2 Materialien und Methoden

↓14

2.1  Materialien

2.1.1  Chemikalien

Chemikalien

Hersteller

PD98059

Alexis, 385-023-M10

LY294002

Alexis, 270-038-M005

Nogalamycin

Calbiochem, 488200

5-Aza-2´-Desoxycytidine

Sigma, A 3656

Trichostatin A

Sigma, T 8552

Cycloheximid

Calbiochem, 239764

IFN-γ Maus

PeproTech, C-31505-H

IFN-γ Mensch

R&D Systems, #285-IF

TNF-α Maus

R&D Systems, #410-MT

TNF-α Mensch

R&D Systems, #210-TA

pCPT-cAMP

Sigma, C 3912

2.1.2 Kits

Name

Anwendung

Firma

RNeasy Mini

RNA Isolierung

Qiagen

QIAprep Spin Miniprep

DNA Isolierung

Qiagen

QiaExII

DNA Isolierung aus Agarosegel

Qiagen

Fast-Link™ DNA Ligation and Screening

Ligation

Epicentre Technologies

Nick Translation

5`-Markierung von Oligonukleotiden

Amersham Pharmacia Biotech

Fugene™ Transfection Reagent

Transfektion

Boehringer Mannheim

SequiTherm EXCEL™ II DNA Sequencing

Sequenzierung

Epicentre Technologies

GPS™-1 Genome Priming System

Sequenzierung

New England Biolabs

QuikChange® Site-Directed Mutagenesis

Zielgerichtete Mutagenese

Stratagene

Dual-Luciferase® Reporter Assay System

Reporter Assay

Promega

Great Escape™ SEAP Reporter System

Reporter Assay

Clontech

2.1.3 Geräte

↓15

Geräte

Hersteller

Szintillationszähler

Wallac; Wallac 1409

Luminometer

Berthold Technologies; Lumat LB 9507

2.1.4 Enzyme

Name

Funktion

Firma

KpnI

Restriktionsenzym

Promega

SmaI

Restriktionsenzym

Promega

PvuI

Restriktionsenzym

Promega

PstI

Restriktionsenzym

Promega

EcoRI

Restriktionsenzym

Promega

SmaI

Restriktionsenzym

Promega

XhoI

Restriktionsenzym

Promega

HindIII

Restriktionsenzym

Promega

NotI

Restriktionsenzym

Promega

BamHI

Restriktionsenzym

Promega

T4 DNA Ligase

T4 DNA Ligase

New England Biolabs

T4 Polynucleotid Kinase

T4 Polynukleotid Kinase

New England Biolabs

Deep Vent™ (exo-) DNA Polymerase

Polymerase

New England Biolabs

Vent™ DNA Polymerase

Polymerase

New England Biolabs

Taq Gold

Polymerase

Boehringer Mannheim

Superscript™ II RNase H-

Reverse Transkriptase

Life Technologies

HK™ Thermolabile Phosphatase

Phosphatase

Epicentre Technologies

SssI Methylase

Methylase

New England Biolabs

2.1.5 Zelllinien

↓16

Zelllinie

Medium

Typ

Referenz

OVCAR-3

D 10

humane Ovarialkarzinomzelllinie

American Type Culture Collection (ATCC), USA

SKOV-3

D 10

humane Ovarialkarzinomzelllinie

American Type Culture Collection (ATCC), USA

A27/80

D 10

humane Ovarialkarzinomzelllinie

European Cell Culture Collection (ECACC), UK

HOSE

D 10

humane Ovarial-Oberflächenepithelzelllinie

Tsao et al., 1995

RCC26 endo

D 10

Nierenkarzinomzelllinie

Jung et al., 1998

RCC26 exo

D 10 + G418 (700 μg/ml)

Derivat von RCC 26 endo erzeugt durch stabile Überexpression von INF-γ

Jung et al., 1998

OAW42

D 10

humane Ovarialkarzinomzelllinie

American Type Culture Collection (ATCC), USA

PA-1

D 10

humane Teratokarzinomzelllinie

Zeuthen et al., 1980

NIH3T3

D 10

Maus Fibroblastenzelllinie

Todaro und Green, 1969

KA-1

D10 + G418 (70µg/ml)

Hygromycin (14 µg/ml)

Derivat von NIH3T3 erzeugt durch stabile Überexpression von humanem Östrogen/IRF-1 Fusionsplasmid

Kirchhoff und Hauser, 1999

Rose199

D 10 + G 418

Ratten Ovarial-Oberflächenepithelzelllinie

Adams und Auersperg, 1985

Rose199 A2/5

D 10 + G 418

Derivat von ROSE199 erzeugt durch stabile Überexpression von KRAS (V12)

Tchernitsa et al., 2004

2.1.6 Bakterienstämme (Escherichia coli)

Name

Genotyp

Firma

XL1-Blue

recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F'proAB lacIqZDM15 Tn10 (Tetr)]

Stratagene

XL2-Blue

recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F´ proAB laclq ZΔM15 Tn10 (Tetr) Amy Camr]

Stratagene

SURE 2

e14-(McrA-) Δ(mcrCB-hsdSMR-mrr)171 endA1 supE44 thi-1 gyrA96 relA1 lac recB recJ sbcC umuC::Tn5 (Kanr) uvrC [F´proAB laclqZΔM15 Tn10(Tet´) Amy Camr]

Stratagene

2.1.7  Antikörper für den Gel Retardations-Assay

↓17

Name

Hersteller

Nummer

Spezifität für Spezies

Spezifität für Proteine

eingesetzte Verdünnung

cRel (C)

Santa Cruz

sc-71

Maus, Ratte

cRel (p75)

1:30

NFκB p65 (A)

Santa Cruz

sc-109

Mensch, Maus, Ratte

NFκB (p65)

1:30

cRel (N)

Santa Cruz

sc-70

Mensch, Maus, Ratte

cRel (p75)

1:30

NFκB p65

Cell Signalling

3032

Mensch, Maus, Ratte

p65, p50

1:30

NFκB p52

Upstate

05-361

Mensch

p52

1:30

NFκB p50

Upstate

06-886

Mensch, Maus

p50

1:30

RelB (C-19)

Santa Cruz

sc-226

Mensch, Maus, Ratte

RelB (p68)

1:30

cRel (N-466)

Santa Cruz

sc 272X

Mensch, Maus, Ratte

cRel (p75), NFκB (p65)

1:30

CREB-1 (C-21)

Santa Cruz

sc-186X

Mensch, Maus, Ratte

CREB-1 (p43), ATF-1, CREM-1

1:30

ATF-2 (N-96)

Santa Cruz

sc-6233X

Mensch, Maus, Ratte

ATF-2

1:30

ATF-3 (C-19)

