[Seite 18↓]

2  Material und Methoden

2.1 Chemikalien


[Seite 19↓]

Tab. 2.1 Zusammenstellung der verwendeten Chemikalien und Hersteller.

Substanz

Hersteller

1,2-Dichlorpropan (DCP)

Merck, Darmstadt

Acetamid

Sigma-Aldrich, Steinheim

Agar-Agar

Roth, Karlsruhe

Agarose

Roth, Karlsruhe

Ammoniumchlorid

Merck, Darmstadt

Ampicillin

Sigma-Aldrich, Steinheim

APS (Ammoniumperoxodisulfat)

Sigma-Aldrich, Steinheim

Aqua dest.

Inst. f. Mikrobiol. u. Hygiene, Berlin

Borsäure

Roth, Karlsruhe

Bromphenolblau

Bio-Rad Laboratories, München

Calciumchlorid-Dihydrat

Merck, Darmstadt

Chloroform

Merck, Darmstadt

CSPD (Dinatrium-3-(4-methoxyspiro{1,2-Doxetan-
3,2'(5'Chloro)Tricyclo[3.3.1.1 3,7 ]Decan}-4-yl)-
Phenylphosphat)

Roche, Manheim

DAPI (4,6-Diamidino-2-Phenylindol)

Sigma-Aldrich, Steinheim

DMSO (Dimethylsulfoxid)

Merck-Schuchhardt, Hohenbrunn

Ecotainer Wasser

B. Braun, Melsungen

EDTA (Ethylendiamintetraacetat)

Sigma-Aldrich, Steinheim

Eisenchlorid

Merck, Darmstadt

Essigsäure

Roth, Karlsruhe

Ethanol

Roth, Karlsruhe

Ethidiumbromid

Merck, Darmstadt

Ficoll

Sigma-Aldrich, Steinheim

Formaldehyd

Roth, Karlsruhe

Formamid

Amresco, Solon, USA

Glycerin

Fluka, Neu-Ulm

Harnstoff

Roth, Karlsruhe

Hefeextrakt

Roth, Karlsruhe

Isopropyl- β -D-thiogalactosid (IPTG)

Sigma-Aldrich, Steinheim

Kaliumchlorid

Merck, Darmstadt

Kaliumdihydrogenphosphat

Merck, Darmstadt

Kaliumhydrogenphosphat

Merck, Darmstadt

Kobaltchlorid-Hexahydrat

Merck, Darmstadt

Kupferchlorid

Merck, Darmstadt

Magnesiumchlorid

Merck, Darmstadt

Magnesiumchlorid-Hexahydrat

Merck, Darmstadt

Maleinsäure

Sigma-Aldrich, Steinheim

Manganchlorid-Tetrahydrat

Merck, Darmstadt

Methanol

Roth, Karlsruhe

Mineralöl

Fluka, Neu-Ulm

Natriumchlorid

Merck, Darmstadt

Natriumcitrat-Dihydrat

Merck, Darmstadt

Natriumhydrogenphosphat

Merck, Darmstadt

Natriumhydroxid

Merck, Darmstadt

Natriumjodid

Roth, Karlsruhe

Natriumlauroylsarkosin

Merck, Darmstadt

Natriummolybdat-Dihydrat

Merck, Darmstadt

Natriumpyrophosphat

Merck, Darmstadt

Natriumselenat

Merck, Darmstadt

Nickelchlorid

Merck, Darmstadt

Peressigsäure

Herbeta Arzneimittel, Berlin

Phenol (Rotiphenol)

Roth, Karlsruhe

Rapid Gel XL (40%)

USB, Cleveland, USA

Salzsäure

Roth, Karlsruhe

SDS (Sodiumdodecylsulfat)

Bio-Rad Laboratories, München

Silica

Sigma-Aldrich, Steinheim

Stickstoff

Linde AG, Hamburg

TEMED (N, N, N', N'-Tetramethylendiamin)

Roth, Karlsruhe

Tricin (N-tris[Hydroxymethyl]methylglycin; N-[2-Hydroxy-
1,1-bis(hydroxymethyl)ethyl]glycine)

Sigma-Aldrich, Steinheim

Tris(-Base) (Tris-(hydroxymethyl)-Aminomethan

Roth, Karlsruhe

Trypton

Difco, Detroit, USA

Wasserstoff

Linde AG, Hamburg

X-Gal
(5-chloro-4-bromo-3-indolyl- β -D-galactopyranosid)

Sigma-Aldrich, Steinheim

Xylencyanol FF

Bio-Rad Laboratories, München

Zinkchlorid

Merck, Darmstadt


[Seite 20↓]

2.2  Puffer, Nährmedien und sonstige Lösungen


[Seiten 21 - 23↓]

Tab. 2.2 Zusammenstellung der verwendeten Puffer, Nährmedien sowie sonstigen Lösungen.

Substanz

Zusammensetzung

Agarosegel-Probenpuffer

1.5 g Ficoll
25 mg Bromphenolblau
25 mg Xylencyanol FF
ad 10 mL Aqua dest.

Anti DIG AP Konjugat

1% Blockierungsreagenz
9 mL Maleinsäurepuffer
2 µL Anti DIG AP (Anti Digoxigenin Alkalische Phosphatase)

Blockierungsreagenz

10% Blockierungsreagenz [Roche, Mannheim] in Maleinsäurepuffer

CSPD-Substrat

12 µL CSPD auf 10 mL Detektionspuffer

Detektionspuffer

0.1 M Tris-Salzsäure, pH 9.5
0.1 M Natriumchlorid

DIG PCR-Mix

10 µM DIG-11-dUTP
190 µM dTTP
je 200 µM dATP, dCTP, dGTP

Hybridisierungspuffer (FISH)

0.9 M Natriumchlorid
0.02 M Tris-Salzsäure; pH 7.2
0.01% SDS
0 – 60% Formamid

LAXI-Agar

10 g Trypton
5 g Hefeextrakt
10 g Natriumchlorid
15 g Agar Agar
ad 1000 mL Aqua dest.
Nach dem Autoklavieren auf ca. 50°C abkühlen
250 µL Ampicillin (200 mg/mL)
200 µL X-Gal
50 µL IPTG

LightCycler Reaktionsmix

Taq DNA Polymerase
Reaktionspuffer
dUTP, dATP, dCTP, dGTP
SYBR Green I
10 mM Magnesiumchlorid

Lysozympuffer

100 mM Tris-Base
50 mM EDTA
pH 8.0

Maleinsäurepuffer

0.1 M Maleinsäure
0.15 M Natriumchlorid
pH 7.5

Mung Bean Nuklease Puffer

(Stratagene, Heidelberg)

30 mM Natriumacetat, pH 5.0
50 mM Natriumchlorid
1 mM Zinkchlorid
5% Glycerin

PBS-Puffer

8 g Natriumchlorid
0.2 g Kaliumchlorid
1.44 g Natriumhydrogenphosphat
ad 1000 mL Aqua dest.
pH 7.4

PCR-Puffer (10 x)

100 mM Tris-Salzsäure, pH 8.3
500 mM Kaliumchlorid

Phosphatpuffer

23.14 g Kaliumdihydrogenphosphat
164.38 g Kaliumhydrogenphosphat
ad 1000 mL Aqua dest.

Polyacrylamidgel
(für DNA-Sequenzierung)

21 g Harnstoff
5 mL Rapid Gel XL (40%)
6 mL 10 x TBE (für Sequenziergele)
500 µL DMSO
ad 50 mL Aqua dest. (Filtration)
292 µL APS (10%)
30 µL TEMED

RAMM-Medium

Lösung 1:

5.3 g Ammoniumchlorid
0.75 g Calciumchlorid-Dihydrat
1 g Magnesiumchlorid-Hexahydrat
0.2 g Eisenchlorid
ad 1000 mL Aqua dest.

