated)

↓32

5‘ATTATGCCTCCCTCGAGTCACTAGTTGCCT 3‘

R109E2 (32 mer)

5‘GCAACTAGTGACTCGAGGGAGGCATAATCTGG 3’

↓33

R269G1 (29 mer) (BamHI site generated)

5‘ AGCTCAATAATGGGATCCGATGCACCTAT 3‘

R269G2 (30 mer)

↓34

5‘ ATAGGTGCATCGGATCCCATTATTGAGCTT 3‘

R269E1 (28 mer)

5‘ AGCTCAATAATGGAATCAGATGCACCTA 3‘

↓35

R269E2 (28 mer)

5‘ AGGTGCATCTGATTCCATTATTGAGCTT 3‘

K299G1 (34 mer) (alwI site generated)

↓36

5‘ CAAAACGTAAACGGGATCACTTATGGAGCATGCC 3‘

K299G2 (35 mer)

5‘ GCATGCTCCATAAGTGATCCCGTTTACGTTTTGAA 3‘

↓37

K299E1 (34 mer) (Nde I site abolished)

5‘ CAAAACGTAAACGAGATCACTTATGGAGCATGCC 3‘

K299E2 (35 mer)

↓38

5‘ GCATGCTCCATAAGTGATCTCGTTTACGTTTTGAA 3’

S110D1 (27 mer) (Bgl II site generated)

5'GCCTCCCTTAGAGATCTAGTTGCCTCG 3'

↓39

S110D2 (27 mer)

5'CGAGGCAACTAGATCTCTAAGGGAGGC 3'

I89E1 (24 mer)

↓40

5'AGACACTAAAGAAGATCTCTGGTC 3'

I89E2 (24 mer)

5'GACCAGAGATCTTCTTTAGTGTCT 3'

↓41

I89R1 (26 mer)

5'GAAGACACTAAAAGAGATCTCTGGTC 3'

I89R2 (26mer)

↓42

5'GACCAGAGATCTCTTTTAGTGTCTTC 3'

Y308R1 (27 mer)

5'GCATGCCCCAAGAGAGTTAAGCAAAAC 3'

↓43

Y308R2 (27mer)

5'GTTTTGCTTAACTCTCTTGGGGCATGC 3'

T212E-N216R1 (40mer) (Avr II site generated)

↓44

5’AGAAGCCAGCAAGAAATAATCCCTAGGATCGGGTCCAGAC 3’

T212E-N216R2 (40mer)

5’GTCTGGACCCGATCCTAGGGATTATTTCTTGCTGGCTTCT 3’

↓45

N216E1 (26mer)

5’AGAAGCCAGCAAGAAATAATCCCTGAAATAGGGTCCAGAC 3’

N216E2 (26mer)

↓46

5’GTCTGGACCCTATTTCAGGGATTATT 3’

3.3 Chemicals and Film material

Acrylamide, bis-acrylamide, sucrose, Tris, HCl, sodium chloride, sodium hydroxide, cetyltrimethylammonium bromide (CTAB), glycerol, parafilm, powder-free gloves, potassium chloride, ethylenediaminetetraaceticacid (EDTA) (Carl Roth GmbH, Karlsruhe, Germany).

Agarose (Hybaid GmbH, Heidelberg, Germany).

↓47

Calcein-AM (acetoxymethylester of calcein, used 50 mM in DMSO); R18 (octadecylrho-damin B chloride, used 2 mM in ethanol;

calcein(MW 623, excitation at 495 nm, emission at 520 nm), excitation at 560 nm, emission at 590 nm), dextran-conjugated tetramethylrhodamine, neutral (TMR-D, MW 10,000; excitation at 555 nm, emission at 580 nm) (Molecular Probes, Göttingen, Germany).

Cell culture flasks, cell culture dishes (Greiner Bio-one GmbH, Frickenhausen, Germany).

↓48

Dimethylsulphoxide (DMSO), isopropanol, bovine serum albumin (BSA), ammonim per sulphate (APS), ammonium chloride, Tween 20, citric acid, salicylic acid, TPCK trypsin (type XIII from bovine pancreas, TPCK treated), trypsin inhibitor, fixer and developer for X-ray film development, N,N,N’,N’-tetramethylethylenediamine (TEMED), 3-3’-dithiobissuccinymidylpropionate (DSP; cross-linking reagent), phenyl- methylsulonylflouride (PMSF; protease inhibitor) (Sigma Chemicals).

DMEM (with L-methionine, L-Glutamine and Glucose), Lipofectin reagent, bacto-agar, peptone, 2YT medium (Invitrogen GmbH, Karlsruhe, Germany).

DMEM (with L-methionine, L-Glutamine and Glucose), Trypsin-EDTA solution (0.05%/0.02% in PBS) (Cambrex Bio Science Verviers, Belgium).

↓49

Ethanol, acetic acid (Merck, Darmstadt, Germany).

Ethidium bromide, Triton X-100 (Boehringer Mannheim, Mannheim, Germany).

Foetal bovine serum (FBS), PBS++ (PBS with Ca++ and Mg++). (Biochrom KG, Berlin, Germany).