Santa Cruz

sc-188X

Mensch, Maus, Ratte

ATF-3

1:30

2.1.8 Membranen

Name

Experiment

Hersteller

Hybond-N

Northern Blot

Amersham Biosciences

Hybond-N+

Northern Blot

Amersham Biosciences

Nytran N

Southern Blot

Schleicher & Schuell Biosciences

2.1.9  Oligonukleotide

2.1.9.1  Primer für die Sequenzierung

↓18

Name

Sequenz

TM

M13 fwd

CAG GAA ACA GCT ATG AC

57°C

M13 rev

GTA AAA CGA CGG CCA GT

57 °C

T3 fwd

AAT TAA CCC TCA CTA AAG GG

54 °C

T7 rev

GTA ATA CGA CTC ACT ATA GGG C

60 °C

SEAP fwd seq

CTA GCA AAA TAG GCT GTC CC

58 °C

SEAP rev seq

CCT CGG CTG CCT CGC GGT TCC

71 °C

pGL3 fwd seq

CTA GCA AAA TAG GCT GTC C

55 °C

pGL3 rev seq

CTT TAT GTT TTT GGC GTC TTC CA

59 °C

GPS-1 N

ACT TTA TTG TCA TAG TTT AGA TCT ATT TTG

57 °C

GPS-1 S

ATA ATC CTT AAA AAC TCC ATT TCC ACC CCT

63 °C

2.1.9.2 Primer zur Synthese der Fragmente der SEAP Konstrukte

Name

Kürzel

Orientierung

Sequenz

kursiv: Restriktionsschnittstelle (RS)

normal: Primersequenz

T M in °C: mit RS/ ohne RS

Prom H-Rev fwd Kpn1

A

5´-3´

GGGGTACCCC GAG ACT GAG TTT CGC TTT G

66 / 49

Prom H-Rev fwd2 Kpn1

B

5´-3´

GGGGTACCCC ACA GGC TAG AGT GCA GTG

67 / 50

Prom H-Rev fwd3 Kpn1

C

5´-3´

GGGGTACCCC TCA TCG TGT TAG CCA GCA TG

67 / 52

Prom H-Rev fwd4 Kpn1

D

5´-3´

GGGGTACCCC AGA GGT CGA GTG TGT GC

67 / 49

Prom H-Rev rev EcoRI

2

3´-5´

CGGAATTCCG TGG ACC GGG TCT AAT GG

64 / 49

H-Rev107 5` rev EcoRI

4

3´-5´

CGGAATTCCG ACC CTC AAG GCC AGG CTC

67 / 55

2.1.9.3  Primer zur Synthese der Fragmente der pGL3 Konstrukte

Name

Kürzel

Orientierung

Sequenz

kursiv: Restriktionsschnittstelle (RS)

normal: Primersequenz

T M in °C: mit RS/ ohne RS

Prom H-Rev fwd Kpn1

A

5´-3´

GGGGTACCCC GAG ACT GAG TTT CGC TTT G

66 / 49

Prom H-Rev fwd2 Kpn1

B

5´-3´

GGGGTACCCC ACA GGC TAG AGT GCA GTG

67 / 50

Prom H-Rev fwd3 Kpn1

C

5´-3´

GGGGTACCCC TCA TCG TGT TAG CCA GCA TG

67 / 52

Prom H-Rev fwd4 Kpn1

D

5´-3´

GGGGTACCCC AGA GGT CGA GTG TGT GC

67 / 49

Prom H-Rev fwd5 Kpn1

E

5´-3´

GGGGTACCCC TCT GCG AGG CTC TCA TTA G

67 / 51

Prom H-Rev fwd6 Kpn1

F

5´-3´

GGGGGTACCCC ACC CGG TCC AAT TGC TG

69 / 49

Prom H-Rev rev Sma1

2

3´-5´

TCCCCCGGGGGA TGG ACC GGG TCT AAT GG

72 / 51

Prom+STAT1 rev Sma1

3

3´- 5´

TCCCCCGGGGGA AGA AGC ATC CCA GGC AC

70 / 49

2.1.9.4 Primer für die Sondenherstellung

↓19

humane H-REV107-1 Sonde (Northern- und Southern Blot Hybridisierungsassay)

Name

Sequenz

TM

hu107-D

GCC TCC GAG ACC GAG AGT GG

65.5°C

hu107-E

CAT CTT CCT CGC GGT GTG GAC CC

68°C

Ratten H-rev107-1 Sonde (Northern Blot Hybridisierungsassay)

↓20

Name

Sequenz

TM

R107-K

GAA GTT GAG CCT CAC ATA TCC TG

63°C

R107-D

TCG CCA CCT TGA CGG TAT CT

62°C

humane und Ratten IRF-1 Sonde (Northern Blot Hybridisierungsassay)

Name

Sequenz

TM

hu IRF-1 fwd

CTG GGA CAT CAA GGA TG

57°C

hu IRF-1 rev

GTA GCT GCT GTG GTC ATC AG

59.5°C

↓21

Primer Extension Assay

Name

Sequenz

TM

HRev107 PrimExt 2

GAA CAA CCA CCT CGC TCC CTT TAA CAA CTT TCT CG

71°C

HRev 107 seqrev 2

GAA CAA CCA CCT CGC TCC CTT TAA C

64°C

2.1.9.5 Primer für die zielgerichtete Mutagenese

Transkriptions
faktorbindungsstelle

Primer

T M

IRF-1/IRF-2/

ISRE

Fwd: CATATATATATTTTGAGACTGAGGTTCGCTGTGTTGCACAGGCTAG

Rev: CTAGCCTGTGCAACACAGCGAACCTCAGTCTCAAAATATATATATG

79 °C

AP-4 + AP-1

Fwd: catcgtgttagcaagcatggtctcgatctcttaacctcgtgatctg

Rev: CAGATCACGAGGTTAAGAGATCGAGACCATGCTTGCTAACACGATG

72 °C

GC-Box

Fwd: CATTAGCCGGCGGCGCGGCGACGAGCCGGGTGACCTCACGC

Rev: GCGTGAGGTCACCCGGCTCGTCGCCGCGCCGCCGGCTAATG

89 °C

CREB-1

Fwd: GAGGGGCCGGGTGCCCGCACGCCGGCCCGCCAC

Rev: GTGGCGGGCCGGCGTGCGGGCACCCGGCCCCTC

89 °C

CCAAT-Box #1.

Fwd: GCCCGCCACCGCGGCTATTAGACCCGGTC

Rev: GACCGGGTCTAATAGCCGCGGTGGCGGGC

84 °C

CCAAT-Box #2.

Fwd: CATTAGACCCGGTCTAATTGCTGGGGCTGC

Rev: GCAGCCCCAGCAATTAGACCGGGTCTAATG

79 °C

cRel-Box #1

Fwd: GCGAAGTGGGTGGATCTGGTCTTCATGGAAGGTGCGATAAG

Rev: CTTATCGCACCTTCCATGAAGACCAGATCCACCCACTTCGC

82 °C

cRel-Box #2

Fwd: GTCTTCCTGGAAGGTGAGATAAGGCCGGGCGAG

Rev: CTCGCCCGGCCTTATCTCACCTTCCAGGAAGAC

83 °C

STAT

Fwd: GTGGGTGGATCGGGTCTGCCTGGCAGGTGCGATAAG

Rev: CTTATCGCACCTGCCAGGCAGACCCGATCCACCCAC

83.5 °C

↓22

Die unterstrichenen Basen zeigen die eingeführten Mutationen.

2.1.9.6  Oligonukleotide für EMSA Experimente

Name

Sequenz

Quelle

CREB (HREV1071)

GAG GGG CCG GGT GAC CTC ACG CCG GCC CGC CAC

aus der H REV107 1 Promotersequenz

CREB mutiert (H-REV107-1)

GAG GGG CCG GGT GCC CGC ACG CCG GCC CGC CAC

aus der H REV107 1 Promotersequenz

CREB Literatur

AGA GAT TGC CTG ACG TCA GAG AGC TAG

Konsensus CRE Sequenz Zhang et al., 2004

cRel (HREV1071)

GTG GAT CGG GTC TTC CTG GAA GGT GCG ATA AG

aus der H REV107 1 Promotersequenz

cRel mutiert (H-REV107-1)