 

Lösung 2:

10.8 g Kaliumdihydrogenphosphat
14 g Kaliumhydrogenphosphat
ad 1000 mL Aqua dest.

 

Lösung 3:

50 mg Manganchlorid-Tetrahydrat
5 mg Borsäure
5 mg Zinkchlorid
1 mg Kupferchlorid
1 mg Natriummolybdat-Dihydrat
50 mg Kobaltchlorid-Hexahydra
1 mg Nickelchlorid
5 mg Natriumselenat
ad 1000 mL Aqua dest.

 

Zur Herstellung des Mediums wurden 100 mL Lösung 1, 25 mL Lösung 2 und 10 mL Lösung 3 vereinigt, mit Aqua dest. auf 1000 mL aufgefüllt und autoklaviert.

SE-Puffer

8.76 g Natriumchlorid
2.92 g EDTA
ad 1000 mL Aqua dest.

Silika-Suspension

2.5 g Silica
25 mL Natriumjodid (3 M)

Silika-Waschpuffer

50 mM Natriumchlorid
10 mM Tris-Base
2.5 mM EDTA
50% Ethanol
pH 7.5

SSC-Puffer (20 x)

175.3 g Natriumchlorid
88.2 g Natriumcitrat-Dihydrat
ad 1000 mL Aqua dest.
pH 7.0

Standard-Hybridisierungspuffer

5 x SSC
0.1% Natriumlauroylsarkosin
0.02% SDS
1% Blockierungsreagenz

Standard-Hybridisierungspuffer mit Formamid

5 x SSC
0.1% Natriumlauroylsarkosin
0.02% SDS
2% Blockierungsreagenz
50% deionisiertes Formamid

Stoppuffer

9.5 mL Formamid
0.4 mL EDTA (500 mM)
5 mg Bromphenolblau
5 mg Xylencyanol FF
0.1 mL Aqua dest.

Stripping-Lösung

0.2 N Natronlauge
0.1% SDS

TAE-Puffer (50 x)

242 g Tris-Base
57.1 mL Essigsäure
100 mL EDTA (0.5 M)
ad 1000 mL Aqua dest.

TBE-Puffer (10 x)
(für Agarosegele)

108 g Tris-Base
27.5 g Borsäure
7.3 g EDTA
ad 1000 mL Aqua dest.

TBE-Puffer (10 x)
(für Sequenziergele)

162 g Tris-Base
27.5 g Borsäure
7.3 g EDTA
ad 1000 mL Aqua dest.

TB-Medium

12 g Trypton
24 g Hefeextrakt
4 mL Glycerin (87%)
ad 900 mL Aqua dest.
Nach dem Autoklavieren wurden 100 mL Phosphat-Puffer zugesetzt.

TE-Puffer

1 mM EDTA

Tricin-Puffer (10 x)

300 mM Tricin
500 mM Kaliumchlorid
pH 8.4

TSS-Lösung

0.5 M Tris-Salzsäure, pH 8.0
10% SDS

Waschlösung 1

0.1 x SSC
0.1% SDS

Waschlösung 2

6 x SSC
0.1% SDS

2.3 Biochemikalien und Kits


[Seite 24↓]

Tab. 2.3 Verwendete Biochemikalien bzw. Kits sowie deren Hersteller.

Substanz / Kit

Hersteller

AdvanTAge PCR Cloning Kit

Clontech, Heidelberg

AmpliTaq DNA-Polymerase

PerkinElmer, Rodgau-Jügesheim

Bovine Serum Albumin (BSA)

MBI Fermentas, St. Leon-Rot

Desoxynukleotidtriphosphat-Mix (dNTP)

Roche, Mannheim

DIG Luminescent Detection Kit
(mit: Anti DIG AP, Blockierungsreagenz, CSPD)

Roche, Mannheim

DIG Oligonucleotide 3’-End Labelling Kit

Roche, Mannheim

DIG-11-dUTP

Roche, Mannheim

DNA-Marker II, -III, -XIV

Roche, Mannheim

GFX Plasmidpräparationskit

Pharmacia Biotech, Freiburg

LighCycler DNA Master SYBR Green I Kit
(mit: LightCycler-Reaktionsmix)

Roche, Mannheim

Lysozym

Fluka, Neu-Ulm

Mung Bean Nuklease

Stratagene, Heidelberg

PlusOne DNA Silver Staining Kit

Amersham-Pharmacia, Freiburg

Proteinase K

Sigma-Aldrich, Steinheim

QiaQuick Gel Extraction Kit

Qiagen, Hilden

TA-Cloning Kit

Invitrogen, de Shelp, Niederlande

Desoxyadenosintriphosphat (dATP)

Roche, Mannheim

Desoxycytidintriphosphat (dCTP)

Roche, Mannheim

Desoxyguanosintriphosphat (dATP)

Roche, Mannheim

Desoxythymidintriphosphat (dATP)

Roche, Mannheim

Thermosequenase Fluorescent Labelled Primer Cycle
Sequencing Kit

Amersham-Pharmacia, Freiburg

2.4 Oligonukleotide


[Seite 25↓]

Tab. 2.4 Verwendete Primer und Oligonukleotidsonden.

Oligonuk-
leotid

Spezifität

Sequenz (5’ 3’)

Zielregion

Markierung

10-30Fa

Archaea

TCCGGTTGATCCTGCC

16S, 8-23

-

1114F

Bacteria

GCAACGAGCGCAACCC

16S, 1100-1115

IR

1390Ra

Archaea

CGGTGTGTGCAAGGAGC

16S, 1385-1401

-

357Fa

Archaea

ACGGGGCGCAGCAGGC

16S, 344-359

-

ARCH915

Archaea

GTGCTCCCCCGCCAATTCCT

16S, 915-934

Cy3

deb1007r

Dehalobacter restrictus

ACTCCCATATCTCTACGG

16S, 989-1007

-

deb179

Dehalobacter restrictus

TGCCTCTCGGACAATACA

16S, 179-197

Cy3

deb179f

Dehalobacter restrictus

TGTATTGTCCGAGAGGCA

16S, 179-197

-

EUB338

Bacteria

GCTGCCTCCCGTAGGAGT

16S, 338-355

Cy3

F-968

Bacteria

AACGCGAAGAACCTTAC

16S, 968-985

-

F-968-GC

Bacteria

(CGCCCGGGGCGCGCCCCGGGC
GGGGCGGGGGCACGGGGGG)AA
CGCGAAGAACCTTAC

16S, 968-985

-

M13(21)F

M13-Bindungsstelle

TGTAAAACGACGGCCAGT

universell

IR

M13(24)R

M13-Bindungsstelle

AACAGCTATGACCATG

universell

-

M13(24)R

M13-Bindungsstelle

AACAGCTATGACCATG

universell

IR

M13(40)F

M13-Bindungsstelle

GTTTTCCCAGTCCGAC

universell

-

MCONC

Methanosaeta concilii

GAGTACGCTGGCAACTGT

16S, 1120-1135

Cy3

MHOLL

Methanomethylovorans
hollandica

AAGAGGTACTACGGGGGT

16S, 668-686

Cy3

R-1401

Bacteria

CGGTGTGTACAAGGCCC

16S, 1384-1401

-

RTU2

Bacteria

TGCCTCCCGTAGGAGTYTGG

16S, 334-353

-

RTU8

Bacteria

AAGGAGGTGATCCANCCRCA

16S, 1522-1541

-

TPU1

Bacteria

AGAGTTTGATCMTGGCTCAG

16S, 8-27

-

TPU1

Bacteria

AGAGTTTGATCMTGGCTCAG

16S, 8-27

IR

2.5 Kontrollstämme

Tab. 2.5 Verwendete Kontrollstämme.

