Schmitt, Roland: Die Expression von Natrium-Transportproteinen im distalen Rattennephron während der Ontogenese

18

Kapitel 3. Material und Methoden

3.1 Versuchstiere und Gewebeprozessierung

Für die vorliegende Arbeit wurden Sprague-Dawley Ratten verschiedener postnataler Stadien (Tag 1, 3, 4 und 8 post partum) perfusionsfixiert.

3.1.1 Perfusionsfixierung und Gewebsprozessierung für Immunhistochemie und In situ-Hybridisierung

Die Tiere wurden mit Hilfe von Äther anästhesiert. Der Brustkorb wurde eröffnet und das Herz freipäpariert. Der Blutkreislauf wurde am linken Ventrikel geöffnet und über einen Polyethylenschlauch mit einem Perfusionssystem verbunden. Zeitgleich mit dem Beginn der Perfusion wurde durch einen Schnitt in das rechte Atrium ein Druckausgleich zum Perfusionsdruck geschaffen. Bei einem konstanten Perfusionsdruck von 1,50 m Wassersäule wurde zuerst für 30 Sek. mit Phosphatpuffer (PBS; 8 g NaCl, 240 mg KH2PO4, 1,78 g Na2HPO4, 200 mg KCl in 1000 ml H2O; pH 7,4) vorgespült und anschließend 5 Min. mit Paraformaldehyd (Merck, Darmstadt) fixiert. Das Paraformaldehyd wurde vor jeder Perfusionsreihe als 3%ige Lösung in PBS frisch angesetzt und auf pH 7,4 eingestellt. Nach der Fixierung wurden die Nieren entnommen, durch einen Horizontalschnitt geteilt und zum Schutz vor Gefrierartefakten für mehrere Stunden bei 4°C in einer Saccharose-PBS Lösung (800 mOsm/kg H2O, pH 7,4) immergiert. Anschließend wurde das Gewebe auf Styroporplättchen aufgebracht und in Stickstoff-gekühltem Isopentan (Riedel-de Haen, Seelze) schockgefroren.

3.1.2 Perfusionsfixierung und Gewebsprozessierung für feinstrukturelle Morphologie

Die Tiere wurden mit einer intraperitonealen Injektion Nembutal (Sanofi-CEVA, Bad Segeberg; 40 mg/kg Körpergewicht) anästhesiert. Nach Eröffnung des Bauchraumes wurde die Aorta abdominalis freipräpariert und über einen ausgezogenen Polyethylenschlauch mit dem Perfusionssystem verbunden. Bei Perfusionsbeginn wurde zum Druckausgleich die


19

untere Vena cava geöffnet, und die Nieren wurden retrograd zuerst mit PBS vorgespült und anschließend für 5 Min. perfusionsfixiert. Als Fixierlösung diente eine Lösung aus 3% Glutaraldehyd (Merck, Darmstadt) und 1,5% Paraformaldehyd in PBS (pH eingestellt auf 7,4). Nachdem die Nieren entnommen worden waren, wurden mit einer Rasierklinge schmale Gewebeblöckchen zugeschnitten. Diese wurden über Nacht bei 4°C in einer Immersionslösung nachfixiert, die in ihrer Zusammensetzung der Perfusionslösung entsprach.

Anschließend wurde das Gewebe in einer Ethanolreihe aufsteigender Konzentration (je 15 Min. in 50%, 70%, 90%, 96% Ethanol und 3x 20 Min. 100% Ethanol) entwässert, über Nacht in einem 1:1 Gemisch aus Propylenoxid und Epon (beides Fluka, Buchs, Schweiz) inkubiert und dann in Beem-Kapseln (Roth, Karlsruhe) gegeben, die mit Epon aufgefüllt wurden. Die Aushärtung erfolgte über drei Tage bei 60°C.

3.2 Morphologische Analyse

3.2.1 Lichtmikroskopische Morphologie

An einem Ultramikrotom (LKB, Ultrotom 8800) wurden Semidünnschnitte (1µm) von Epon-eingebettetem Gewebe angefertigt und auf Alkohol-gereinigte Objektträger aufgebracht. Die Schnitte wurden mit Methylenblau-Azur (nach Richardson) gefärbt und mit Eukitt (Riedel-de Haen) eingedeckt. Die Untersuchung und das Photographieren der Semidünnschnitte erfolgte an einem DMRB Lichtmikroskop der Firma Leica.