GTG GAT CTG GTC TTC ATG GAA GGT GCG ATA AG

aus der H REV107 1 Promotersequenz

NFκB Literatur

GAT GAC ACC TGG GGA ATT CCC ACA CGG AGC AGG

aus dem Toll-like receptor 2 Promoter; Wang et al., 2001

STATα Literatur

TAC TTT CAG TTT CAT ATT ACT CTA

Konsensus STATα Sequenz De Saint et al., 2000

STAT1 / STAT3 Literatur

CGT CGA CAT TTC CCG TAA ATC A

aus dem c-fos Promoter
Ward et al., 1999

STAT1 / STAT 5 Literatur

AGA TTT CTA GGA ATT CAA TCC

aus dem -casein Promoter; Ward et al., 1999

2.1.10  Plasmide, Konstrukte und Phagen

Name

Vektor-Backbone

Art

Bezugsquelle

Verwendung

Bluescript II KS +

pUC19

Klonierungsvektor

Stratagene

Klonierung

P-1 bis P-12

pCYPAC-2

Phagen mit Teilen des humanen Genoms

Ressourcen-Zentrum Heidelberg (RZPD)

Subklonierung

IRF1-hER

pMTHE

Expressionsplasmid

S. Kirchhoff, H. Hauser; EUGEN

Expressions-

analyse

phRG-TK

pGL3 basic

Expressionsplasmid

Promega

Promoterassay

SEAPII basic

SEAPII basic

promoterloses Expressionsplasmid

Clontech

Promoterassay

A-2

SEAPII basic

Expressionsplasmid

siehe Kapitel 2.2.7.5

Promoterassay

B-2

SEAPII basic

Expressionsplasmid

siehe Kapitel 2.2.7.5

Promoterassay

C-2

SEAPII basic

Expressionsplasmid

siehe Kapitel 2.2.7.5

Promoterassay

D-2

SEAPII basic

Expressionsplasmid

siehe Kapitel 2.2.7.5

Promoterassay

A-4

SEAPII basic

Expressionsplasmid

siehe Kapitel 2.2.7.5

Promoterassay

pGL3 basic

pGL3 basic

promoterloses Expressionsplasmid

Promega

Promoterassay

A-1

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

A-2

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

A-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

B-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

C-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

D-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

E-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

F-3

pGL3 basic

Expressionsplasmid

siehe Kapitel 2.2.7.4

Promoterassay

I-Kappa B (S32A/S36A) dom. negativ

pUSEamp+

Expressionsplasmid

Upstate Cell Signaling

Promoterassay

2.1.11  Software

2.1.11.1  Promoteranalyse

↓23

Programm

URL

Genomatix MatInspector

http://www.genomatix.de

Genomatix PromoterInspector

http://www.genomatix.de

ConPro

http://stateslab.bioinformatics.med.umich.edu/conpro

McPromoter

http://genes.mich.edu/McPromoter.html

FirstEF

http://rulai.cshl.org/tools/FirstEF

CPGPLOT

http://www.ebi.ac.uk/emboss/cpgplot/

2.1.11.2 Datenbanken

Datenbank

URL

Database TSS oligo-capped

http://dbtss.hgc.jp/index.html

BLAST (NCBI) non-redundant (nr)

http://www.ncbi.nlm.nih.gov/BLAST/

BLAST (NCBI) high throughput genome sequences (htgs)

http://www.ncbi.nlm.nih.gov/BLAST/

2.1.12 Stammlösungen

10 x PBS Puffer [pH 7.4]

80 g NaCl

2 g KCl

14.4 g Na2HPO4 * 2 H2O

2.4 g KH2PO4

H2O auf 1 Liter

↓24

5x TAE-Puffer [pH 7.5 – 7.8]

24.2 g Tris-Base

5.7 ml Eisessig

10 ml 0.5 M EDTA [pH 8.0]

H2O auf 1 Liter

10 x MOPS Puffer [pH 7.0]

41.8 g MOPS

4.1 g Na-Acetat

20 ml 0.5 M EDTA [pH 8.0]

H2O auf 1 Liter

20 x SSC [pH 7.0]

175.3 g NaCl

88.2 g Na-Citrat

H2O auf 1 Liter

1 x TA-Puffer

4,8 g Tris-Base

1.1 ml Eisessig

6,5 g Kaliumacetat

2,1 g Magnesiumacetat

0.08 g DTT

H2O auf 1 Liter

mit 5 N NaOH auf pH 7.8 einstellen

↓25

10 x TBE-Puffer

108 g Tris-Base

55 g Borsäure

20 ml 1 M EDTA [ph 8.0]

H2O auf 1 Liter

DNA-Lade-Puffer

0.25 % Bromphenolblau

0.25 % Xylencyanol

30 % Glycerin

RNA-Lade-Puffer

0.35 ml H2O

0.21 ml 10 x MOPS

0.35 ml 37% Formaldehyd

0.96 ml deionis. Formamid

0.1 ml Glycerol

0.01 g Bromphenol-Blau

2 μl Ethidiumbromid

2 x UB-Puffer

2.4 g HEPES

0.4 g MgCl2

0.32 g DTT

7.5 g NaCl

100 ml Glycerol

H2O auf 1 Liter, auf pH 7.8 einstellen

2.1.13 Medien

2.1.13.1  Zellkultur

↓26

D10

Ausgangsmedium

Dulbeccos Minimal Essential Medium (DMEM)

Cambrex, Verviers, Belgien)

enthält 1 g/L Glucose, kein L-Glutamine

Zusätze

50 ml fötales Kälberserum

5 ml Streptomycin/Penicillin

5 ml L-Glutamin

Für Östrogen-freies Medium (KA-1 Zellen) wurde fötales Kälberserum der Firma Boehringer Mannheim (Katalog-Nr.: 210 471) verwendet.

2.1.13.2 Bakterienkultur

↓27

1 x LB-Agar

15 g Agar

10 g NaCl

10 g Tryptone

5 g Hefe-Extrakt

H2O auf 1 Liter

mit 5 N NaOH auf pH 7.0 einstellen

autoklavieren

1 x LB-Medium

10 g NaCl

10 g Tryptone

5 g Hefe-Extrakt

H2O auf 1 Liter

mit 5 N NaOH auf pH 7.0 einstellen

autoklavieren

2 x YT-Medium

16 g Tryptone

10 g NaCl

10 g Hefe Extrakt

H2O auf 1 Liter

mit 5 N NaOH auf pH 7.2 – 7.4 einstellen

autoklavieren

1 x NYZ+-Medium

10 g NZ Amin (Casein Hydrolysat)

5 g Hefe-Extrakt

5 g NaCl

H2O auf 1 Liter

mit 5 N NaOH auf pH 7.5 einstellen

autoklavieren

vor dem Gebrauch noch zugeben

12.5 ml 1 M MgCl2 (steril)

12.5 ml 1 M MgSO4 (steril)

10 ml 2 M filtersterilisierte Glukose-Lösung

2.1.14 Gel-Zusammensetzung

1%iges DNA-Agarosegel

0.5 g Agarose

50 ml 1 x TAE-Puffer

0.2 μl Ethidiumbromid

0.8%iges RNA-Agarosegel

1.6 g Agarose

20 ml 10 x MOPS-Puffer

0.8 μl Ethidiumbromid

10.8 ml 37% Formaldehyd

146 ml H2O

8%iges Polyacrylamid Gel

31. 5 g Harnstoff

in 61 ml H2O lösen

7.5 ml 10 x TBE

6 ml Acrylamid (9:1)

63 μl TEMED

450 μl 10%iges APS

2.2 Methoden

2.2.1  RNA-Isolierung aus Säuger-Zelllinien

Zur Isolierung von Gesamt-RNA wurde das RNeasy Kit von Qiagen benutzt. Die entsprechenden Zellen wurden in Zellkulturschalen (10 cm Durchmesser) kultiviert, das Medium abgesaugt und die Zellen einmal mit PBS (1x) gewaschen. Anschließend wurden die Zellen mit RLT-Puffer abgelöst, in ein Mikrozentrifugationsröhrchen überführt und kurz mit dem Vortex resuspendiert. Zur Homogenisierung der Probe wurde diese mindestens fünfmal durch eine Kanüle (Durchmesser: 0.9 mm) gezogen. Ein Volumenäquivalent 70%igen Ethanols wurde zugegeben und gut gemischt. Die Probe wurde auf eine RNeasy Säule gegeben und für 15 Sekunden bei 8000 x g zentrifugiert. Die Probe wurde auf der Säule mit dem Puffer RW1 und anschließend zweimal mit dem Puffer RPE gewaschen. Zuletzt wurde die RNA mit 50 μl RNase freiem Wasser eluiert (1 Minute bei 8000 x g). Die RNA wurde bei – 80°C aufbewahrt.