Stamm

Herkunft/Stammsammlung/
Nummer

Escherichia coli TOP10F

Invitrogen, de Shelp, Niederlande

Dehalobacter restrictus

DSMZ, DSM 9455

Sulfospirillum barnesii

DSMZ, DSM 10660

Clostridium symbiosum

DSMZ, DSM 934

Methanoculleus olentangyi

DSMZ, DSM 2772

Methanosarcina barkeri

DSMZ, DSM 800

Methanosaeta concilii

DSMZ, DSM 3671

Methanosarcina mazei

DSMZ, DSM 2053

Methanosarcina thermophila

DSMZ, DSM 1825

An Milchpulver bzw. Aktivkohle immobilisiertes Zellmaterial aus Stammkonserven wurde zunächst in je 1 mL sterilem PBS aufgenommen. Zellsuspensionen von Aktivkulturen wurden direkt weiterbehandelt. Die eine Hälfte einer jeweiligen Zellsuspension wurde für in-situ-Hybridisierungen durch Zugabe des gleichen Volumens Ethanol/PBS (1:1) fixiert. Aus der verbleibenden Hälfte wurde DNA mittels einer Schnellmethode präpariert. Dazu wurde die Zellsuspension zentrifugiert (1 min, 13800 g) und die sedimentierten Zellen nach Dekantieren des Puffers im gleichen Volumen TE resuspendiert. Der Ansatz wurde für 10 min bei 95°C erhitzt und zur Abtrennung von Zelltrümmern kurz abzentrifugiert. Die so präparierte DNA (Zellysat) wurde bei –20°C gelagert und direkt für PCR-basierte Methoden eingesetzt.


[Seite 26↓]

2.6  Entnahme von Flußsedimentproben, Kultivierung der mikrobiellen Sedimentpopulation und Probenentnahme aus dem Bioreaktor

Im August 1997 wurde eine Probe aus dem Flußsediment der Saale entnommen. Der Probenentnahmeort befand sich zwischen Korbetha und Rattmannsdorf (bei Halle, Sachsen-Anhalt) direkt vor der Mündung eines Abwasserkanals einer Propylenoxid- produzierenden Fabrik (Abb. 2.1). Etwa 20 Liter Sediment-Flußwassergemisch wurden mit Hilfe einer speziellen Sedimententschaufel entnommen und auf direktem Wege ins Labor transportiert. Das Probenmaterial wurde in 1 L–Kulturflaschen gefüllt und anschließend mit Mineralsalzmedium (Shelton und Tiedje, 1984) überschichtet, dem zuvor 3 mg/L DCP sowie 50 mg/L Methanol zugesetzt worden waren.

Abb. 2.1 Probenentnahmestelle an der Saale in der Nähe von Halle. Die Pfeile kennzeichnen den entsprechenden Flußabschnitt. Die hellgraue Fläche symbolisiert das Betriebsgelände des naheliegenden chemischen Industriestandorts (Buna-Werke).

Die Kultivierung der Mikroorganismen erfolgte anaerob bei 30°C unter Lichtabschluß. Die Konzentration des DCPs in den Kulturflaschen wurde täglich mit einem Headspace-Gaschromatographen mit Flammenionisationsdetektor (Sigma 2000, Perkin Elmer, Norwalk, USA) gemessen. Die DCP-Transformationsrate ließ sich wie folgt ermitteln: Transformation(DCP) = 100*c(DCP, Ablauf)/c(DCP, Zulauf) [%]. Nachdem eine stabile mikrobielle Transformation des DCPs vorlag, wurde einer der Ansätze mit würfelförmigen Polyurethanschaumstoffpartikeln (Bayvitec C, Bayer AG, Leverkusen) zusammenge-bracht. Einhundert PU-Körper von je 1 cm³ Volumen wurden über einen Zeitraum von 74 Tagen mit dem Sediment der Kulturflasche inkubiert. Danach wurden die an den PU-[Seite 27↓] Körpern immobilisierten Mikroorganismen am 28.01.1998 in einen anaeroben kontinuierlich betriebenen 5 L-Wirbelschichtreaktor aus Edelstahl überführt (Abb. 2.2). Der Reaktor wurde mit Mineralsalzmedium gespeist (Shelton und Tiedje, 1984), dem zuvor 7 mg/L DCP sowie 50 mg/L Methanol zugesetzt worden waren. In den Kopfraum des Reaktors wurde eine mit Glasobjektträgern versehene Halterung aus Edelstahl eingebaut ("Robins-Device"). Der pH-Wert und das Redoxpotential wurden mittels in den Reaktordeckel eingebauter Elektroden kontinuierlich erfaßt und durch einen angeschlossenen Mikrocomputer dokumentiert. Die DCP-Konzentrationen im Zulauf sowie Ablauf des Reaktors wurden täglich bestimmt. Vor der ersten Probennahme wurde der Reaktor zwei Monate lang unter konstanten Bedingungen betrieben. In diesem Zeitraum betrug die DCP-Transformation etwa 98% bei einem Redoxpotential von -380 mV, einem pH-Wert von 6.8 und einer hydraulischen Verweilzeit von 24 Stunden.

Abb. 2.2Schematische Darstellung des zur Kultivierung der DCP-transformierenden Mischkultur verwendeten Wirbelschichtreaktors.


[Seite 28↓]

Zur Probenentnahme (PU-Körper, Objektträger) wurde der Reaktordeckel kurzfristig entfernt und der Reaktorkopfraum kontinuierlich mit Stickstoff begast. Die Proben wurden zur Lagerung entweder direkt (für sich anschließende in-vitro-Amplifikations-verfahren) oder nach Überschichtung mit 50% Ethanol/PBS (für sich anschließende in- situ-Hybridisierungen) eingefroren. Während der Probennahme kam es aufgrund des Luftsauerstoffzutritts zu einer deutlichen Erhöhung des Redoxpotentials und damit zu einer Beeinträchtigung der DCP-Transformation. Die Reaktormischkultur hat sich jedoch nach Beendigung der Probennahme innerhalb kurzer Zeit wieder stabilisiert. Zwischen Tag 769 und 785 des Reaktorbetriebs wurden täglich zur gleichen Zeit 200 mL Wasserstoff in den Zulauf des Reaktors gegeben. Um hierbei eine mögliche Veränderung der DCP-Transformationsrate nachweisen zu können, wurde diese zuvor auf 45% gesenkt (Verminderung der Verweilzeit auf 20 Stunden sowie DCP-Konzentrationserhöhung von 45 mg/L im Zulauf). Die Kultivierung der DCP-transformierenden Mischkultur wurde im Rahmen der Kooperation innerhalb des Sonderforschungsbereichs 193 von Dr. Regine Hauck betreut (Arbeitsgruppe Prof. Dr. Hegemann, Institut für Siedlungswasserwirt-schaft, Technische Universität Berlin).