3.2.2 Elektronenmikroskopische Morphologie

Ultradünnschnitte (60 nm) für die Transmissions-Elektronenmikroskopie wurden an einem Ultracut-Mikrotom (Leica) angefertigt. Zu diesem Zweck wurden von einem Epon-Gewebeblöckchen zuerst so lange Semidünnschnitte heruntergeschnitten und nach Färbung lichtmikroskopisch beurteilt, bis sich interessante Strukturen auf den Schnitten identifizieren ließen. War dies der Fall, so wurden von demselben Gewebsblöckchen Ultradünnschnitte hergestellt. Die Schnitte wurden auf Schlitznetzchen (Plano, Wetzlar) aufgebracht, die mit


20

Formvar (Sigma, St. Louis, USA) beschichtet waren, und wurden mit 5% Uranylacetat (Merck, Darmstadt) für 15 Min., sowie mit Bleicitrat (Merck, Darmstadt) für 2 Min. nachkontrastiert. Die Schnitte wurden an einem ZEISS EM 900 Elektronenmikroskop analysiert und photographiert.

3.3 In situ-Hybridisierung

3.3.1 In situ-Hybridisierung mit nicht-radioaktivem Detektionssystem

3.3.1.1 Präparation der cDNA-Matrizen

Zur Herstellung der Riboproben für NaPi2 wurde aus einem Rattennieren-RNA-Extrakt mittels RT-PCR ein 794 bp langes cDNA-Fragment generiert. Die hierzu nötigen Primer waren entsprechend Magagnin et al. 1993 so gewählt, daß die synthetisierte Sequenz die Positionen 1561-2355 der mRNA für NaPi2 umfaßte (+1561 5´ GCAAACGCACTGCCAAGTACCGC 3´ und +2355 5´-CCAGCTGCTCTTCTGCCTCTCC-3´). Die Identität der generierten Probe wurde durch maschinelle Sequenzierung (Perkin-Elmer) abgesichert. Die cDNA wurde in die multiple Klonierungsstelle des Vektors pBluescript KS+ (Stratagene, La Jolla, USA), der zuvor mit SmaI (Boehringer, Mannheim) geschnitten worden war, einkloniert. Die cDNAs zur Herstellung der anderen Riboproben waren im Labor von Prof.Dr. S. Bachmann schon zur Anwendung gekommen und lagen bereits in klonierter Form vor. Alle cDNAs waren in die EcoRV Stelle des pBluescript KS+ Vektors subkloniert. Diese Klonierungsstelle wird jeweils von einer Promotorstelle für die Transkriptionspolymerasen T3 und T7 flankiert. Im einzelnen handelte es sich bei den cDNAs um ein 712 bp langes cDNA-Fragment des thiazidsensitiven Na+-Cl--Kotransporters der Maus, das die Membrandomänen 1-7 umfaßt [Obermüller et al. 1995]; ein 375 bp langes cDNA-Fragment des bumetanidsensitiven Na+-K+-2Cl--Kotransporters der Maus, welches mit dem Aminosäureabschnitt 61-188 korrespondiert [Obermüller et al. 1996]; und ein 248 bp langes cDNA-Fragment der NAD-abhängigen 11 beta-Hydroxysteroiddehydrogenase Typ2 der Ratte [Bostanjoglo et al. 1998]. Im Falle der 11 beta-Hydroxysteroiddehydrogenase wurde die cDNA innerhalb des Plasmids als Matrize für die Transkription benutzt, nachdem das Plasmid vorher unter Verwendung von HindIII oder BamHI (Boehringer, Mannheim) linearisiert worden war.


21

Als Matrize zur Transkription der anderen Proben wurde statt des linearisierten Plasmids ein PCR-Produkt hergestellt. Dieses umfaßte den jeweiligen einklonierten cDNA-Abschnitt und die plasmideigenen Transkriptionspromotoren und wurde mittels PCR unter Verwendung von vektorspezifischen Primern synthetisiert. Durch Extraktion mittels Phenol/Chloroform und Lithium-Chlorid/Ethanolfällung (4 M LiCl/ 100% Ethanol) wurde die DNA aufgereinigt. Zur Qualitätskontrolle und zur Quantifizierung der DNA wurden Agarosegel-Elektrophoresen (Seakem-ME Agarose , FMC, USA) und photometrische Bestimmungen (GeneQuantII, Pharmacia Biotech) durchgeführt.