2.2.2 DNA Isolierung

2.2.2.1  Maxi Präparation

↓28

100 ml Bakterienkultur wurden 10 Minuten bei 4000 rpm und 4°C zentrifugiert. Das Pellet wurde in 6.7 ml Maxiprep Puffer (25 mM Tris-HCl [pH 8.0], 50 mM Glucose, 10 mM EDTA [pH 8.0]) und 100 μg RNAseA/ml Lösung gelöst und 30 Minuten bei Raumtemperatur inkubiert. Anschließend wurden der Lösung 13.3 ml 0.2 N NaOH und 1% SDS (Endkonzentration) zugegeben. Nach 5 min bei Raumtemperatur wurden 10 ml 3M Kaliumacetat zugegeben, gemischt und 20 min bei 4°C inkubiert. Das entstandene Präzipitat wurde bei 4°C, für 20 min bei 9000 x g abzentrifugiert, die wässrige Phase entnommen und das restliche Präzipitat abfiltriert. Ein Volumenäquivalent bestehend aus einem Gemisch von Tris-gesättigtem Phenol, Chloroform, Isopropanol im Verhältnis 25/24/1 wurde mit der Lösung vermischt und anschließend die Phasen bei 17 °C für 10 min bei 16000 x g getrennt. Die wässrige Phase wurde abgenommen, mit einem Volumenäquivalent eines 49/1 Gemisches aus Chloroform und Isopropanol gemischt und für 10 min bei 17 °C und 16000 x g abzentrifugiert. Die wässrige Phase wurde erneut abgenommen und 3 M NaCl im Verhältnis 1/10 sowie das 0.7fache Volumenäquivalent Isopropanol zugegeben. Das Gemisch wurde bei 16000 x g und 4°C für 25 min abzentrifugiert, der wässrige Überstand abgegossen, das feste Pellet mit 70%igem EtOH gewaschen und in Tris-HCl [pH8.0] aufgenommen. Die DNA wurde bis zur weiteren Verwendung bei –20°C eingefroren.

2.2.2.2 Mini Präparation

Kleinere Mengen DNA (-10μg) wurden mit dem QIAprep Spin Miniprep Kit (Qiagen) isoliert. Dazu wurden 1.5 ml Bakterienkultur abzentrifugiert, das Pellet in 250 μl Puffer P1 gelöst und in ein Mikrozentrifugationsröhrchen überführt. Nach Zugabe von 250 μl Puffer P2 wurde das Mikrozentrifugationsröhrchen dreimal geschüttelt und anschließend 350 μl Puffer N3 zugegeben. Das entstandene Präzipitat wurde abzentrifugiert und der Überstand auf eine QIAprep Säule gegeben. Diese wurde anschließend mit den Puffern PB und PE gewaschen. Zuletzt wurde die DNA mit 10 mM Tris-HCl [pH 8.0] von der Säule eluiert und bis zur weiteren Verwendung bei –20°C eingefroren.

2.2.3 Manipulation von DNA

2.2.3.1  Verdau von DNA

Soweit nicht anders angegeben, wurden zur Restriktion von DNA Enzyme der Firma Promega nach Anleitung des Herstellers verwendet und die DNA mit dem entsprechenden Enzym für eine Stunde bei 37°C inkubiert. Das Enzym wurde anschließend den Angaben entsprechend inaktiviert. Die DNA der Phagen wurde auf Grund ihrer Größe über einen Zeitraum von 12 Stunden verdaut.

2.2.3.2 Dephosphorylierung von DNA-Enden

↓29

Die linearisierte DNA wurde in 1xTA Puffer und 5 mM CaCl für 5 Minuten bei 30 °C inkubiert. Für jedes Mikrogramm DNA wurde eine Einheit des Enzyms HK Phosphatase (Epicentre Technologies) zugegeben und das Gemisch für eine Stunde bei 30 °C inkubiert. Abschließend wurde die Phosphatase durch Inkubation bei 65 °C und 15 Minuten inaktiviert.

2.2.3.3 Ligation von DNA Fragmenten

Zur Ligation von DNA-Fragmenten in Vektoren wurde das Fast-Link DNA Ligation and Screening Kit (Epicentre Technologies) nach Anleitung des Herstellers verwendet. Dazu wurden 1.5 μl 10fach Puffer, 1mM ATP sowie Fragment-DNA und dephosphorylierte Vektor-DNA im molaren Verhältnis 3:1 (Gesamt-Menge: ca. 50 ng) gemischt. Hierzu wurden zwei Einheiten Fast-Link Ligase zugegeben. Das Gemisch wurde für 10 Minuten bei Raumtemperatur und anschließend für 15 Minuten bei 70°C inkubiert.

Parallel dazu wurde eine Probe des nicht dephosphorylierten Leervektors zur Kontrolle ligiert. Ein kleiner Teil der Proben wurde mit einem Restriktionsenzym linearisiert und zur Kontrolle auf einem 1%igem Agarosegel aufgetrennt. Aus dem Vergleich der Banden konnte abgelesen werden, ob das Fragment mit dem Vektor ligiert worden war. Das Restriktionsprodukt des Vektors, in den das Fragment ligiert wurde, sollte entsprechend des Fragments größer sein, als der zur Kontrolle linearisierte Leervektor.

2.2.3.4 Einführung von Punkt-Mutationen

↓30

Gezielte Mutationen wurden mit dem QuikChange Site-Directed Mutagenesis Kits (Stratagene), nach Anleitung des Herstellers, in Plasmid-DNA eingeführt. Mit Hilfe dieser Methode wurden in den Transkriptionsfaktorbindungsstellen des H-REV107-1 Promoters gezielt Nukleotide ausgetauscht.

Die Beschreibung der Methode in Kürze: Ein ca. 30 Basenpaare langes, komplimentäres Primerpaar mit den gewünschten, in die Plasmid DNA einzuführenden Mutationen, wurde mit der Plasmid-DNA, dNTPs, und der Pfu Turbo DNA Polymerase in einer PCR Reaktion eingesetzt.

Tabelle 3: PCR-Programm zum Einbringen zielgerichteter Mutationen

Segment

Zyklen

Temperatur

Zeit

1

1

95 °C

30 Sekunden


2


12

95 °C

30 Sekunden

55 °C

1 Minute

68 °C

10 Minuten

↓31

In dieser Reaktion wurde die DNA mit der eingeführten Mutation synthetisiert. Die neu synthetisierte DNA enthält im Unterschied zur Ausgangs-DNA einen Knick. Dem auf 37 °C abgekühlten Reaktionsgemisch wurden 10 Einheiten des Restriktionsenzyms DpnI zugegeben, welches nur die Ausgangs-DNA, aber nicht die neu synthetisierte DNA verdaute. Der Verdau fand bei 37 °C für eine Stunde statt. Die übriggebliebene, mutierte DNA wurde in XL1-Blue Supercompetente Zellen transformiert. In den Bakterien wurde der Knick von diesen repariert und die DNA vervielfältigt. Abschließend wurde die DNA mit Hilfe der DNA-Maxipräparation gewonnen und zur Kontrolle sequenziert.