↓50

Hepes, L-glutamine, bromophenol blue (Serva, Heidelberg, Germany).

Oligonucleotides (Invitek GmbH, Berlin, Germany).

Pre stained protein standard markers for SDS-gel electrophoresis (Peqlab).

↓51

Qiagen plasmid maxi-kit along with buffers for plasmid DNA extraction (Qiagen GmbH, Hilden, Germany).

QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA).

Restriction enzymes and buffers, Rnase A1, lysozyme, lambda maker for DNA analysis on ge electrophoresis (New England Biolabs, Schwalbach/Taunus, Germany).

↓52

Sodiumdodecylsulphate (SDS) (Biomol Feinchemikalien GmbH, Hamburg, Germany).

X-ray films (Kodak, England).

3.4 Equipments

Avanti J25 High performance centrifuge (rotors: JA-25.50, JLA-16.250), Ultra centrifuge L7 65 (rotor Ti 45), FACS machine (Beckmann Coulter).

↓53

Vertical gel electrophoresis tank and power pack, ScanPack 2.0 software for densitometry (Biometra GmbH, Göttingen, Germany).

Agarose mini-gel electrophoresis tank (Blomed Analytik GmbH, Göttingen, Germany).

Thermomixer, pipette tips, pipette man (Eppendorf).

↓54

CO2 incubator (Forma Scientific, Life sciences GmbH, Frankfurt a.M, Germany).

Gilson micro-pipettes (Gilson medical electronics, France).

Inverted microscope (Helmut hund GmbH, Wetzlar, Germany).

↓55

Lamin Air (Heraeus Industries GmbH, Berlin, Germany).

Wterbath (Lauda DR. R. Wobser GmbH & Co, Lauda-koenigshofen, Germany).

PCR thermalcycler (Perkin Elmer, Vaterstetten, Germany).

↓56

Mcro pipettes (SC-pette Nichiryo, Sued-Labordedarf GmbH, Gauting, Germany).

Vortexer (Scientific Industries, NY, USA).

Toshiba Microwave (TÜV Rheinland Koeln, Germany).

↓57

Gel dryer (UniEquip Laborgeraetebau + vertriebs GmbH, Martinsried, Germany).

3.5 Glass and Plastic ware

Micropipettes, Eppendorf tubes, Glass flasks, Glass pipettes, Glass spreader, Petriplates, Tubes.

3.6 Solutions and Media

2YT medium: Bacto Trypton 16 g, Yeast extract 5 g, NaCl 5 g, distilled water made upto 1000 ml. The solution pH is adjusted to 7.2 with 1N NaOH. The solution is sterilized by autoclaving.

↓58

Ampicillin: solution of 50 mg/ml in dist.water and filter sterilized.

Fusion buffer: 10 mM MES, 100 mM NaCl, 10 mM HEPES, 2 mg/ml glucose. The fusion buffer is adjusted to desired pH with 2 M NaOH.

Lysis buffer (for trimer assay with DSP): 50 mM NaOH, 150 mM NaCl, 1 % NP 40, 5 mM Iodoacetamide, 1 mM PMSF.

↓59

Lysis buffer: 100 mM Tris pH 7.4, 1 % NP-40.

RIPA buffer: 1 % Triton X-100, 1 % deoxycholate, 0.1 % SDS, 0.15 M NaCl, 20 mM Tris, 10 mM EDTA, 10 mM iodoacetamide, 1 mM PMSF.

SDS-PAGE reagents

↓60

10X PAGE buffer : 30 g Tris-base, 110 g Glycin, 10 g SDS in 1 liter dist.water.

Tris pH 8.8 (1.5 M): 181.71 g of Tris-base in 1 liter of dist.water and pH is adjusted to 8.8 with 2M NaOH and stored at 4°c.

Tris pH 6.8 (0.5 M) : 60.57 g of Tris-base in 1 liter of dist.water and pH adjusted to 6.8 stored at – 4°c.

↓61

6 X SDS-PAGE loading buffer: 15 % DTT, 15 % SDS, 1.5 % Bromophenol blue, 50 % glycerol.

Fixing solution for PAGE gels: 10 % acetic acid, 40 % methanol.

Solutions for DNA extraction

↓62

Resuspension buffer: 50 mM Tris-Cl, pH 8.0; 10 mM EDTA; 100 µg/ml RNase A.

Lysis buffer: 200 mM NaOH; 1 % SDS.

Neutralisation buffer: 3.0 M potassium acetate, pH 5.5.

↓63

Equilibration buffer: 750 mM NaCl; 50 mM MOPS, pH 7.0; 15 % isoproponal; 0.15 % Triton X-100.

Wash buffer: 1 M NaCl; 50 mM MOPS, pH 7.0; 15 % isoproponal.

TE: 10 mM Tris-Cl, pH 8.0; 1 mM EDTA.

↓64

STET buffer: 8 % sucrose, 0.1 % Triton X-100, 50 mM EDTA, 50 mM Tris/HCl pH8.0.

TAE buffer: 1 mM EDTA, 200 mM acetic acid, 40 mM Tris.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
14.09.2006