3.3.1.2 In vitro-Transkription zur Herstellung Digoxigenin-markierter Riboproben

Die in vitro-Transkription zur Herstellung markierter RNA-Proben wurde mit Hilfe einer T3 Polymerase bzw. einer T7 Polymerase (Boehringer, Mannheim) unter Verwendung von Digoxigenin-markiertem Substrat durchgeführt. Bei der Herstellung jeder Probe wurden in verschiedenen Ansätzen beide Polymerasen verwendet, so daß durch die komplementäre Leserichtung der Enzyme jeweils eine Antisense- und eine Sense-RNA-Probe entstand. Die Antisenseprobe, die das komplementäre Gegenstück zur zellulären mRNA bildet, diente als Nachweis für Proteinexpression, während die Sense-Probe als Kontrollsonde benutzt wurde.

Für die Transkription wurde jeweils 1µg des linearisierten Plasmids bzw. 0,3 µg des PCR-Produktes als Matrize eingesetzt und zusammen mit 13 µl Diethyl-Pyrocarbonat (DEPC, Sigma, St. Louis, USA) behandeltem H2O, 2 µl Transkriptionspuffer (Boehringer, Mannheim), 2 µl Nukleotidgemisch mit Digoxigenin-markiertem Uridin 5´-Triphosphat (DIG-Labeling Mix; Boehringer, Mannheim) und 2µl der jeweiligen RNA-Polymerase (Boehringer, Mannheim) für 2 ¼ Std. bei 37°C inkubiert. Danach erfolgte der Verdau der DNA-Matrize in einer ¼ -stündigen Inkubation mit RNAse freier DNAse (Boehringer, Mannheim). Die RNA wurde mit Lithium-Chlorid und 100% Ethanol gefällt, mit 80% Ethanol gewaschen und nach anschließendem Trocknen in 100 µl DEPC-H2O

aufgenommen. Um die RNA zu quantifizieren und die Güte des Transkriptionsproduktes zu beurteilen, wurden photometrische Bestimmungen und Agarosegel-Elektrophoresen durchgeführt.

Da die Zugänglichkeit zellulärer mRNA für lange Riboproben eingeschränkt ist, wurden die


22

markierten Riboproben für NaPi2 und NCC nach erfolgter Transkription durch alkalische Hydrolyse gekürzt. Hierzu wurden 50 µl gelöstes Transkript mit einem Carbonatpuffergemisch (20 µl 0,2 M NaHCO3/30 µl 0,2 M Na2CO3) bei 60°C inkubiert. Die Inkubationsdauer wurde entsprechend der Ausgangslänge der Riboprobe berechnet (NCC 33 Min.; NaPi2 37 Min.). Die Fällung der hydrolysierten RNA erfolgte analog zur Fällung der Transkripte (s.o.).