2.2.4 5´-Endmarkierung von Oligonukleotiden

Die 5´-Endmarkierung von Oligonukleotiden wurde mit dem Nick Translation Kit von AmershamPharmacia Biotech, entsprechend dem Protokoll, durchgeführt. Dazu wurden 100 ng Oligonukleotid, 10 μl Nukleotid-Puffer und 5 μl dCTP [α-32P] (10mCi/ml) mit H2O auf 50 μl aufgefüllt. Anschließend wurde 5 μl Enzym-Lösung zugegeben, gemixt, kurz abzentrifugiert und für 2 Stunden bei 15 °C inkubiert. Ein μl der Probe wurde in ein leeres Röhrchen gefüllt und die α-32P-Einbaurate mit einem Szintillationszähler gemessen. Die restliche Probe wurde für fünf Minuten bei 95 °C denaturiert und die gewünschte Menge verwendet.

2.2.5 Northern Blot Hybridisierung für mRNA

Zehn μg Gesamt-RNA, gemischt mit 2μl RNA-Ladepuffer, wurden mittels Elektrophorese in einem formaldehydhaltigen, einprozentigem Agarosegel aufgetrennt (Elektrolytlösung:1fach MOPS). Das Gel wurde auf einen UV-Tisch gelegt, fotografiert und zurechtgeschnitten. Anschließend wurde es für 10min in 5xSSC equilibriert. Das Gel wurde mit der Rückseite nach oben auf einen Bogen Whatmanpapier gelegt, dessen Enden in eine Lösung von 20xSSC hingen. Eine in 2xSSC equilibrierte Nylonmembran (HybondN) wurde auf das Gel gelegt, mit vier Lagen Whatmanpapier belegt und mit genügend saugfähigem Zellulosepapier bedeckt. Es wurde darauf geachtet, dass sich zwischen dem Gel und der Nylonmembran keine Luftblasen befanden. Durch die aus dem Gel aufsteigende Flüssigkeit wurde die RNA im Laufe von 16 Stunden auf die Nylonmembran transferiert. Die Membran wurde anschließend für 10 Minuten in 2xSSC gewaschen und die RNA durch Bestrahlung mit UV-Licht (2 Minuten, 120mJ/cm2) fixiert. Die Membran wurde in Prähybridisierungslösung (ExpressHyb, Clontech), der 10 μl (10mg/ml) tRNA /ml ExpressHyb zugegeben war, bei 42 °C für mindestens 30 Minuten inkubiert. Eine markierte Sonde (Herstellung der Sonde siehe Kapitel 2.2.7) wurde für 2 Minuten bei 95°C denaturiert, der Hybridisierungslösung zugegeben und die Membran für weitere 4 Stunden inkubiert. Anschließend wurde die Membran in 2xSSC mit 0.1% SDS bei Raumtemperatur bei wiederholtem Austausch der Waschlösung für 30 Minuten gewaschen. Danach wurde die Membran in 0.1xSSC mit 0.1% SDS für eine Stunde bei 50 C gewaschen. Die Membran wurde in Plastikfolie eingeschweißt, in einer Dunkelkammer in eine Filmkassette auf einen Röntgenfilm (BioMAX MS) gelegt und über Nacht bei -70°C exponiert.

2.2.6 Southern Blot Hybridisierung für DNA

↓32

Die isolierte und gereinigte DNA eines Phagen, wurde mit den entsprechenden Restriktionsenzymen geschnitten. Die DNA wurde in einem einprozentigen Agarosegel elektrophoretisch aufgetrennt (Laufpuffer 1xTAE). Das Gel wurde auf einen UV-Tisch gelegt, fotografiert und zurechtgeschnitten. Anschließend wurde es für 2 x 20 min in einer Lösung aus 0.4 M NaOH, 1 M NaCl equilibriert und die DNA denaturiert. Das Gel wurde mit der Rückseite nach oben auf einen Bogen Whatmanpapier gelegt, dessen Enden in eine Lösung von 0.4 M NaOH, 1 M NaCl hingen. Eine Nylonmembran (HybondN+) wurde auf das Gel gelegt, mit vier Lagen Whatmanpapier belegt und mit genügend saugfähigem Zellulosepapier bedeckt. Es wurde darauf geachtet, dass sich zwischen dem Gel und der Nylonmembran keine Luftblasen befanden. Durch die aus dem Gel aufsteigende Flüssigkeit wurde die DNA im Laufe von 16 Stunden auf die Nylonmembran transferiert. Die Membran wurde anschließend in einer Lösung, bestehend aus 0.5 M Tris-HCl [pH 7.2] und 1.0M NaCl für 2 x 20 Minuten neutralisiert und die DNA durch Bestrahlung mit UV-Licht (2 Minuten, 120mJ/cm2) fixiert. Die Membran wurde in Prähybridisierungslösung (ExpressHyb, Clontech), der 10 μl (10mg/ml) tRNA /ml ExpressHyb zugegeben war, bei 60 °C für mindestens 30 Minuten inkubiert. Ein radioaktiv markiertes, PCR-synthetisiertes H-REV107-1 cDNA Fragment, welches das 5´-Ende des Gens enthielt, wurde für 2 Minuten bei 95 °C denaturiert, der Hybridisierungslösung zugegeben und die Membran für weitere 4 Stunden bei 60°C inkubiert (Herstellung der Sonde siehe Kapitel 2.2.7). Anschließend wurde die Membran in 2xSSC mit 0.1% SDS bei Raumtemperatur bei wiederholtem Austausch der Waschlösung für 30 Minuten gewaschen. Danach wurde die Membran in 0.1xSSC mit 0.1% SDS für eine Stunde bei 50 °C gewaschen. Die Membran wurde in Plastikfolie eingeschweißt, in einer Dunkelkammer in eine Filmkassette auf einen Röntgenfilm (BioMAX MS) gelegt und über Nacht bei -70°C exponiert.

2.2.7 PCR

2.2.7.1  Herstellung der humanen H-REV107-1 Sonde für den Northern- und Southern Blot Hybridisierungsassay

Sequenz der Primer: siehe Tabelle 2.1.9.4

Primer:

5´- 3´: hu107-D

3´- 5´: hu107-E

Ausgangs-DNA:

15 ng H-REV107-1 12-1cDNA pZERO-1

Primer

je 15 pmol

Polymerase

Taq Gold, 0.7 μl

dNTP

1 μl

↓33

Programm:

Tabelle 4: PCR-Programm zur Synthese der humanen H-REV107-1 Sonde

Schritt

Zyklen

Temperatur (°C)

Zeit

1

1

95

12 min


2


30

95

20 sek

62

20 sek

72

40 sek

3

1

72

5 min

2.2.7.2  Herstellung der IRF-1 Sonde für den Northern Blot Hybridisierungsassay (human und Ratte)

↓34

Programm:

Tabelle 5: PCR-Programm zur Synthese der IRF-1 Sonde

Schritt

Zyklen

Temperatur (°C)

Zeit

1

1

95

12 min


2


30

95

30 sek

55.5

30 sek

72

60 sek

3

1

72

5 min

2.2.7.3 Herstellung der Ratten H-rev107-1 Sonde für den Northern Blot Hybridisierungsassay

↓35

Programm:

Tabelle 6: PCR-Programm zur Synthese der Ratten H-rev107-1 Sonde

Schritt

Zyklen

Temperatur (°C)