2.7 Präparation der DNA aus den Bioreaktorproben

Pro Bioreaktorprobe wurde die DNA eines PU-Körpers präpariert (modifiziert nach Tsai und Olson, 1991). Dazu wurde der PU-Körper aufgetaut und in 3.5 mL SE sowie 2.5 mL Lysozympuffer aufgenommen. Nach Zugabe und vollständiger Lösung von 0.175 mg Lysozym wurde der PU-Körper 2 Stunden lang bei 37°C inkubiert und anschließend in 6 mL TSS aufgenommen. Es folgten acht Einfrier- und Auftauzyklen des Probenmaterials durch sukzessives Eintauchen in flüssigen Stickstoff (jeweils 10 min), gefolgt von einer 10 minütigen Inkubation bei 65°C im Wasserbad. Nach Zugabe von 215 µL Proteinase K-Lösung (15.3 mg/L) wurde das Probenmaterial bei 50°C für 2.5 Stunden inkubiert. Die anschließende lichtmikroskopische Untersuchung des Biofilms ergab, daß die Morphologie der Mikroorganismen nicht mehr erkennbar war. Daraufhin wurde die DNA jeweils einmal mit Phenol, Phenol/Chloroform (1:1) und Chloroform aus der Flüssigphase des Ansatzes extrahiert. Die in der wässrigen Phase enthaltene DNA wurde durch Zugabe von einem Volumenteil (VT) absoluten Ethanol sowie 0.1 VT Natriumacetat-Lösung (3 M, pH 4.9) bei –80°C ü.N. gefällt. Der Ansatz wurde zentrifugiert (13800 x g, 1 h, 4°C), das erhaltene DNA-Präzipitat einmal mit Ethanol (70%) gewaschen und anschließend in 100 µL TE gelöst (10 min, 50°C). Zur Abtrennung niedermolekularer DNA sowie möglicherweise vorhandener PCR-Inhibitoren wurde eine Gelfiltration sowie eine präparative Agarosegelelektrophorese durchgeführt (Liesack und Stackebrandt, 1992). Dazu wurde zunächst ein 50 µL-Aliquot der in TE-Puffer gelösten Bioreaktor-DNA mittels einer S-300 [Seite 29↓] HR Säule (Pharmacia Biotech, Freiburg) gemäß Herstellerangaben gelfiltriert. Im Anschluß daran wurde die Probe mit 0.5 VT sterilem Agarosegel-Probenpuffer vermischt und mit einer zusätzlichen Negativkontrolle (nur steriler Probenpuffer) zur elektrophoretischen Trennung auf ein einprozentiges Agarosegel geladen. DNA-Banden mit einer Größe von mehr als 9 kb sowie der korrespondierende Bereich der Negativkontrolle wurden unter UV-Licht (356 nm) mit einem sterilem Skalpell aus dem Gel ausgeschnitten. Um eine Kontamination des Probenmaterials mit Fremd-DNA zu vermeiden, wurden zuvor sämtliche Kunststoffteile der Elektrophoresekammer mit sterilem Wasser sowie einer frisch angesetzten zehnprozentigen Peressigsäure-Lösung gepült und UV-bestrahlt. Die verwendeten Lösungen und Puffer wurden zuvor autoklaviert. Die in den ausgeschnittenen Gelstücken enthaltene Bioreaktor-DNA wurde mit Hilfe des QiaQuick Gel Extraction Kit (Qiagen, Hilden) nach Anleitung des Herstellers eluiert. Die Negativkontrolle wurde entsprechend behandelt.

2.8 Analyse der Bioreaktorproben anhand von 16S rDNA-Klonbibliotheken

2.8.1  PCR-Amplifikation der 16S rDNA aus den Bioreaktorproben

Die PCR-Amplifikation der aufgereinigten Bioreaktor-16S rDNA erfolgte in 50 µL-Ansätzen mit Hilfe eines Trioblocks (Biometra, Göttingen). Bei der Amplifizierung bakterieller 16S rDNA setzte sich der PCR-Ansatz wie folgt zusammen: 2 µL Bioreaktor-DNA, 1 x PCR-Puffer, 2 mM MgCl 2 , 0.5 µM TPU1, 0.5 µM RTU8, je 200 µM dNTP, 2.5 U AmpliTaq DNA-Polymerase, 2% (v/v) DMSO, 2.5 µg/µL BSA und 2 Tropfen Mineralöl. Das PCR-Reaktionsprotokoll ist in Tab. 2.6 dargestellt.

Tab. 2.6 PCR-Protokoll für Bacteria-spezifische 16S rDNA-Amplifikation.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

98°C

3 min

1x

Denaturierung

93°C

2 min

1x

Denaturierung

93°C

1 min

 

Primer-Hybridisierung

53°C

1 min

28x

Primer-Elongation

72°C

3 min

 

Primer-Elongation

72°C

7 min

1x


[Seite 30↓]

Die Amplifikation archaealer 16S rDNA fand in folgendem Reaktionsansatz statt: 2 µL Bioreaktor-DNA, 1 x Tricin-Puffer (Barns et al., 1994), 5% Acetamid, 2 mM MgCl 2 , je 0.5 µM 10-30Fa sowie 1390Ra bzw. je 0.5 µM 357Fa sowie 1390Ra, je 200 µM dNTP, 2.5 U AmpliTaq DNA-Polymerase, 2% (v/v) DMSO, 2.5 µg/µL BSA und 2 Tropfen Mineralöl. Das PCR-Reaktionsprotokoll ist in Tab. 2.7 dargestellt.

Tab. 2.7 PCR-Protokoll für Archaea-spezifische 16S rDNA-Amplifikation.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

94°C

6 min

1x

Denaturierung

92°C

1.5 min

 

Primer-Hybridisierung

50°C

1.5 min

30x

Primer-Elongation

72°C

3 min

 

Primer-Elongation

72°C

7 min

1x

Die DNA-Polymerase wurde während des Denaturierungsschritts separat in die Reaktionsgefäße pipettiert. Dieser “Hot-Start” erhöhte die Spezifität der Amplifikation durch Unterbindung der Polymeraseaktivität bei niedrigeren Temperaturen. In der Negativkontrolle wurde Wasser anstatt Template-DNA in den PCR-Ansatz gegeben. Als Positivkontrolle wurde Escherichia coli - bzw. Methanosaeta barkeri -Zelllysat verwendet.

2.8.2  Agarosegelelektrophorese der 16S rDNA-Amplifikate

Die qualitative Kontrolle der PCR erfolgte durch Auftrennung eines Gemisches aus je 5 µL Amplifikat und 3 µL Agarosegel-Probenpuffer in einem horizontalen einprozentigen Agarosegel. Zur Anfärbung der Nukleinsäuren wurde 1 µL Ethidiumbromidlösung (10 mg/mL) zu 100 mL heißer Agarose-Lösung gegeben. Als Längenmarker wurde DNA-Marker III verwendet. Die Trennung erfolgte bei 10 V/cm in 1 x TBE. Das Gel wurde anschließend mit dem Eagle Eye Videodokumentationssystem (Stratagene, Heidelberg) ausgewertet.