3.3.1.3 Hybridisierung Digoxigenin-markierter Riboproben

Für die In situ-Hybridisierung wurden Gefrierschnitte von 7 µm Dicke verwendet. Die Gefrierschnitte wurden an einem CM3000 Kryostat (Leica) hergestellt, auf silanisierte (1% Aminopropyltriethoxysilan in H2O, Sigma, St. Louis, USA) Objektträger aufgebracht und für 15 Min. in eisgekühltem 4% Paraformaldehyd (in PBS, pH 7,4) nachfixiert. Nach mehreren Waschschritten (3x 5 Min. PBS; 2x 5 Min. H2O; 2x 5 Min. PBS) und einem Deproteinierungsschritt (10 Min. 0,1 M HCl) wurden die Schnitte für 20 Min. in 0,25% Essigsäure (T.J.Baker, Holland)/0,1 M Triethanolamin (Sigma, St. Louis, USA) inkubiert. Es folgten zwei weitere 5-minütige Waschschritte in PBS und die Entwässerung der Schnitte in einer aufsteigenden Ethanolreihe (jeweils 5 Min. in 70%, 80% und 96% Ethanol). Nachdem die Schnitte für 20Min. bei Raumtemperatur luftgetrocknet worden waren, wurden sie mit einem Prähybridmix (50% deionisiertes Formamid [Merck, Darmstadt], 40 mM Tris-HCl [Trometamol, Merck, Darmstadt/HCl; pH 7,4], 25 mM EDTA [Roth, Karlsruhe], 20 mM NaCl, 0,25 mg/ml tRNA, 2,5x Denhardt-Lösung [100 x = 0,05% Ficoll, 0,05% Polyvinylpyrolidon und 0,05% bovines Serumalbumin], alle Produkte - soweit nicht anders angegeben - von Boehringer, Mannheim) bedeckt, und für 1-2 Std. bei 40°C in einer feuchten Kammer inkubiert. Nach Entfernen des Prähybridmix wurden die Schnitte mit dem Hybridmix (50% deionisiertes Formamid, 200 mM Tris-HCl [pH 7,4], 1 mM EDTA [pH 8], 0,2 M Dithiothreitol [Biomol, Hamburg], 0,33 M NaCl, 5 mg/ml tRNA, 1 mg/ml Heringsperma [beides Boehringer, Mannheim], 10x Denhardt-Lösung, 10% Dextransulfat [Sigma, St. Louis, USA], mit 2-8 pg Digoxigeninmarkierter Riboprobe [die optimale Sondenkonzentration wurde für jede Riboprobe austitriert]) überschichtet. Es wurden jeweils Sense- und Antisense-Hybridisierungen durchgeführt. Um eine Austrocknung der Schnitte zu verhindern wurden sie mit silikonisierten (Sigmacote, Sigma, St. Louis, USA) Deckgläschen bedeckt und für 18-20 Std. bei 40°C in einer feuchten Kammer inkubiert.Für die parallele Detektion von NKCC2- und NaPi2-mRNA wurden die entsprechenden Riboproben im selben


23

Hybridmix, dessen Zusammensetzung ansonsten unverändert blieb (s.o.), eingesetzt.

3.3.1.4 Entfernen nicht hybridisierter Riboproben

Die silikonisierten Deckgläschen wurden in einer Natriumzitratlösung (2x Standard Sodium Citrat, SSC = 18% NaCl/15% Na-Citrat [beides Merck, Darmstadt]) abgelöst und die Schnitte für 30 Min. in derselben Lösung bei 40°C gewaschen. Es folgten weitere Waschschritte in verschiedenen Waschlösungen bei unterschiedlichen Temperaturen (30 Min. in 0,38x SSC/50% deionisiertes Formamid und 1 Std. in 0,1x SSC/50 % deionisiertes Formamid, beide Waschschritte bei 40°C; 2x 10 Min. in 0,5x SSC und 10 Min. in 0,2x SSC bei Raumtemperatur).

3.3.1.5 Detektion der hybridisierten Riboproben

Zur Detektion der hybridisierten Riboproben wurden die Schnitte nach einer ½ Std. Inkubation mit Blockier-Medium (1% Boehringer Blockierungsreagens, 0,5% Rinderserumalbumin in 100 mM Tris-HCl [pH 7,5]/150 mM NaCl gelöst), mit einem alkalische Phosphatase-gekoppelten anti-Digoxigenin-Antikörper (Boehringer, Mannheim) in einer Verdünnung von 1:500 in Blockier-Medium beschichtet. Nach einer 1-2 stündigen Inkubation bei Raumtemperatur auf einem Schüttelgerät wurden die Schnitte über Nacht bei 4°C gelagert. Die enzymatische Farbentwicklung der Schnitte wurde unter Verwendung eines Entwicklungspuffers nach Boehringer (enthält Nitroblau Tetrazolium und 5Bromo-4Chloro-3Indolyl-Phosphat als Enzymsubstrate, sowie Levamisol [Sigma, St. Louis, USA] zur Hemmung endogener Phospatasen; pH 9,5) unter Lichtabschluss bei 4°C oder bei Raumtemperatur durchgeführt und in Abhängigkeit von der angestrebten Intensität der Nachweisreaktion nach 4-48 Std. abgestoppt. Nachdem die Schnitte 2x 15 Min. in Tris-puffer (100 mM Tris-HCl, 1mM EDTA, pH 8,0) gewaschen worden waren, folgten 2 weitere Waschschritte für jeweils 15 Min. in PBS. Abschließend wurden die Schnitte mit 50% Glycerin (Merck, Darmstadt)/PBS eingedeckt und an einem Leica DMRB Mikroskop mit Interferenzkontrastlicht ausgewertet.