Zeit

1

1

95

12 min


2


30

95

20 sek

60

20 sek

72

40 sek

3

1

72

5 min

2.2.7.4 Herstellung der pGL3-Promoterkonstrukte

Tabelle 7: Annealing Temperaturen und Anzahl der Zyklen für die folgenden PCR Programme zur Synthese der pGL3-Konstrukte

Name des Fragments

Annealing Temp. °C (Schritt 2/Schritt 3)

Anzahl Zyklen

(Schritt 2/Schritt 3)

A-3

49.5 / 64.5

10 / 25

B-3

49.5 / 64.5

10 / 25

C-3

49.5 / 64.5

10 / 25

D-3

49.5 / 64.5

10 / 25

E-3

48.5 / 68.5

10 / 25

F-3

48.5 / 68.5

10 / 25

A-2

50 / 66.5

10 / 25

↓36

PCR Programm für alle pGL3-Konstrukte:

Ausgangs-DNA:

20 ng, SEAP A-4

Primer

je 30 pmol; Sequenz der Primer: siehe Tabelle 2.1.9.3

Polymerase

VentR (New England Biolabs) 2 Units

dNTP

2 μl

Tabelle 8: PCR-Programme zur Synthese der pGL3-Konstrukte

Schritt

Zyklen

Temperatur (°C)

Zeit (min)

1

1

95

10


2


siehe Tabelle 5

95

1

siehe Tabelle 5

1

78

2


3


siehe Tabelle 5

95

1

siehe Tabelle 5

1

78

2

4

1

78

10

2.2.7.5 Herstellung der SEAP-Promoterkonstrukte

↓37

Tabelle 9: Annealing Temperaturen und Anzahl der Zyklen für die folgenden PCR-Programme zur Synthese der SEAP-Konstrukte

Name des Fragments

Annealing Temp. °C (Schritt 2/Schritt 3)

Anzahl Zyklen

(Schritt 2/Schritt 3)

A-2

48.7 / 65.5

10 / 20

B-2

48.7 / 65

10 / 25

C-2

48.7 / 65

10 / 25

D-2

48.7 / 65

10 / 20

A-4

48.5 / 63

10 / 20

Die Promoterkonstrukte für die funktionelle Untersuchungen, B-2, C-2, D-2 und A-2 wurden mittels PCR aus dem Gesamtpromoterfragment A-4 hergestellt.

PCR Programm für Konstrukte A-2 und A-4:

↓38

Ausgangs-DNA:

32 μg, Phage P1-8

Primer

je 15 pmol; Sequenz der Primer: siehe Tabelle 2.1.9.2

Polymerase

VentR (New England Biolabs) 1 Unit

dNTP

2 μl

Tabelle 10: PCR-Programme zur Synthese der SEAP-Konstrukte A-2 und A-4

Schritt

Zyklen

Temperatur (°C)

Zeit (min)

1

1

95

10


2


siehe Tabelle 7

95

1

siehe Tabelle 7

2

78

6


3


siehe Tabelle 7

95

1

siehe Tabelle 7

2

78

6

4

1

78

10

PCR Programm für die Konstrukte B-2, C-2 und D-2:

↓39

Ausgangs-DNA:

20 ng, A-4

Primer

je 30 pmol; Sequenz der Primer: siehe Tabelle 2.1.9.2

Polymerase

VentR (New England Biolabs) 2 Units

dNTP

2 μl

Tabelle 11: PCR-Programme zur Synthese der SEAP-Konstrukte B-2, C-2 und D-2

Schritt

Zyklen

Temperatur (°C)

Zeit (min)

1

1

95

10


2


siehe Tabelle 7

95

1

siehe Tabelle 7

1

78

3


3


siehe Tabelle 7

95

1

siehe Tabelle 7

1

78

3

4

1

78

10

2.2.8 Sequenzierung

2.2.8.1  Genome Priming System

Um eine längere DNA Sequenz zu sequenzieren konnte man anstatt des "Primer-Walkings“ auch das Genome Priming System verwenden. Bei diesem System wurden mit Hilfe eines, vom Transposon Tn7 abgeleiteten Transprimer™ Elements, in jedes Zielplasmid zwei Primer-Bindungsstellen (Primer N und S; Sequenz siehe Kapitel 2.1.9.1) statistisch zufällig verteilt in die Plasmid-DNA inseriert.

↓40

Durch Sequenzierung einer genügend hohen Anzahl an Klonen, ausgehend jeweils von den inserierten Primer-Bindungsstellen, erhält man eine vollständige Abdeckung der Ziel-DNA. Die Zusammensetzung der einzelnen, sich überlappenden Fragmente, erfolgt mit Hilfe eines Computers.

Zu einem Gemisch aus Ziel-DNA (0.08 µg) und zu inserierendem Transprimer™ (0.02 µg) wurde Transposase TnsABC zugegeben und für 10 Minuten bei 37 °C inkubiert. Nach Zugabe eines Startmixes lief die Reaktion für eine Stunde bei 37 °C und wurde abschließend 10 Minuten bei 75 °C inaktiviert.

Die DNA wurde in Bakterien transformiert und Klone durch Zugabe entsprechender Antibiotika selektioniert. Aus 50 Klonen wurde die transformierte DNA isoliert und anschließend mit dem Primer N und dem Primer S sequenziert.

2.2.8.2 zyklische Sequenzierung

↓41

Sequenzierungen wurden mit dem SequiTherm EXCEL II DNA Sequencing Kit-LC (Epicentre Technologies) durchgeführt. Die Primer (siehe Kapitel 2.1.9.1) waren IRD 800 markiert und wurden von MWG Biotech bezogen. Aus einem frisch hergestellten Mix, bestehend aus 7.2 μl 3.5xSequiTherm EXCEL II Sequenzier-Puffer, 2 pmol markiertem Primer, 700 ng DNA, 1 μl SequiTherm EXCEL II DNA Polymerase, der mit H2O auf 17 μl aufgefüllt wurde, wurden je 4 μl entnommen und zu je 2 μl SequiTherm EXCEL II Termination Mix A, C, G oder T gegeben. Das Gemisch wurde mit Mineralöl überschichtet, 5 Minuten bei 95 °C denaturiert und anschließend eine PCR mit folgenden Parametern durchgeführt:

Tabelle 12: PCR-Programm zur Durchführung von Sequenzierungen

Schritt

Zyklen

Temperatur (°C)

Zeit

1

30

95

30 sek

TM – 2 °C

(TM s. Kapitel 2.1.9.1)

15 sek

70

1 min

Abschließend wurden 3 μl Stop/Loading Puffer zugegeben.

↓42

Zur Analyse der Sequenzierung wurden die Proben für 3 Minuten auf 70 °C erwärmt und je 1.2 μl der Probe auf ein Sequenziergel aufgetragen. Das Sequenziergel wurde aus 350 μl 10% APS, 400 μl DMSO, 30 ml Sequagel XR und 7.5 ml Sequagel Complete Buffer (beides National Diagnostics) hergestellt. Die Analyse erfolgte mit dem Sequenzierautomat LI-COR DNA-Sequencer 4000 und wurde mit der Software DataBase Image IR am Computer ausgewertet.

2.2.9 Primer Extension

2.2.9.1  Markieren des Primers

Das Oligonukleotid HRev107 PrimExt 2 wurde mit ATP [γ-32P] (10 mCi/ml) am 5`-Ende markiert. Dazu wurden 50 pmol Primer mit 2 Einheiten Polynukleotid-Kinase (PNK; NEB), 5 μl 10 x PNK-Puffer, 2 μl ATP [γ-32P] und 36 μl H2O für eine Stunde bei 37°C inkubiert und die PNK anschließend für 15 min bei 70°C inaktiviert. Freies ATP [γ-32P] wurde über eine Sephadex-Säule (G 25, Calbiochem) vom Primer abgetrennt und dieser anschließend mit 10 mM Tris-HCl [pH 8.0] von der Säule gewaschen. Zum Bestimmen der Einbaurate wurden die γ-Zerfälle pro Sekunde mit Hilfe eines Szintillationszählers gemessen. Die Konzentration des Primers wurde auf 105 Zerfälle pro Sekunde je μl verdünnt und für jede Probe eine Menge des Primers eingesetzt, die 2x104 Zerfälle pro Sekunde entsprach.