2.8.3  Klonierung der 16S rDNA aus den Bioreaktorproben

Die 16S rDNA-Amplifikate der Bioreaktorproben wurden mit Hilfe des TA-Cloning Kits (Invitrogen, de Shelp) oder des AdvanTAge PCR Cloning Kits (Clontech, Heidelberg) gemäß Herstellerangaben kloniert. Abweichend von den Empfehlungen wurden die zu klonierenden PCR-Produkte zunächst extrahiert und mit Hilfe des QiaQuick Gel Extraction Kit (Qiagen, Hilden) einer präparativen Agarosegelelektrophorese unterzogen (siehe 2.7). Diese Vorgehensweise führte zu einer effizienteren Transformation der bakteriellen 16S rDNA. Zur Klonierung wurden gemäß Herstellerempfehlung PCR-Produkte verwendet, die nicht älter als 24 Stunden waren. Die PCR-Produkte wurden in den Plasmid-Vektor [Seite 31↓] pCR2.1 (Invitrogen, de Shelp) bzw. in den identischen Vektor pT-Adv (Clontech, Heidelberg) ligiert. Die ligierten PCR-Produkte wurden in E. coli TOP10F’-Zellen transformiert. Die transformierten Zellen wurden auf LAXI-Agar kultiviert (37°C, ü.N.) und im Anschluß einem “Blue-White-Screening” unterzogen. Nach einmaliger Überimpfung und Kultivierung weißer Kolonien auf frischem LAXI-Agar wurde eine Kontroll-PCR zur Ermittlung der Insertlängen rekombinanter Plasmide durchgeführt. Dazu wurden die Inserts mit Hilfe der zu den flankierenden Plasmidbereichen komplementären Primern M13(40)F und M13(24)R in einem Trioblock (Biometra, Göttingen) amplifiziert. Als Ausgangs-DNA diente das Zellysat zu prüfender weißer Kolonien. Dazu wurde mit einem sterilen Zahnstocher Koloniematerial in 100 µL sterilem TE-Puffer aufgenommen, für 10 min bei 95°C erhitzt und anschließend kurz anzentrifugiert (Centrifuge 5415C, Eppendorf, Hamburg). Die PCR-Ansätze (25 µL) setzten sich zusammen aus jeweils 0.5 µL Zellysat einer weißen Kolonie, 1 x PCR-Puffer, 1.5 mM MgCl 2 , 0.5 µM M13(40)F, 0.5 µM M13(24)R, je 200 µM dNTP, 2.5 U AmpliTaq DNA-Polymerase und einem Tropfen Mineralöl. Das PCR-Reaktionsprotokoll ist in Tab. 2.8 dargestellt.

Tab. 2.8 PCR-Protokoll für universelle (M13) 16S rDNA-Amplifikation.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

95°C

5 min

1x

Denaturierung

92°C

1 min

 

Primer-Hybridisierung

53°C

1 min

28x

Primer-Elongation

72°C

3 min

 

Primer-Elongation

72°C

7 min

1x

In der Negativkontrolle wurde Wasser anstatt DNA in den PCR-Ansatz gegeben. Als Positivkontrolle diente E. coli -Zellysat eines Klons, dessen Plasmid-Insert sequenziert worden war. Die qualitative Kontrolle der PCR-Amplifikate erfolgte wie unter 2.8.2 beschrieben.

2.8.4  Plasmidpräparation

Zur Präparation der Plasmid-DNA wurden je 1 mL TB-Medium mit Ampicillin (50 µg/mL) mit Koloniematerial eines Klons beimpft und bei 37°C ü.N. unter Schütteln bebrütet. Die Isolation und Aufreinigung der Plasmid-DNA erfolgte mit Hilfe des GFX Plasmid-Präparationskits (Pharmacia Biotech, Freiburg) gemäß den Angaben des Herstellers. Während der Aufreinigung wurde abweichend vom empfohlenen Protokoll die an der Säulenmatrix gebundene Plasmid-DNA einmal zusätzlich mit 70 prozentigem Ethanol gewaschen. Zur Kontrolle wurden je 5 µL der isolierten Plasmid-DNA zusammen mit 3 µL Agarosegelprobenpuffer auf ein horizontales 0.8 prozentiges Agarosegel aufgetragen und [Seite 32↓] elektrophoretisch getrennt (siehe 2.8.2). Als Längenmarker wurde DNA Marker III verwendet. Nach Analyse des Gels unter UV-Licht konnte die Konzentration der erhaltenen Plasmid-DNA abgeschätzt werden.

2.8.5  Analyse der 16S rDNA-Klonbibliotheken durch Sequenzierung

Bei ausreichender Konzentration wurde die präparierte Plasmid-DNA direkt zur Sequenzierung verwendet. Im Falle einer geringen Plasmid-Konzentration wurden die 16S rDNA-Inserts zunächst mit Hilfe der Primer M13(40)F und M13(24)R PCR-amplifiziert (50 µL-Ansätze, siehe 2.8.3). Als Template dienten jeweils 0.5 µL der jeweiligen Plasmid-Präparation. Vor der Sequenzierung wurden die PCR-Produkte unter Verwendung von Silika (Siliziumdioxid) aufgereinigt (Boyle und Lew, 1995). Dazu wurde die wässrige Phase des PCR-Ansatzes mit 2 VT einer 6 M Natriumjodidlösung sowie 12 µL einer Silika-Suspension vermischt. Nach zehnminütiger Inkubation bei Raumtemperatur wurden die Silikapartikel kurz abzentrifugiert und das erhaltene Pellet zweimal mit je 200 µL Silika-Waschpuffer gewaschen. Anschließend wurde das Pellet in 45 µL TE aufgenommen und die DNA 10 min bei 50°C eluiert. Die Silikapartikel wurden danach mittels Spin-Filtern (Bio101, Heidelberg) abgetrennt. Eine qualitative Kontrolle der PCR-Amplifikate erfolgte wie unter 2.8.2 beschrieben, jedoch mit DNA Marker III. Nach Analyse des Gels unter UV-Licht konnte die jeweilige Konzentration der gereinigten PCR-Produkte abgeschätzt werden.

Zur DNA-Sequenzierung wurde die zyklische Methode mit fluoreszenzmarkierten Primern angewandt. Für die Analyse der 16S rDNA-Inserts kamen die universellen Sequenzierprimer M13(21)F und M13(24)R zum Einsatz sowie die bakterienspezifischen Primer TPU1 und 1114F. Alle Reaktionen wurden mit dem Thermosequenase Fluorescent Labelled Primer Cycle Sequencing Kit (Amersham-Pharmacia, Freiburg) durchgeführt. Ein Reaktionsansatz (8 µL) enthielt 3 - 5 µL aufgereinigtes PCR-Produkt bzw. aufgereinigte Plasmid-DNA, 4 pmol fluoreszenzmarkierten Primer, 1.5 % DMSO, 1 - 2 µL A-, C-, G- oder T-Reagenz sowie einen Tropfen Mineralöl. Die Sequenzierreaktionen wurden entweder mit dem Omni-Cycler (Hybaid, Heidelberg) oder mit dem Trioblock (Biometra, Göttingen) nach dem in Tab. 2.9 dargestellten Protokoll durchgeführt.

Tab. 2.9 Amplifikationsprotokoll der 16S rDNA-Sequenzierreaktionen.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

95°C

5 min

1x

Denaturierung

95°C

0.5 min

 

Primer-Hybridisierung

55-58°C

0.5 min

28x

Primer-Elongation

70°C

1 min

 


[Seite 33↓]

Entgegen den Herstellerangaben wurden zu den Sequenzieransätzen unmittelbar nach Ablauf der Reaktion je 6 µL formamidhaltiger Stoppuffer gegeben und ein Aliquot der Ansätze (1.7 – 2 µL) auf ein vierprozentiges senkrechtes Polyacrylamidgel (Länge: 66 cm; Stärke: 0.25 mm) aufgetragen. Die Analyse der Sequenzierprodukte erfolgte auf einem automatischen LI-COR 4000L DNA-Sequenzierer (MWG-Biotech, Ebersberg) mit der dazugehörigen Auswertesoftware (BaseImageIR v2.20, MWG-Biotech, Ebersberg).