24

3.3.2 Autoradioaktiv markierte In situ-Hybridisierung

Nachdem der Nachweis von rENaC-mRNA mit der Methode der nonradioaktiven In situ-Hybridisierung trotz mehrfacher Versuche nicht gelungen war, wurde die In situ-Hybridisierung für rENaC mit (35S)-markierten Riboproben zusammen mit M. Fey und Prof. Dr. N. Farman, INSERM U 246, in Paris durchgeführt.

3.3.2.1 Präparation der cDNA-Matritzen

Die cDNAs für die Herstellung (35S)-markierter Riboproben für die beta- und die gamma- Untereinheit des Amilorid-sensitiven Na+-Kanals entsprachen der 3´untranslatierten Region der jeweiligen mRNA aus der Rattenniere (Nukleotide 2150-2463 für die beta-Untereinheit und 2470-2911 für die gamma-Untereinheit) [Duc et al. 1994]. Die cDNAs waren in den pBluescript KS+ Vektor subcloniert, wurden mit BamHI oder KpnI (Stratagene) linearisiert und wie unter 3.3.1.2 beschrieben aufgereinigt.

3.3.2.2 In vitro-Transkription zur Herstellung (35S)-markierter Riboproben

Die Transkription erfolgte nach einem Protokoll analog zu 2.3.1.2, unter Verwendung von einem Transkriptions-Kit (Promega) und von (35S)-markiertem Uridin 5´-Triphosphat (35S- UTP, 1000 Ci/mmol; Amersham, USA). Die Bestandteile der Transkriptionslösung wurden mittels Ausschlußchromatographie (Nick Column, Sephadex G200, Pharmacia, Uppsala, Schweden) aufgetrennt und die RNA durch Ethanol-Präzipitation gefällt. Anschließend wurde der Erfolg der Inkorporation von (35S)-UTP anhand der Strahlungsaktivität der Riboproben in einem Szintillationszähler kontrolliert.


25

3.3.2.3 Hybridisierung (35S)-markierter Riboproben

Gefrierschnitte (7 µm) wurden 20 Min. in 4% Paraformaldehyd nachfixiert, 2x 5 Min. in PBS gewaschen, für 7,5 Min. mit Proteinase K (19µg/ml; Sigma, St. Louis, USA) behandelt. Anschließend wurden die Schnitte 5 Min. in 4% Paraformaldehyd nachfixiert, für einige Sek. in H2O gespült, 10 Min. mit 0,25% Acetanhydrid (T.J.Baker, Holland) in Triethanolamin (pH 8) acetyliert, je 5 Min. mit PBS und 145 mM NaCl gewaschen und anschließend in einer aufsteigenden Ethanolreihe (30%, 50%, 70%, 85%, 95%, 2x 100%) entwässert. Nach einer Std. Lufttrocknung wurden die Schnitte mit einem Hybridisierungsgemisch beschichtet, das aus 50% Formamid, 1 mM DTT, 2x SSC, 10% Dextransulfat, 1mg/ml Lachssperma-DNA (Sigma, St. Louis, USA), und der jeweiligen (35S)-markierten Riboprobe bestand. Pro Objektträger wurden zwischen 2,4 und 3,2x 106 Szintillationszähleinheiten/Min. appliziert. Es wurden jeweils Sense- und Antisense-Hybridisierungen durchgeführt. Die Schnitte wurden durch Abdecken mit Parafilm vor Austrocknung geschützt und bei 50°C über Nacht inkubiert.

3.3.2.4 Entfernen nicht hybridisierter Riboproben

Nach einem ersten Waschschritt in 5x SSC/10 mM DTT für 20 Min. bei 50°C wurde der Parafilm mit einer Kanüle vorsichtig von den Schnitten entfernt. Ein hochstringenter Waschschritt über 20 Min. in 50% Formamid/2x SSC/10 mM DTT bei 65°C war gefolgt von zwei 10-minütigen Waschschritten bei 37°C in 0,5 M NaCl/5 mM EDTA [pH 8]/10 mM Tris-HCl [ph 7,5]. Zum Verdau nicht-hybridisierter Riboproben wurde anschließend bei 37°C eine 20-minütige Inkubation mit RNAse (Sigma, St. Louis, USA) durchgeführt, wonach die Schnitte noch einmal 30 Min. bei 37°C in derselben NaCl/EDTA/Tris-HCl-Lösung gewaschen wurden. Nach einem abschließenden Waschschritt für 15 Min. bei Raumtemperatur in 0,1x SSC wurden die Schnitte in einer aufsteigenden Ethanolreihe entwässert (Konzentrationen wie am Vortag) und danach luftgetrocknet.