Um kleine Abweichungen beim Pipettieren der Proben, die zu stark unterschiedlichen Signalen auf dem Röntgenfilm geführt hätten, zu vermeiden, wurden alle Ansätze für 10 Proben oder mehr angesetzt. Im Ansatz für 1 Probe wurde Primer entsprechend einer Menge von 2x104 Zerfälle/s und 30 μg Gesamt-RNA mit H2O auf 50 μl Gesamtvolumen aufgefüllt. Die Probe wurde mit NaAcetat/EtOH gefällt und die getrocknete Probe in 30 μl Hybridisierungspuffer (10 mM Tris-HCl [pH 7.9]; 1 mM EDTA; 250 mM KCl) aufgenommen. Das Gemisch wurde für 10 min auf 80°C erwärmt und über Nacht bei 30°C stehen gelassen. Die Probe wurde erneut gefällt und anschließend eine Reverse Transkription mit der Transkriptase SuperscriptII (Life Technologies) durchgeführt. Das Pellet wurde hierfür in 4 μl 5x RT-Puffer, 2 μl 0.1 M DTT, 1 μl 10 mM dNTPs, 0.5 μl RNAsin und 11.5 μl H2O gelöst und für 2 Minuten bei 37 °C inkubiert. Jetzt wurde 1 μl Reverse Transkriptase zugegeben und die Probe für 10 Minuten bei 37 °C, 50 Minuten bei 42 °C und 5 Minuten bei 95 °C inkubiert. Das fertige Produkt wurde mit 40 ng RNAaseA behandelt und die Behandlung mit 1 μl EDTA (0.5 M, [ph 8.0]) gestoppt. Die Probe wurde wieder mit NaAcetat/EtOH gefällt und in 4 μl 10 mM Tris-HCl [pH 8.0] aufgenommen.

2.2.9.2 radioaktive Sequenzierung im Zuge des Primer Extension Nachweises

↓43

Der Primer für die Sequenzierung wurde entsprechend dem "Nick Translation" Protokoll mit ATP [γ-32P] (10 mCi/ml) und Polynukleotid Kinase am 5´-Ende markiert (s. Kapitel 2.2.4) und gemäss dem Protokoll der SequiTherm EXEL II Sequenzierung (s. Kapitel 2.2.8.2) eingesetzt.

Primer:

HRev 107 seqrev 2

2 pmol

Template:

H-REV107-1 12-1 in pZero

0.5 μg

Polymerase:

SequiTherm EXCEL II DNA Polymerase

1 μl

Durchführung siehe Sequenzierung

↓44

Tabelle 13: PCR-Programm zur Durchführung der radioaktiven Sequenzierung

Schritt

Zyklen

Temperatur (°C)

Zeit

1

1

95

10 min


2


30

95

1 min

57

1 min

72

2 min

3

1

4

Das Produkt der Primer Extension Reaktion wurde neben dem Produkt der Sequenzierung auf einem 8%igen Polyacrylamidgel (7 M Harnstoff) aufgetragen und bei 250V aufgetrennt. Als Laufpuffer wurde 1 x TBE verwendet. Die Proben wurden vor dem Auftragen für 2 Minuten auf 72 °C erwärmt und jeweils 2 μl Loading-Buffer zugegeben. Die Spannungsquelle wurde abgeschaltet, wenn die Bromphenol-Bande ca. 2 cm über dem Gelende stand. Das Gel wurde anschließend auf Whatmanpapier überführt, für zwei Stunden bei 70 °C vakuumgetrocknet, in Frischhaltefolie eingeschlagen und über Nacht zusammen mit einem Röntgenfilm bei –70°C in eine Filmkassette gelegt. Der entwickelte Film wurde von Hand ausgewertet.

2.2.10 Bakterienkultur

2.2.10.1  allgemeine Bakterienkultur

Bakterienkulturen auf festem Medium: Agar-Agar enthaltenes LB-Medium wurde aufgekocht und auf 50 °C abgekühlt. Jetzt wurde das gewünschte Antibiotikum zugegeben (Ampicillin, Kanamycin; jeweils mit einer Endkonzentration von 50 μg/ml) und das Medium in 10 cm Petrischalen gegossen. Auf dem ausgehärteten Medium wurde die Bakterienkultur ausgestrichen und für 14 Stunden bei 37 °C inkubiert. Die gewachsenen Kolonien wurden bis zu zwei Wochen bei 4 C aufbewahrt.

↓45

Bakterienkulturen in Flüssigmedium: LB-Medium wurde mit Ampicillin versetzt (Endkonzentration: 50 μg/ml) und je 2 ml auf 14 ml Zentrifugenröhrchen aufgeteilt. In dieses Medium wurde mit Hilfe einer sterilen Pipettenspitze eine, von einer Agarplatte abgenommene Bakterienkolonie oder eine bei –80°C in Gefriermedium eingefrorene Bakterienkultur eingebracht und für 14 Stunden bei 37 °C und einer Schüttelfrequenz von 220 Umdrehungen in der Minute inkubiert.

Phagen (Vektor pPAC4): Zur Kultivierung der Phagen-Klone wurde das Medium 2×YT benutzt und mit Kanamycin versetzt (Endkonzentration: 50 μg/ml). Je 200 ml des Mediums wurden aus einem, bei – 80°C in Gefriermedium aufbewahrten, Phagenlysat angeimpft und für 14 Stunden bei 37 °C und einer Schüttelfrequenz von 220 Umdrehungen in der Minute inkubiert.

2.2.10.2 Transformation

E.coli XL-2 Blue Ultracompetente Zellen oder E.coli Sure-2 Zellen (Stratagene) wurden auf Eis aufgetaut und pro Ansatz 100 μl in ein Mikrozentrifugierröhrchen aliquotiert. Nach Zugabe von 2 μl ß-Mercaptoethanol wurden die Bakterien für 10 Minuten auf Eis inkubiert. 10–20 ng der zu transformierenden DNA wurden zugegeben und 30 Minuten auf Eis stehen gelassen. Anschließend wurden die Zellen in einem Wasserbad einem 42°C warmen und 30 Sekunden langen Hitzeimpuls ausgesetzt. Nachdem die Zellen für 2 Minuten auf Eis abgekühlt waren, wurden 900 μl 37 °C warmes NYZ+ Medium zugegeben und die Zellen für eine Stunde bei 37°C und einer Schüttelfrequenz von 220 Umdrehungen in der Minute inkubiert. 100 μl dieser Bakterienkultur wurden auf die, mit dem entsprechenden Antibiotikum versetzten, Agarplatten ausplattiert und über Nacht bei 37°C inkubiert.

2.2.11 Zellkultur

2.2.11.1  allgemeine Zellkultur

↓46

Soweit nicht anders beschrieben, wurde für die Zellkultur DMEM Medium mit 10% fötalem Kälber-Serum, 1 % Glutamin (Ultraglutamin, Bio Whittaker Europe) und 1000 μg Streptomycin/Penicillin je ml Medium) verwendet. Gegebenenfalls wurde ein entsprechendes Antibiotikum als Selektionsmittel zugegeben. Die Zellen wurden bei 37°C und 5% CO2 kultiviert. Zum Passagieren der Zellen wurden die Zellen mit Trypsin abgelöst und 1:10 verdünnt. Für die KA-1 Zelllinie wurde ein Östrogen-freies Kälber-Serum verwendet.