2.8.6  Phylogenetische Analyse der 16S rDNA Sequenzen

Zunächst wurden die ermittelten 16S rDNA-Sequenzen mit den in öffentlichen Datenbanken hinterlegten Sequenzen verglichen (Stand: Januar 2001), um eine orientierende phylogenetische Zuordnung zu erhalten. Dazu wurden die Anwendungen FASTA oder BLASTN2 des HUSAR Programm-Pakets (Deutsches Krebsforschungszentrum Heidelberg, Heidelberg, http://genius.embnet.dkfz-heidelberg.de/menu/cgi.bin/w2h/w2h. start) verwendet. Das Alignment der 16S rDNA-Sequenzen sowie die Erstellung von phylogenetischen Stammbäumen erfolgte mit Hilfe des UNIX-basierten ARB Programm-Pakets (Technische Universität München, München, http://www.mikro.biologie.tu-muenchen.de/pub/ARB/documentation/ARB.ps). Die lokale ARB-Sequenzdatenbank wurde mit den durch FASTA bzw. BLASTN2 ermittelten Sequenzen stetig aktualisiert. Zur Erstellung von phylogenetischen Stammbäumen wurde die “Neighbor joining” (Saitou und Nei, 1987) mit einer Korrektur nach Jukes und Cantor (1969) sowie einer Bootstrap-Analyse (Felsenstein, 1985) angewandt. Um Fehler durch ungleich lange Sequenzen zu minimieren, wurden die Dendogramme z.T. mit Hilfe entsprechender Konsensusmasken erzeugt. Die Stammbäume wurden zusätzlich mittels der PHYLIP-PARSIMONY-Methode (Ludwig et al., 1998) berechnet, um die Reproduzierbarkeit der Verzweigungsmuster zu überprüfen. Um möglicherweise auftretende Sequenzchimären zu identifizieren, wurden alle Sequenzen mit dem CHECK-CHIMERA-Programm geprüft (Larsen et al., 1993).

2.8.7  Analyse der bakteriellen 16S rDNA-Klonbibliotheken durch Dot-Blot- Hybridisierung mit Polynukleotidsonden

Neben direkter Sequenzierung der 16S rDNA-Inserts ausgewählter Klone wurden die bakteriellen Klonbibliotheken durch Dot-Blot-Hybridisierung mit Digoxygenin-markierten Polynukleotidsonden durchgemustert (von Wintzingerode et al., 1999). Dazu wurde die präparierte Plasmid-DNA (siehe 2.8.4) zunächst für 3 min bei 95°C denaturiert und anschließend in Eis abgekühlt. Je 1 µL der denaturierten DNA wurde auf eine positiv geladene Nylonmembran (Roche, Mannheim) pipettiert. Die Membran wurde von beiden Seiten auf einem UV-crosslinker (Modell TFL20M, MWG Biotech, Ebersberg) je 3 min mit UV-Licht (λ = 312 nm) bestrahlt, so daß die DNA durch UV-Quervernetzung auf der Membran fixiert wurde.


[Seite 34↓]

Zur Herstellung der Polynukleotidsonden wurden zunächst 0.5 µL Plasmid-DNA eines entsprechenden Klons oder aber 1 µL Zellysat eines Referenzstamms unter Verwendung der Primer M13(40)F und M13(24)R PCR-amplifiziert (vgl. 2.8.5). Aliquots dieser PCR-Reaktionen wurden 1:1000 in TE verdünnt und dienten als Ausgangs-DNA für eine zweite nachgeschaltete Amplifikation mit den Primern TPU1 und RTU2. Dieser “nested PCR”-Ansatz sollte eine mögliche Koamplifizierung kontaminierender E. coli -16S rDNA verhindern. Darüber hinaus wurde dem zweiten Ansatz DIG-11-dUTP zugesetzt. Die TPU1/RTU2-Amplifikation erfolgte in 25 µL-Ansätzen in einem Trioblock (Biometra, Göttingen). Der Ansatz setzte sich wie folgt zusammen: 1 µL M13-PCR-Produkt (1:1000 in TE), 1 x PCR-Puffer, 2 mM MgCl 2 , 0.5 µM TPU1, 0.5 µM RTU2, 7.5 µL DIG PCR-Mix, 2.5 U AmpliTaq DNA-Polymerase und 1 Tropfen Mineralöl. Das PCR-Reaktionsprotokoll ist in Tab. 2.10 dargestellt.

Tab. 2.10 PCR-Protokoll zur Herstellung DIG-markierter 16S rDNA-Polynukleotidsonden.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

95°C

5 min

1x

Denaturierung

92°C

1 min

 

Primer-Hybridisierung

60°C

1 min

28x

Primer-Elongation

72°C

1 min

 

Primer-Elongation

72°C

5 min

1x

In der Negativkontrolle wurde Wasser anstatt DNA in den PCR-Ansatz gegeben. Als Positivkontrolle wurde E. coli-Zellysat verwendet. Die qualitative Kontrolle der PCR-Amplifikate erfolgte wie unter 2.8.2 beschrieben, jedoch mit DNA Marker XIV.

Zur nachfolgenden Hybridisierung wurden je 3 - 3.5 µL der DIG-markierten Polynukleotidsonden in 20 mL Standard-Hybridisierungspuffer mit Formamid gegeben und 10 min bei 68°C denaturiert. Zuvor wurden die Nylonmembranen 30 min bei 60°C in 40 mL Standard-Hybridisierungspuffer vorhybridisiert. Die anschließende Hybridisierung der Membran mit den DIG-markierten Polynukleotiden erfolgte 4 Stunden bei Temperaturen zwischen 60 und 62°C. Alle Hybridisierungen wurden in Hybridisierungsglasröhren (200 mL) und in einem Hybridisierungsofen der Firma MWG-Biotech (Ebersberg) durchgeführt. Nach Abgießen des Standard-Hybridisierungspuffers mit Formamid wurden die Membranen zweimal mit je 40 mL Waschlösung 1 bei 68°C jeweils 25 min gewaschen.

Der Nachweis der gebundenen DIG-markierten Polynukleotide erfolgte mit Hilfe des DIG Luminescence Detection Kit (Böhringer, Mannheim) bei Raumtemperatur. Zunächst wurden die Membranen für 3 min mit Maleinsäure-Puffer gespült. Es folgte eine jeweils [Seite 35↓] 30 minütige Inkubation in einprozentiger Blockierunglösung und anschließend in Anti-DIG-AP-Konjugat. Die Membranen wurden zweimal für je 15 min in Maleinsäurepuffer gespült und 3 min in Detektionspuffer äquilibriert. Danach wurden die Membranen für 5 min in CSPD-Substrat inkubiert, getrocknet und in einer Röntgenfilmkassette (MS-Laborgeräte, Heidelberg) auf einen Röntgenfilm (Amersham Pharmacia Biotech, Freiburg) gelegt. Nach einer Belichtung von zunächst 15 min bei 37°C und anschließend 1 h bei Raumtemperatur wurde der Röntgenfilm mit Hilfe eines Hyperprozessors (Amersham Pharmacia Biotech, Freiburg) entwickelt. Um eine erneute Hybridisierung der Membranen zu ermöglichen, wurden gebundene Oligonukleotide durch Waschen mit Stripping-Lösung (2 x 30 min bei 37°C) entfernt.