3.3.2.5 Detektion der hybridisierten Sonden


26

Für die autoradiographische Entwicklung wurden die Objektträger unter Lichtabschluß mit einer 50%-wäßrigen NTB-2 Emulsion (Eastman, Kodak, Rochester, USA) bedeckt und für zwei Wochen bei -20°C exponiert. Danach wurden die Signale mit D-19 Entwickler (Kodak, Rochester, USA) entwickelt und mit Unifix (Kodak, Rochester, USA) fixiert. Nach einer Gegenfärbung mit Hämatoxylin-Eosin (Sigma, St. Louis, USA) wurden die Schnitte mit Eukitt eingedeckt und mikroskopisch mit Durchlicht oder Auflicht analysiert.

3.4 Immunhistochemie

3.4.1 Verwendete Primärantikörper

Die polyklonalen Antikörper, die in der vorliegenen Arbeit verwendet wurden, sind bereits eingesetzt und charakterisiert worden. Der Antikörper gegen NCC (freundlichst überlassen von Prof. Dr. D. Ellison, Denver, USA) war gegen ein Fusionsprotein, welches das gesamte N-terminale Ende des NCC der Maus umfaßte, generiert worden [Bostanjoglo et al. 1998]. Der Antikörper gegen 11HSD (freundlichst überlassen von Dr. B. Reeves, New Haven, USA) war gegen ein Fusionsprotein generiert worden, welches mit dem humanen 11HSD korrespondiert [Bostanjoglo et al. 1998, Kyossev et al. 1996]. Für die Herstellung der Antikörper gegen die drei Untereinheiten von rENaC (freundlichst überlassen von Prof. Dr. B. Rossier, Lausanne, Schweiz) waren Fusionproteine des N-terminalen Endes von alpha-rENaC und des C-terminalen Endes von beta- und gamma-rENaC verwendet worden [Duc et al. 1994]. Dabei wurde die stärkste Immunreaktivität mit dem Antikörper gegen die beta-Untereinheit erzielt. Alle genannten Antikörper waren im Kaninchen erzeugt worden, während der Antikörper gegen NaCa (freundlichst überlassen von Dr. R. Reilly, Denver, USA) im Meerschweinchen gegen ein Fusionsprotein des Kaninchen-NaCa hergestellt worden war [Reilly et al. 1993]. Die Antikörper gegen NaCa und rENaC wurden in einer Verdünnung von 1:100, der Antikörper gegen NCC in einer Verdünnung von 1:200 und der Antikörper gegen 11HSD in einer Verdünnung von 1:200-1:1000 eingesetzt. Der Antikörper gegen erythrozytäre Bande 3, (freundlichst überlassen von Dr. Jöns, Berlin) diente als Kontrollmarker für Schaltzellen Typ A [Alper et al. 1989, Madsen et al. 1992] und wurde in einer Verdünnung von 1:3000 verwendet.


27

3.4.2 Antikörperinkubation und Antikörperdetektion

Für die Immunhistochemie wurden Gefrierschnitte einer Dicke von 4-7 µm verwendet. Die Gefrierschnitte wurden auf Chromgelatine-beschichtete (Kaliumchromsulfat-12-Hydrat, Riedel-de Haen) Objektträger aufgebracht, ca.1 Std. bei Raumtemperatur luftgetrocknet und anschließend zum Blocken unspezifischer Proteinbindungsstellen mit Blocking-Medium für ½ Std. bei Raumtemperatur in einer feuchten Inkubationskammer inkubiert. Als Blocking-Medium diente entweder 5% Milchpulver (Magermilch, Glücksklee) verdünnt in PBS oder 2% bovines Serum-Albumin in PBS. Nach Entfernen des Blocking-Mediums wurden die Schnitte mit den jeweiligen Primärantikörpern, die entsprechend den unter 3.4.1 angegebenen Konzentrationen in PBS verdünnt worden waren, überschichtet und für 1- 2 Std. bei Raumtemperatur auf einem Schüttler inkubiert. Anschließend wurden die Schnitte über Nacht bei 4°C gelagert. Nach der Primärantikörperinkubation wurden die Schnitte sorgfältig gespült (3x 8 Min. in PBS) und mit den jeweiligen Sekundärantikörpern beschichtet.