2.2.11.2 Transiente Transfektion

1x105 Zellen wurden pro well (2 cm Durchmesser) in 6-well Platten ausgesät und 24 Stunden bei 37 C im Brutschrank inkubiert. Die Transfektion erfolgte gemäss den Angaben des Herstellers (Fugene, Boehringer Mannheim). Zu 97 μl serumfreien DMEM Medium wurden 3 μl Fugene gegeben, anschließend wurden 1–2 μg DNA zugegeben und das Gemisch für 15 Minuten bei sterilen Bedingungen und Raumtemperatur inkubiert, bevor es dann auf die Zellen verteilt wurde. Die Zellen wurden für 24 Stunden im Brutschrank ruhen gelassen. Anschließend wurde das Medium abgesaugt und die Zellen in dem für sie notwendigen Medium weiter inkubiert und entsprechend der durchgeführten Experimente weiterverwendet.

2.2.12 Reporterassay

2.2.12.1  Great EscAPeTM SEAP Reporter Assay System (Clontech)

1x105 Zellen wurden in Sechs-well Platten (Durchmesser 2 cm) ausplattiert und nach 24 Stunden mit den entsprechenden Reporterplasmiden transfiziert (siehe Kapitel 2.2.11.2). Weitere 48 Stunden später wurden die Zellen mit dem Great EscAPeTM SEAP Reporter Assay aufgearbeitet. Dazu wurden 110 μl vom Zellmedium in ein Mikrozentrifugationsröhrchen überführt und zum Abtrennen von möglicherweise mitüberführten, abgelösten Zellen für 10 Sekunden bei 12.000 x g abzentrifugiert. 100 μl vom Überstand wurden in ein neues Mikrozentrifugationsröhrchen überführt. Die Proben wurden bis zum Messen der Lumineszens bei –20°C eingefroren.

↓47

Zu je 25μl Probe wurden 75μl 1x Dilution-Puffer gegeben und vorsichtig gemischt. Die Proben wurden für 30 Minuten bei 65°C in einem Heizofen inkubiert, auf Eis für 2 Minuten abgekühlt, anschließend ließ man die Proben sich langsam bis auf Raumtemperatur erwärmen. 100 μl Assay Puffer wurden zugegeben und die Probe für 5 Minuten bei Raumtemperatur inkubiert. Abschließend wurden 100 μl 1.25 mmol CSPD Chemilumineszens-Substrat zugegeben und die Probe für 10 Minuten bei Raumtemperatur inkubiert. Danach konnte die Lumineszenz in einem Luminometer bestimmt werden.

2.2.12.2 Dual-Luciferase Reporter Assay System (Promega)

1x 105 Zellen wurden in Sechs-well Platten (Durchmesser 2 cm) ausplattiert und nach 24 Stunden mit den entsprechenden Reporterplasmiden transfiziert. Als interne Transfektionskontrolle wurde ein Renilla-Luciferase Plasmid ko-transfiziert. Innerhalb jedes Experiments wurde neben den zu untersuchenden Reporterkonstrukten auch der Leervektor transfiziert. Weitere 24 Stunden später wurden die Zellen mit dem Dualen Luciferase Reporter Assay System Kit (Promega) aufgearbeitet. Nach dem Absaugen des Mediums wurden die auf Eis stehenden Zellen einmal mit PBS gewaschen und anschließend 500 μl PLB Puffer zugegeben. Die Zellen wurden mit einem Zellschaber abgelöst und in Mikrozentrifugationsröhrchen überführt. Die Zellmembranen wurden in drei Gefrier-Tauzyklen aufgebrochen, die festen Bestandteile mittels Zentrifugation abgetrennt (30s, 10000xg). 20 μl des Zelllysates wurden in Luminometer-Röhrchen gegeben und die Lumineszens wie folgt gemessen:

↓48

Die Berechnung der Werte erfolgte mit der Software Excel. Der Wert aus jeder einzelnen Transfektion ergab sich aus dem Quotienten Firefly-Luciferase (Aktivität des Konstrukts) durch Renilla-Luciferase (Transfektionskontrolle). Jede Transfektion wurde innerhalb eines Experiments sechsmal durchgeführt. Der Mittelwert von sechs Messungen wurde durch den Mittelwert der korrespondierenden Leervektor-Messungen dividiert. So erhielt man den Wert für die Aktivität des zu messenden Konstrukts relativ zum Wert des Leervektors. Die Fehlerfortpflanzung wurde dabei berücksichtigt. Wurden Promoter-Konstrukte mit Chemikalien behandelt oder eine Ko-transfektion durchgeführt, so wurden auch die Transfektionen des Leervektor-Plasmids entsprechend behandelt bzw. ebenfalls ko-transfiziert. Der Wert des Plasmids A-3, das die gesamte Promotersequenz enthält, wurde anschließend als 100% gesetzt und die weiteren Werte relativ dazu angegeben.

2.2.13 Proteinisolierung aus Zellkernen

70%-konfluent gewachsene Zellen wurden auf Eis dreimal mit kaltem PBS gewaschen, in kaltem PBS mit einem Gummischaber abgekratzt und bei 3000 x g 10 Minuten abzentrifugiert. Das Pellet wurde in 2ml 1% NP-40 enthaltenen Puffer A (10 mM HEPES [pH 7.8], 15 mM KCl, 2 mM MgCl2, 0.1 mM EDTA [pH 8.0]) resuspendiert und 5 Minuten auf Eis stehen gelassen. Der Überstand wurde abzentrifugiert und das Pellet mit 2 ml 1% NP-40 enthaltenen Puffer A gewaschen. Das Pellet wurde in 100 μl Puffer C (25 mM HEPES [pH 7.6], 50 mM KCl, 0.1 mM EDTA [ph 8.0], 10 % Glycerin) aufgenommen und die Salzkonzentration bezogen auf das Gesamtvolumen auf 0.4 M NaCl eingestellt. Nach 60 Minuten auf Eis wurde das Pellet bei 12000 x g abzentrifugiert und der Proteinextrakt in 20 μl Aliquots bei – 80 °C eingefroren.

2.2.14 EMSA

Je 5 μg komplimentärer, einzelsträngiger Oligonukleotide (MWG-Biotech) wurden in 40 μl Annealing-Puffer (50 mM Tris-Cl [pH 8.0], 70 mM NaCl) für 10 Minuten auf 90 °C erhitzt und bei Raumtemperatur langsam abgekühlt. 200 ng des doppelsträngigen Oligonukleotids wurden mit einer Polynukleotidkinase (New England Biolabs) nach Angaben des Herstellers am 5`-Ende mit ATP [γ-32P] (10 mCi/ml) markiert. 1 μl des markierten Oligonukleotids (20000 Zerfälle pro s je μl) wurde mit 10 μg Kernextrakt, 2 μg poly[dI-dC] (1 μg/μl) und 2 μg BSA in 20 μl 2xUB-Puffer, sowie je nach Experiment, mit 1 μl Antikörper oder einem 100fachen bzw. 1000fachen Überschuss an nicht markiertem Oligonukleotid für 30 Minuten bei Raumtemperatur (45 Minuten bei 4°C für Experimente mit Antikörper) inkubiert. Die Proben wurden auf einem 4-prozentigem SDS-freiem Acrylamidgel bei 200 V für 2 Stunden aufgetrennt. Das Gel wurde anschließend bei 70°C unter Vakuum für 2 Stunden getrocknet, in Plastikfolie eingeschweißt und über Nacht bei –70°C auf einen Röntgenfilm exponiert.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 4.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
12.10.2006