2.8.8  Analyse der Archaea-16S rDNA-Klonbibliotheken durch Dot-Blot- Hybridisierung mit Oligonukleotidsonden

Analog zur bereits beschriebenen Vorgehensweise bei den bakteriellen Klonbibliotheken (siehe 2.8.7) wurde zum Durchmustern der Archaea-Klonbibliotheken die Plasmid-DNA der betreffenden 16S rDNA-Klone mit Hilfe des GMX Plasmid Präparationskits präpariert und anschließend auf positiv geladenen Nylon-Membranen immobilisiert. Für die nachfolgende Dot Blot Hybridisierung der Membranen wurden die entsprechenden Oligonukleotide durch Verwendung des DIG Oligonucleotide 3’-End Labelling Kits (Roche, Mannheim) gemäß Angaben des Herstellers enzymatisch (Terminale Transferase) mit Digoxygenin markiert. Für jede Reaktion wurden 100 pmol Oligonukleotid eingesetzt. Zur Überprüfung der Markierungsausbeute wurden Verdünnungsreihen des Eduktes und eines DIG-markierten Standards (Roche, Mannheim) verglichen. Dies erfolgte durch die Dot- Blot-Hybridisierung einer Test-Membran mit anschließender Detektion der Chemilumineszenz. Zur Dot-Blot-Hybridisierung der Proben-Membranen wurden je 10 pmol der DIG-markierten Oligonukleotidsonden in 20 mL Standard-Hybridisierungspuffer gegeben und die Membranen 2 Stunden bei 37°C hybridisiert. Zuvor wurde eine Vorhybridisierung in 40 mL Standard-Hybridisierungspuffer durchgeführt (30 min bei 60°C). Für alle Hybridisierungen wurden Hybridisierungsglasröhren (200 mL) sowie ein Hybridisierungsofen der Firma MWG-Biotech (Ebersberg) verwendet. Nach Abgießen des Standard-Hybridisierungspuffers wurden die Membranen zweimal mit je 25 mL Waschlösung 2 je 15 min bei 52-54°C gewaschen. Der Nachweis der gebundenen DIG-markierten Polynukleotide erfolgte mit Hilfe des DIG Luminescence Detection Kit (Böhringer, Mannheim) wie unter 2.8.7 beschrieben.


[Seite 36↓]

2.9  Analyse der Bioreaktorproben mittels Denaturierender Gradientengelelektrophorese (DGGE)

2.9.1  Amplifikation und Trennung der 16S rDNA aus den Bioreaktorproben

Die Amplifikation und anschließende Auftrennung der Bioreaktor-16S rDNA in der DGGE wurde im Rahmen einer Kooperation mit dem Institut für Bodenökologie des GSF-Forschungszentrums für Umwelt und Gesundheit (Neuherberg, Bayern) von Claudia von Wintzingerode durchgeführt. Dazu wurde aus der aufgereinigten Bioreaktor-DNA (siehe 2.7) ein 435 bp langes 16S rDNA-Fragment unter Verwendung der Primer F-968-GC sowie R-1401 (Engelen et al., 1998) PCR-amplifiziert. Die Amplifikation erfolgte in 50 µL-Ansätzen der folgenden Zusammensetzung: 2 µL Template-DNA, 1 x PCR-Puffer, 3 mM MgCl 2 , je 0.2 µM Primer, 100 µM dNTP, 5 U AmpliTaq DNA-Polymerase und 1 Tropfen Mineralöl. Um unspezifische Amplifikation zu minimieren, wurde die Taq-Polymerase während der Denaturierung zugegeben (Hot-Start). Das PCR-Reaktionsprotokoll ist in Tab. 2.11 dargestellt.

Tab. 2.11 PCR-Protokoll für die DGGE.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

95°C

10 min

1x

Denaturierung

93°C

1 min

 

Primer-Hybridisierung

54°C

1 min

28x

Primer-Elongation

72°C

1 min

 

Primer-Elongation

72°C

10 min

1x

Die PCR-Produkte wurden mit Hilfe des QIAquick PCR Purification Kits (Qiagen, Hilden) nach Angaben des Herstellers aufgereinigt. Einzelstrang-DNA wurde durch einen Mung Bean Nuklease-Verdau entfernt (Simpson et al., 1999). Das Reaktionsgemisch (30 µL-Ansatz) enthielt 15 µL PCR-Produkt, 1x Mung Bean Nuklease Puffer sowie 3 U Mung Bean Nuklease und wurde 10 min bei 37°C inkubiert.

Für die DGGE der PCR-Produkte wurde das D-Gene System (Biorad, München) verwendet. Die PCR-Produkte wurden in einem sechsprozentigen Polyacrylamidgel bei einer Temperatur von 60°C und einer Spannung von 70 V innerhalb von 18 Stunden aufgetrennt. Das Gel wurde anschließend gemäß Herstellerempfehlung silbergefärbt (PlusOne DNA Silver Staining Kit, Amersham-Pharmacia, Freiburg), luftgetrocknet, in Folie eingeschweißt und gescant. Die Auswertung des digitalen Gelabbildes erfolgte mit Hilfe der RFLPscan Plus Software (Version 3.0, Scanalytics, Fairfax, USA). Ermittelt wurden die relative Abundanz einer jeweiligen DGGE-Bande (rA), die Anzahl der [Seite 37↓] distinkten Banden einer Probe (S; Dunbar et al., 2000) sowie die Ähnlichkeit der Bandenmuster einzelner Proben untereinander in Form des Sorenson Index, CS, mit: CS = 2j / (a+b), wobei a der Anzahl der Banden in Spur 1, b der Anzahl der Banden in Spur 2 und j der Anzahl der Banden in beiden Spuren entspricht.

2.9.2  Analyse der 16S rDNA-Fragmente ausgewählter DGGE-Banden

Basierend auf der digitalen Auswertung wurden ausgewählte DGGE-Banden einer 16S rDNA-Sequenzanalyse unterzogen. Dazu wurden die betreffenden Banden zunächst mittels eines sterilen Skalpells ausgeschnitten, in sterilem Wasser eluiert (50°C, 10 min) und anschließend mit den Primern F-968 und R-1401 (Engelen et al., 1998) reamplifiziert. Mit Ausnahme einer höheren Annealingtemperatur von 60°C entsprach das Reaktionsprotokoll dem unter 2.9.1 beschriebenen. Die Kontrolle der PCR-Amplifikate erfolgte wie unter 2.8.2 beschrieben, jedoch unter Verwendung von DNA Marker XIV. Die 16S rDNA-Reamplifikate wurden mit Hilfe des TA-Cloning Kits (Invitrogen, de Shelp) kloniert (siehe 2.8.3). Die Plasmid-DNA ausgewählter Klone wurde präpariert (siehe 2.8.4) und direkt zur Sequenzierung verwendet. Die Sequenzierung erfolgte unter Verwendung der Primer M13(21)F und M13(24)R (siehe 2.8.5). Die Sequenzauswertung wurde analog zu 2.8.6 durchgeführt.

2.10 Analyse der Bioreaktorproben mittels quantitativer Echtzeit-PCR

Die QE-PCR wurde mit Hilfe des LightCyclers (Roche, Mannheim) durchgeführt. Mit Hilfe dieser Technologie kann die Zunahme der Amplifikationsprodukte während einer PCR-Reaktion durch Detektion von Fluoreszenzenergie verfolgt werden. Im vorliegenden Protokoll wurde dem PCR-Reaktionsmix SYBR Green I zugefügt. Dieser Fluoreszenzfarbstoff bindet selektiv an doppelsträngige DNA und emittiert bei entsprechender Anregung Fluoreszenzenergie, die das optische System des LightCyclers erfaßt. Auf diese Weise kann die Kinetik der Produktzunahme und damit die Ausgangskonzentration des Templates ermittelt werden.