Die verwendeten Sekundärantikörper waren entweder direkt fluoreszenzmarkiert oder waren Bestandteil des Peroxidase-Antiperoxidase Systems (PAP). An fluoreszenzmarkierten Antikörpern kamen Cy3-konjugiertes Ziege anti-Kaninchen IgG Serum, Verdünnung 1:250 in PBS, und Cy2-konjugiertes Ziege anti-Meerschweinchen IgG Serum, Verdünnung 1:60 in PBS (beide Antikörper von DIANOVA, Hamburg) zum Einsatz.

Nachdem die ungebundenden Antikörper nach 1 Std. Inkubation durch 3x 5 Min. Waschen in PBS entfernt worden waren, wurden die Schnitte mit PBS/Glycerin (pH 8,6) eingedeckelt und fluoreszensmikroskopisch (Leica DMRB mit Auflicht-Fluoreszenszusatz) analysiert und photografiert.

Das verwendete PAP-System bestand aus einem Schwein Anti-Kaninchen IgG Serum, mit dem die Schnitte für 30 Min. in einer Verdünnung von 1:20 in PBS inkubiert wurden und dem PAP-Komplex (Kaninchen Anti-Peroxidase IgG Serum plus Peroxidase), mit dem die Schnitte für weitere 30 Min. in einer Verdünnung von 1:100 inkubiert wurden (beide Präparate von DAKO, Glostrup, Dänemark). Das enzymatische Signal wurde mit 0.1% Diaminobenzidin (Sigma, St. Louis, USA) und 0,02% H2O2 (Merck, Darmstadt) in PBS generiert. Die Schnitte wurden mit Eukitt eingedeckelt.

Kontrollen wurden bei jedem Experiment durch den Austausch des Primärantikörpers mit Praeimmunserum (für die Antikörper gegen NCC und rENaC) oder mit PBS (für die


28

Antikörper gegen NaCa und 11HSD) durchgeführt.

3.5 Kombinierte In situ-Hybridisierung und Immunhistochemie

Sollte der Nachweis von mRNA mittels In situ-Hybridisierung mit einem immunhistochemischen Nachweis kombiniert werden, so wurde zuerst die In situ-Hybridisierung bis zum Schritt der Inkubation mit dem Antikörper-Blocking-Medium, wie oben beschrieben, durchgeführt. Im folgenden wurde der Anti-Digoxigenin-Antikörper zusammen mit dem jeweiligen Proteinantikörper appliziert. Nach einem Waschschritt (2x 15 Min. in PBS) wurde der Primärantikörper wie unter 3.4.2 beschrieben mit einem Sekundärantikörper fluoreszensmarkiert. Anschließend wurde die enzymatische Reaktion zum Entwickeln des In situ-Hybridisierungssignals gestartet.

Alternativ wurde der immunhistologische Nachweis im Anschluß an die abgeschlossene In situ-Hybridisierung, d.h. nachdem das In situ-Hybridisierungssignal bereits entwickelt war, durchgeführt.


[Titelseite] [Abkürzungsverzeichnis] [1] [2] [3] [4] [5] [6] [Bibliographie] [Selbständigkeitserklärung] [Lebenslauf] [Anhang]

© Die inhaltliche Zusammenstellung und Aufmachung dieser Publikation sowie die elektronische Verarbeitung sind urheberrechtlich geschützt. Jede Verwertung, die nicht ausdrücklich vom Urheberrechtsgesetz zugelassen ist, bedarf der vorherigen Zustimmung. Das gilt insbesondere für die Vervielfältigung, die Bearbeitung und Einspeicherung und Verarbeitung in elektronische Systeme.

DiML DTD Version 2.0
Zertifizierter Dokumentenserver
der Humboldt-Universität zu Berlin
HTML - Version erstellt am:
Mon Feb 19 17:53:03 2001