Die PCR-Amplifikation der aufgereinigten Bioreaktor-DNA (siehe 2.7) erfolgte in 20 µL-Ansätzen unter Verwendung des LightCycler-DNA Master SYBR Green I Kits (Roche, Mannheim). Der Reaktionsansatz setzte sich zusammen aus 1 µL Template-DNA, 2 µL Reaktionsmix, 1% DMSO, zusätzlichen 1.3 mM MgCl 2 , zusätzliche 0.5 U AmpliTaq DNA-Polymerase sowie jeweils 0.5 µM Primer (TPU1 und RTU8 bzw. deb 179f und deb1007r). Die Reaktionen fanden in Kunststoffkapillaren mit geeigneten optischen Eigenschaften statt. Das PCR-Reaktionsprotokoll ist in Tab. 2.12 dargestellt.


[Seite 38↓]

Tab. 2.12 Amplifikationsprotokoll der QE-PCR.

 

Temperatur

Zeit

Zyklen

Initiale Denaturierung

98°C

3 min

1x

Denaturierung

93°C

1 min

 

Primer-Hybridisierung

53°C

1 min

28x

Primer-Elongation

72°C

3 min

 

Primer-Elongation

72°C

7 min

1x

Bei der Amplifizierung mit den Primern TPU1 bzw. RTU8 wurde E. coli -Zellysat als Positivkontrolle verwendet. Bei der Amplifizierung mit den Primern deb179f bzw. deb1007r wurde Dehalobacter restrictus -Zellysat als Positivkontrolle sowie Zellysat von Sulfospirillum barnesii - (eine Fehlbase) und Clostridium symbiosum - (zwei Fehlbasen) als Negativkontrollen verwendet. In beiden PCR-Ansätzen wurde in der Reagenzkontrolle Wasser anstatt DNA gegeben. Um die Konzentration des Templates in einer jeweiligen Probe ermitteln zu können, wurden während der PCR Verdünnungsreihen definierter DNA-Konzentration mitgeführt. Zu diesem Zweck wurde Plasmid-DNA des Dehalobacter-ähnlichen Klons SHA-67 (Primer deb179f / deb1007r) sowie des bakteriellen Klons SHA-116 (Primer TPU1 / RTU8) verwendet. Die Konzentration der Plasmid-DNA wurde durch Bestimmung der Licht-Absorption bei 260 nm mit Hilfe eines Ultrospec III Photometers (Pharmacia, Freiburg) bestimmt (Sambrook et al., 1989). Da 50 µg/mL doppelsträngige DNA eine Absorption (260 nm) von etwa 1 aufweist, konnten die Konzentrationen der Plasmid-DNAs von Klon SHA-67 sowie SHA-116 gemäß dieses empirischen Zusammenhangs ermittelt werden. Die Plasmid-DNAs beider Klone wurde in Zehnerschritten von 10-1 bis 10-6 verdünnt und als Template eingesetzt. Die PCR wurde mit einer Temperaturänderungsrate von 1°C/sec durchgeführt. Am Ende einer jeden Primerextension wurden die Fluoreszenzemissionen des an doppelsträngiger DNA gebundenen SYBR Greens I gemessen. Im Anschluß an die PCR wurden die Meßergebnisse mittels “Fit Points”-Methode analysiert (LightCycler-Software, Version 3; Roche, Mannheim). Die Basislinie wurde arithmetisch korrigiert, die Anzahl der Näherungspunkte betrug zwei. Zur Kontrolle wurde das PCR-Produkt analog zu 2.8.2 mit DNA-Marker XIV in einem einprozentigen Agarosegel aufgetrennt.


[Seite 39↓]

2.11  Analyse der Bioreaktorproben durch Fluoreszenz-In-Situ-Hybridisierung (FISH)

2.11.1  Fixierung und Vorbehandlung des Zellmaterials

Die entnommenen Proben wurden durch Überschichtung mit einem Ethanol/PBS-Gemisch (1:1) fixiert und bei –20°C gelagert. Parallel dazu wurden alle Proben zusätzlich mit einem Ethanol/PBS-Gemisch (1:1) überschichtet, dem zuvor 1% (v/v) Formaldehyd (37%) zugesetzt worden war. Fixierte Mikroorganismen aus Reinkulturen wurden direkt für die FISH eingesetzt, während Proben aus Misch- bzw. Sedimentkulturen einer Vorbehandlung unterzogen wurden (Zarda et al., 1997). Dazu wurde jeweils ein PU-Würfel mit einem sterilen Skalpell in kleinst-mögliche Teile (ca. 2 mm²) zerschnitten. Eines davon wurde mit 20 µL der Biomasse-haltigen Fixationslösung überschichtet, mit 980 µL Natriumpyrophosphat-Lösung aufgefüllt und für 5 sec ultrabeschallt (Energiestufe: MS72/D, Puls: 20%, Gerät: Sonoplus GM70, Bandelin, Berlin). Das auf diese Weise vorbehandelte Probenmaterial wurde am selben Tag verwendet, da das Natriumpyrophosphat zur Lyse der Zellen führte.

2.11.2  Hybridisierung der Mikroorganismen mit spezifischen Fluoreszenz-farbstoff-markierten Oligonukleotiden und Färbung mit DAPI

Die Hybridisierungen wurden auf Glasobjektträgern (Marienfeld, Bad Mergentheim) durchgeführt, die über je 6 kreisförmige Kopartimente (Durchmesser = 8 mm) verfügten. Nach Reinigung der Objektträger mit Ethanol wurden pro Kompartiment 10 µL Zellsuspension aufgetragen. Die Objektträger wurden bei 37°C bis zur völligen Eintrocknung des Zellmaterials inkubiert und anschließend in einer aufsteigenden Ethanolreihe (je 3 min in 50, 80 und 96 prozentigem Ethanol) entwässert. Danach wurden je 10 pmol einer fluoreszenzmarkierten Sonde in 10 µL Hybridisierungspuffer pro Kompartiment zugesetzt und die Objektträger in einer feuchten Kammer bei 46 – 48°C zwischen 2 und 3 Stunden bei Lichtabschluß hybridisiert. Durch Variation der Hybridisierungstemperatur sowie der Formamid-Konzentration im Hybridisierungspuffer wurde die Stringenz der FISH eingestellt. Objektträger, feuchte Kammer sowie Hybridisierungspuffer wurden auf Hybridisierungstemperatur vorgewärmt. Nach der Hybridisierung wurden die Objektträger kurz mit Wasser gepült, luftgetrocknet und mit "Mountingfluid" (Citifluor Ltd., London, UK) eingedeckt.


[Seite 40↓]

2.11.3  Mikroskopischer Nachweis

Der Nachweis fluoreszenzmarkierter Zellen erfolgte mittels Epifluoreszenzmikroskopie mit einem Axioskop Fluoreszenzmikroskop (Zeiss, Göttingen) unter Verwendung der Filtersätze F41-001, F41-007 (beide AHF Analysentechnik, Tübingen) sowie 02 G 365 (Zeiss, Göttingen). Bei 1000-facher Vergrößerung wurden Phasenkontrast- bzw. Epifluoreszenzbilder der Präparate erstellt. Die Dokumentation erfolgte mit Hilfe einer am Mikroskop installierten Kamera (Zeiss, Göttingen) auf Kodak Ektachrome HC-400 Dia-Film (Kodak, Hamburg). Die Belichtungszeiten variierten zwischen 0.25 und 60 sec.


© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.
DiML DTD Version 3.0Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML-Version erstellt am:
20.09.2004